–_004_AM6PR10MB2822DF85DD303493B6A5CF04FC019AM6PR10MB2822EURP_
Content-Type: multipart/alternative;
boundary= »_000_AM6PR10MB2822DF85DD303493B6A5CF04FC019AM6PR10MB2822EURP_ »

–_000_AM6PR10MB2822DF85DD303493B6A5CF04FC019AM6PR10MB2822EURP_
Content-Type: text/plain; charset= »us-ascii »
Content-Transfer-Encoding: quoted-printable

–_000_AM6PR10MB2822DF85DD303493B6A5CF04FC019AM6PR10MB2822EURP_
Content-Type: text/html; charset= »us-ascii »
Content-Transfer-Encoding: quoted-printable

 

–_000_AM6PR10MB2822DF85DD303493B6A5CF04FC019AM6PR10MB2822EURP_–

–_004_AM6PR10MB2822DF85DD303493B6A5CF04FC019AM6PR10MB2822EURP_
Content-Type: application/pdf; name= »DINERS + SPECTACLES.pdf »
Content-Description: DINERS + SPECTACLES.pdf
Content-Disposition: attachment; filename= »DINERS + SPECTACLES.pdf »;
size=1374826; creation-date= »Thu, 10 Nov 2022 23:08:10 GMT »;
modification-date= »Thu, 10 Nov 2022 23:08:11 GMT »
Content-Transfer-Encoding: base64

JVBERi0xLjUNJeLjz9MNCjM3OCAwIG9iag08PC9MaW5lYXJpemVkIDEvTCAxMzc0NTkwL08gMzgw
L0UgMTM1ODIyMC9OIDEvVCAxMzY2OTE0L0ggWyAxODE2IDMyOV0+Pg1lbmRvYmoNICAgICAgICAg
IA14cmVmDQozNzggNzYNCjAwMDAwMDAwMTYgMDAwMDAgbg0KMDAwMDAwMjMyOSAwMDAwMCBuDQow
MDAwMDAyNDg1IDAwMDAwIG4NCjAwMDAwMDM3MTIgMDAwMDAgbg0KMDAwMDAwNDQyNiAwMDAwMCBu
DQowMDAwMDA1MTEwIDAwMDAwIG4NCjAwMDAwMDU4MzggMDAwMDAgbg0KMDAwMDAwOTQ4OSAwMDAw
MCBuDQowMDAwMDEzMDA4IDAwMDAwIG4NCjAwMDAwMTY3MDUgMDAwMDAgbg0KMDAwMDAyMDEwOCAw
MDAwMCBuDQowMDAwMDIzNjk4IDAwMDAwIG4NCjAwMDAwMjc0NjEgMDAwMDAgbg0KMDAwMDAzMDk4
OCAwMDAwMCBuDQowMDAwMDM0NTE0IDAwMDAwIG4NCjAwMDAwMzQ2MjggMDAwMDAgbg0KMDAwMDAz
NDc0MCAwMDAwMCBuDQowMDAwMDM0ODY0IDAwMDAwIG4NCjAwMDAwMzQ5ODggMDAwMDAgbg0KMDAw
MDAzNTA3MiAwMDAwMCBuDQowMDAwMDM5MzM3IDAwMDAwIG4NCjAwMDAwMzk4NjkgMDAwMDAgbg0K
MDAwMDA0MDQ3MCAwMDAwMCBuDQowMDAwMDQwNTU1IDAwMDAwIG4NCjAwMDAwNDM4NzggMDAwMDAg
bg0KMDAwMDA0NDM2NSAwMDAwMCBuDQowMDAwMDQ0OTEyIDAwMDAwIG4NCjAwMDAwNDUwMDAgMDAw
MDAgbg0KMDAwMDA0OTM1NSAwMDAwMCBuDQowMDAwMDQ5OTEyIDAwMDAwIG4NCjAwMDAwNTA1MzQg
MDAwMDAgbg0KMDAwMDA1MDY1MSAwMDAwMCBuDQowMDAwMDUwNzYzIDAwMDAwIG4NCjAwMDAwNTA4
NzAgMDAwMDAgbg0KMDAwMDA1MTAxNiAwMDAwMCBuDQowMDAwMDUxMTY1IDAwMDAwIG4NCjAwMDAw
NTE0OTIgMDAwMDAgbg0KMDAwMDA1MTgxMSAwMDAwMCBuDQowMDAwMDUyMTI2IDAwMDAwIG4NCjAw
MDAwNTIzNTMgMDAwMDAgbg0KMDAwMDA1MjUyNiAwMDAwMCBuDQowMDAwMDUyNjI5IDAwMDAwIG4N
CjAwMDAwNTI3MzQgMDAwMDAgbg0KMDAwMDA1Mjg0MSAwMDAwMCBuDQowMDAwMDUyOTQ3IDAwMDAw
IG4NCjAwMDAwNTMwNTIgMDAwMDAgbg0KMDAwMDA1MzE1NyAwMDAwMCBuDQowMDAwMDUzMjYyIDAw
MDAwIG4NCjAwMDAwNTMzNjggMDAwMDAgbg0KMDAwMDA1MzQ3OSAwMDAwMCBuDQowMDAwMDUzNzc2
IDAwMDAwIG4NCjAwMDAwNTM5MjUgMDAwMDAgbg0KMDAwMDA1NDAwMyAwMDAwMCBuDQowMDAwMDg5
NzMzIDAwMDAwIG4NCjAwMDAwODk3NzIgMDAwMDAgbg0KMDAwMDA5NTg3MiAwMDAwMCBuDQowMDAw
MDk1OTUwIDAwMDAwIG4NCjAwMDAwOTYyMTQgMDAwMDAgbg0KMDAwMDA5NjI5MiAwMDAwMCBuDQow
MDAwMDk2NTU2IDAwMDAwIG4NCjAwMDAwOTY2MzQgMDAwMDAgbg0KMDAwMDA5NjkwMiAwMDAwMCBu
DQowMDAwMDk2OTgwIDAwMDAwIG4NCjAwMDAwOTcyNDYgMDAwMDAgbg0KMDAwMDA5NzMyNCAwMDAw
MCBuDQowMDAwMDk3NTkyIDAwMDAwIG4NCjAwMDAwOTc2NzAgMDAwMDAgbg0KMDAwMDA5NzkzNiAw
MDAwMCBuDQowMDAwMTEyNjIyIDAwMDAwIG4NCjAwMDEzMjU1ODMgMDAwMDAgbg0KMDAwMTMyNzky
MSAwMDAwMCBuDQowMDAxMzMwMjU5IDAwMDAwIG4NCjAwMDEzMzg5NzAgMDAwMDAgbg0KMDAwMTM1
ODE1OCAwMDAwMCBuDQowMDAwMDAyMTQ1IDAwMDAwIG4NCjAwMDAwMDE4MTYgMDAwMDAgbg0KdHJh
aWxlcg08PC9TaXplIDQ1NC9Sb290IDM3OSAwIFIvSW5mbyA3IDAgUi9JRFs8NEI5QTJGM0VDRTRC
NDFDNDlEOTgzNjk2N0ZCRTQ4Q0M+PDE1OUQ1NjkyOUJCNDRBMTE4NjFEQUFCODFEMzY1RUM5Pl0v
UHJldiAxMzY2OTAyL1hSZWZTdG0gMjE0NT4+DXN0YXJ0eHJlZg0wDSUlRU9GDSAgDTQ1MyAwIG9i
ag08PC9DIDI2MS9GaWx0ZXIvRmxhdGVEZWNvZGUvSSAyODMvTGVuZ3RoIDI0Mi9TIDM5Pj5zdHJl
YW0NCmjeVI8xSwNBEIW/2Vu5vRhDhDMJaLHiBQsbIaApD23SBGwsbMRSUOTsbIQtBO38AxYHNnba
CCnPUn9AQuztLSwsUrg5RMyD13zzeDMD9MCcAvHjiFkpb40pZmDv17DOEm3LQzFXYaMe1tg6ktd0
IeHsO7hnOWX8SdtJQiVnHznW1gXvrFmadPboIhPkRm+jqySZb/NJ4zghyPwCtcliyiGqhYEdlKVe
cIW2rCJVIkRNk9FLY+hvmR867lixviY0RIW8oTLOS5hPYavW/wi+uH3Sl+7aRQe5v+KfhHiwW75L
U/3RkHh8UU7h+UeAAQDRnitRDWVuZHN0cmVhbQ1lbmRvYmoNNDUyIDAgb2JqDTw8L0RlY29kZVBh
cm1zPDwvQ29sdW1ucyAzL1ByZWRpY3RvciAxMj4+L0ZpbHRlci9GbGF0ZURlY29kZS9JbmRleFs4
IDM3MF0vTGVuZ3RoIDM1L1NpemUgMzc4L1R5cGUvWFJlZi9XWzEgMSAxXT4+c3RyZWFtDQpo3mJi
YmRgYmBgHMWDBTPOHQ2D0fgYxaPxQQoGCDAAfNoGMA1lbmRzdHJlYW0NZW5kb2JqDTM3OSAwIG9i
ag08PC9MYW5nKGZyLUZSKS9NYXJrSW5mbzw8L01hcmtlZCB0cnVlPj4vTWV0YWRhdGEgNiAwIFIv
UGFnZXMgNSAwIFIvU3RydWN0VHJlZVJvb3QgOCAwIFIvVHlwZS9DYXRhbG9nL1ZpZXdlclByZWZl
cmVuY2VzPDwvRGlyZWN0aW9uL0wyUj4+Pj4NZW5kb2JqDTM4MCAwIG9iag08PC9BcnRCb3hbMC4w
IDAuMCAxMTkwLjU1IDg0MS44OV0vQmxlZWRCb3hbMC4wIDAuMCAxMTkwLjU1IDg0MS44OV0vQ29u
dGVudHNbMzg0IDAgUiAzODUgMCBSIDM4NiAwIFIgMzg3IDAgUiAzODggMCBSIDM4OSAwIFIgMzkw
IDAgUiAzOTEgMCBSXS9Dcm9wQm94WzAuMCAwLjAgMTE5MC41NSA4NDEuODldL0dyb3VwIDQ1MSAw
IFIvTWVkaWFCb3hbMC4wIDAuMCAxMTkwLjU1IDg0MS44OV0vUGFyZW50IDUgMCBSL1BpZWNlSW5m
bzw8L0luRGVzaWduPDwvRG9jdW1lbnRJRDxGRUZGMDA3ODAwNkQwMDcwMDAyRTAwNjQwMDY5MDA2
NDAwM0EwMDYxMDAzOTAwMzAwMDYyMDAzNTAwMzEwMDMzMDA2NDAwMkQwMDYxMDAzMTAwMzMwMDM1
MDAyRDAwMzQwMDM5MDAzOTAwMzMwMDJEMDAzOTAwNjUwMDMzMDAzNDAwMkQwMDY2MDAzMTAwMzgw
MDM2MDAzNjAwMzIwMDM2MDAzOTAwNjUwMDYxMDA2MjAwMzM+L0xhc3RNb2RpZmllZDxGRUZGMDA0
NDAwM0EwMDMyMDAzMDAwMzIwMDMyMDAzMTAwMzEwMDMwMDAzNDAwMzEwMDM1MDAzMzAwMzIwMDMy
MDAzOTAwNUE+L051bWJlcm9mUGFnZXMgMi9PcmlnaW5hbERvY3VtZW50SUQ8RkVGRjAwNzgwMDZE
MDA3MDAwMkUwMDY0MDA2OTAwNjQwMDNBMDA2NjAwNjYwMDM5MDAzNzAwNjQwMDY2MDAzODAwMzkw
MDJEMDAzMjAwNjYwMDM5MDAzMDAwMkQwMDM0MDA2MTAwNjIwMDY2MDAyRDAwNjEwMDMyMDAzNDAw
MzkwMDJEMDAzOTAwMzEwMDY1MDAzMDAwNjQwMDYxMDA2NTAwNjUwMDY1MDAzNjAwMzIwMDY0Pi9Q
YWdlVUlETGlzdDw8LzAgMjMzLzEgMjM0Pj4vUGFnZVdpZHRoTGlzdDw8LzAgNTk1LjI3Ni8xIDU5
NS4yNzY+Pj4+Pj4vUmVzb3VyY2VzPDwvRXh0R1N0YXRlPDwvR1MwIDM5MiAwIFIvR1MxIDM5MyAw
IFIvR1MyIDM5NCAwIFIvR1MzIDM5NSAwIFI+Pi9Gb250PDwvVDFfMCAzODEgMCBSL1QxXzEgMzgy
IDAgUi9UMV8yIDM4MyAwIFI+Pi9Qcm9jU2V0Wy9QREYvVGV4dC9JbWFnZUNdL1NoYWRpbmc8PC9T
aDAgNDEyIDAgUi9TaDEgNDE3IDAgUi9TaDIgNDI4IDAgUj4+L1hPYmplY3Q8PC9GbTAgNDMyIDAg
Ui9GbTEgNDM0IDAgUi9GbTIgNDM2IDAgUi9GbTMgNDM4IDAgUi9GbTQgNDQwIDAgUi9GbTUgNDQy
IDAgUi9GbTYgNDQ0IDAgUi9JbTAgNDQ2IDAgUi9JbTEgNDUwIDAgUj4+Pj4vUm90YXRlIDAvU3Ry
dWN0UGFyZW50cyAwL1RyaW1Cb3hbMC4wIDAuMCAxMTkwLjU1IDg0MS44OV0vVHlwZS9QYWdlPj4N
ZW5kb2JqDTM4MSAwIG9iag08PC9CYXNlRm9udC9MUkJGUlErTXVzZW9TYW5zLTMwMC9FbmNvZGlu
ZyAzOTYgMCBSL0ZpcnN0Q2hhciAzMS9Gb250RGVzY3JpcHRvciAzOTggMCBSL0xhc3RDaGFyIDIz
OC9TdWJ0eXBlL1R5cGUxL1RvVW5pY29kZSAzOTkgMCBSL1R5cGUvRm9udC9XaWR0aHNbNTUyIDI2
OSAwIDAgMCAwIDczMCAwIDAgMCAwIDAgNjg4IDI0NCA0OTIgMjQ3IDAgNjI1IDQ2NiA1NjUgNTYy
IDAgNTU4IDU5NSAwIDAgNTk0IDI5MyAwIDAgMCAwIDAgMCA2MTYgNjI2IDcyOCA3NDAgNTcxIDAg
NzU4IDAgMCAwIDYwMSA1MTggODU0IDAgODI0IDU5OCAwIDYyOCA1MzggNTg4IDAgNjE4IDAgMCAw
IDAgMCAwIDAgMCAwIDAgNTIwIDU4OSA1NDkgNTg5IDU1MyAzMjAgNTgyIDU5MyAyMzIgMCA1MDIg
MjQ3IDkxNiA1OTMgNjIyIDU4OSA1ODkgMzU2IDQ0MyAzMzUgNTg4IDQ4NSA4MDEgNDkxIDQ5OSA1
MDkgMCAwIDAgMCAwIDU5MCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMjA5IDMz
NSAzMjkgNDAxIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAw
IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAg
MCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCA1MjAgMCA1MjAgMCAw
IDAgMCA1NTAgMCA1NTMgMCAwIDAgMCAyMzJdPj4NZW5kb2JqDTM4MiAwIG9iag08PC9CYXNlRm9u
dC9MUkJGUlErTXVzZW9TYW5zLTcwMC9FbmNvZGluZyA0MDAgMCBSL0ZpcnN0Q2hhciAzMS9Gb250
RGVzY3JpcHRvciA0MDIgMCBSL0xhc3RDaGFyIDIzNC9TdWJ0eXBlL1R5cGUxL1RvVW5pY29kZSA0
MDMgMCBSL1R5cGUvRm9udC9XaWR0aHNbNjk0IDI0MyAwIDAgMCAwIDAgMCAwIDMxMCAzMTAgMCA2
MzMgMjY1IDQ1NyAyNTcgMCA2MjkgNTEyIDAgMCAwIDAgMCAwIDAgMCAyODggMCAwIDAgMCAwIDAg
NjM3IDY0MiAwIDczOSA1NzUgNTI5IDc2MCAwIDMwOSAwIDAgNTM5IDg3OCA3NjAgODE2IDYxNCAw
IDY1OCA1NTQgNjAzIDAgNjQ0IDAgMCAwIDAgMCAwIDAgMCAwIDAgNTM0IDYxMSA1NDUgNjExIDU1
NCAwIDYwNCA2MTMgMjY3IDI2NyAwIDI4NCA5MTMgNjEzIDYyNSA2MTEgMCAzOTMgNDUyIDM3NyA2
MDkgNTE5IDAgNTI0IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAg
MCAwIDAgMjMxIDQwMSAzOTUgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAw
IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAg
MCAwIDAgNTc1IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCA1
MzQgMCAwIDAgMCAwIDAgMCAwIDU1NCA1NTRdPj4NZW5kb2JqDTM4MyAwIG9iag08PC9CYXNlRm9u
dC9MUkJGUlErTXVzZW9TYW5zLTUwMC9FbmNvZGluZyA0MDQgMCBSL0ZpcnN0Q2hhciAzMC9Gb250
RGVzY3JpcHRvciA0MDYgMCBSL0xhc3RDaGFyIDIzOS9TdWJ0eXBlL1R5cGUxL1RvVW5pY29kZSA0
MDcgMCBSL1R5cGUvRm9udC9XaWR0aHNbNjcyIDU4NSAyNTcgMCAwIDAgMCAwIDAgMCAwIDAgMCAw
IDI1NSA0NzIgMCAwIDYyNSA0ODkgNTcyIDAgMCAwIDU5OSA1MjkgNjA3IDU5OSAyOTIgMCAwIDAg
MCAwIDAgNjI4IDYzNCA3MjIgMCA1NzMgNTIxIDc2MCAwIDI5MSA1MzcgMCA1MjkgODY2IDc1NyA4
MjEgNjA3IDAgNjQxIDU0NiA1OTMgNzI4IDYzMiAwIDAgMCAwIDAgMCAwIDAgMCAwIDUyOCA2MDAg
NTQ3IDYwMSA1NTUgMzM2IDU5MyA2MDMgMjQ5IDI0OCA1MjYgMjY1IDkxNCA2MDMgNjI0IDYwMCA2
MDEgMzc1IDQ0OCAzNTggNTk4IDUwMiA4MTQgNTA4IDUxMCA1MTcgMCAwIDAgMCAwIDU5MSAwIDAg
MCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMjE5IDM2OSAzNjAgMCAwIDAgMCAwIDAgMCAw
IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAg
MCAwIDAgMCAwIDAgMCAwIDAgNjI4IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAwIDAgMCAw
IDAgMCAwIDAgMCAwIDAgMCAwIDAgMCA1MjggMCA1MjggMCAwIDAgMCA1NDggNTU1IDU1NSA1NTUg
NTU1IDAgMCAwIDI0OV0+Pg1lbmRvYmoNMzg0IDAgb2JqDTw8L0ZpbHRlci9GbGF0ZURlY29kZS9M
ZW5ndGggMzU4MD4+c3RyZWFtDQpIiaRXa2/jNhb9bmD+A78sEGMnCh+iSA6KAjOZB2Y303nE6Bao
FwvFlh1t9XAlK53ur99zSUuWM0mq7iJATFLkfd9z7714m2+7JmPffXfx4fL9a8bZ99+/en3JZr/O
ODZCOB5pLZmNRWQda7LZP1iFjxfvrjnbtjNcUBFXPImtYvTCxnHEE2WUEOxcRFI5I/AeS24N51Ky
VTm7eF9y9rqefZ69+QBenz0v+vtlIHzC3Vgwt8R94wUzYGqUPF6IbSS0PYoHEjMhBT0z+iDZ+fjg
XMSRAAlh7IGakFx44V79xC6ubzlrb9mbn9jn2cX1Lq3IQFdptWVnm+b87Zd5sJborfV59moxu1iI
f0FottjMpPAs8QPlI8O1YFbwKJE2YYtydvZ6qXRSZU3L/sraXbbap6simy/+PXuzCCZ5gqnsmYLl
kY9SPLJcqRM+P5+xpZRqbtjZVcY+FWne5g1bZ+xL3swTdpbhazz/5+JvR7734kEd40HBxgmM5ciT
DDYTxjGVRMrJo+H9MYIljr1g4bNWTjH/nIvYDjQkPBaCQYyC4QnN4xNzh4gRIWYExQw5QAQHOP/R
sSSWkdVaM20iLp0OVll8WSrBr9n7D58+flnMEduCnb38YcFenBrjcVH0yAkjv/dsjVSRTZQdsz1j
Ex2c3KMt7tNOImlje6rS67Rq2eo2XXUVObiqW1ZmVdc+x7Jr2a7u7mrcuPObpt7VbUaRgE2RzhU7
2+N13TRZu6urdVrt2VLFHNdbts6XXBkErGiyap+1U01kRmoc3QFIgMjxWPTsa77NqhVkWXVFXqU5
pHge+BcppKrW+T6vvVpFBuFJlLsagdxf8SdttnzWzJHkEQL7LuiEVxGbKq992qVOwKXKxqeyX3ZI
qSpjmzTfZ6xEgkHQrsp/7TKYf8+8HHfZKpjaJ1297nJYe9PgcjRVOPegMV3kFGJbncT2HKszcjPF
wF1eeVYVbGXAkGV7ipJyl24rSNSS5QrgT07BQfJFMR7f5VlVkfgw+V2Om/QBKUKX8mpNj3aZDxNP
cJ2Fp3Rj1+T0eZ8eEKZlhy90uqqLPT2arLbgD+mdqEgrgLgc6/2p7hrEBwSq5ooYbrx4kK2syQhY
gBqy5LmXSAaJ1t2qjy3N/0LuoqfkMMqjA0p7EL3eeQ3ytGB/z9cEnN6WdbkjlUCgzM+RS6uMwS6T
k0SIhxQ0cWSEsEyMFUTsl3mVl13J8hL5S+JE7CpFgh4UCn5kbTa2OfL8zifOundRvg9WCYkN9XyW
Eck+zw7Y4X3bHQvUdLeNa9S3tR2ZpAN40yKBG1HHY1QulAWOLsOr+3K16rK88H5ztyHXJb8lX2hG
9VPcdF68o5foCu4qHi5de7mXzyD5UAZHNbAZ1UDaS9FzUbeTFVUjRU/VMpI6DOkYqnKkB7V+nEM8
pMU+9xlCDslYfVPk2wBZ9UEqRiEm69W+vjkceNkCnjSwywvA01JyznZpw3ZoJWqk7GS5428c9Egh
PecRx2LF+uCkfibh8rT6XHe7XUE+IdCjatO2+Q0l467PyhBQ3g3nQkSOAagslG/SgO59Qr3DgzKt
QoItzwAnX080ZCk45av0pjhYpCA7ZdXyWZuVdIiI2DZ1t8uW88nW+INqLqyOJDfqFPrRUW0hgfRu
y9IueCytqvwOsvb41wueFrnPWPgt+T/8ljwAF05HlqQ6KQNXlNOwAkX2APiMwCAnGzUBs465TfEk
g2A+ea7mBuJ7jTzwNfDShkHL1W0Nl/zuEaNBQfntNm9/+f34fLIqD/UHwqFhTMBe3rM0TNrnRcY+
1NVN+p+8ANoGjY5lFops5lTCoOW2SdvB3JPFsg9Z2KJr4ckpHn/JSo/3ZSiUh1p7BE/y7wt2eYtQ
hZlezlGVP15SiL+qGxJxjZj5yq59+LA3ZV4Q9r6DY9bssumGBy+obH2rwb0+XbgHBzfxzeDGKZdp
PEKuyzBoLa4u3p7MY6e31OjWoVHHwIb2lvHI0T9uDP1HbI4gHiMPGm+MbomJjMbApWA8i5vn0kYo
cGGYe2rM4Q/XEKSnDOnphRRJ5LQOE16/tjyOnNUxMzHqonYutN9sagMux0UZYidhmAkriyGSa4DB
mPjPZz1uDZXmLfmvKwoPZOcM9/5MGMpxBcXUKr0EfiE4TyKewOOn6k1VblyyBnQPv7+xb1jZSEmL
agZ3qjgZesxzhWRcXE5W56TeRAkyHSyF9OGjxMGvo5IjQwBCIhdpIJHPQ7+ymOjQGyGypD5qjxzp
sbTt26SpBnkE/UN4YV4R8aGsH9YuVpHhNMeOJZhs/zGECxjBqGDxfu3gVa0wO/5v5M09bQ7JAuqq
Z4MMUXEUc/Re1kUJRzYSi6FkbOpiqK44ywDz2VT29lS7MU8gkkyQQdTeDkwn6+UeJWyciHis/Fyg
BmWoytVsS2kJzH3hK8NQFdAkXHdr9rFDIzZRAMUf1wyRITiCOkFzxHsJwBU827Qrget+2mM/1M0d
FdMt5iu26UrfEEzlLyZYllqAP2tZJZ+wLHLVGIEeXSPkj3Gyy/Zh3m1K+q1XpElahW4jvaHSDPN6
padKoR5Xj7sojq1hiaCoBfQezbtJy6zzHSKV4RxTgO/CXnbbDi12NZV5/Me2RSIemU+2rX7ctiaB
SVEhtbWInmBb9DpzrELfhR4628O6m4Z6hLpM0W5q7jcZ9RFtSm0RerlwcuyGb7u86AeIAt3oVJRW
yQQzGDVIO90M5nHCBAZCJ0wnaBgeMMPH0H6mk5WYgEA61gOv6Uo8jkDWgJ4zGI6Aq/qoBCUDOWdD
KkxVIH4CaAYFhBv4TFYgfgJBMKM6aSzDoEqjzkGBH/OKMhoNa2hWQyB2W2R8x26KtFqhTY2pTZ2s
3BNgg1qkBXAgxhDgBhkQ6DRcLbkyxd4LQMbEXFWkYfIiWXyM7Al2qv0hE9Z5uxqu04Q5WcQnkKi3
f2zFIOJ0+z+OMsaiWwdlTJh8qI3jIS4MbMV4YOsbTUTZpwJAmzfkqy95gANqO5+cGGJ9nBioSYdW
hgqoZaXfK2DX4YC2HH2j33K6B+gS4b4AaKxm908KnCCvNZFASRTS/zoEmNEWUwPRFFGMmma0iTR4
E43Tk8KfGOpztYt8x4e9p5HQ0OG3iRCBFJIvkBifEAkeGWs8e+HZO4wlid97XhbTifXbBKEHEvdO
QEL7mdQTVY5IIMcxvdLNxOAcRd86ooUaiV+icXpCNPBW0RuFfhe/sfNf6NdioDQx+m1OM4VBj+lp
3Dsp/Il3CsDLKee/CISMoQkvUYEWWQntKZfeK/dOSA40mdz6E2KLrRVEEoVVSr93JvYsYlxbze6f
FF45FVs/fDivvkKXmngVHI1FME9sPKkEgwORODkgCqBFoQFKhrybgHSwllLS+99Y4c//y3i149ht
BMF8T8ELCJr/JzXgAwgOpHwDK+A68f0B16e1jyRgw9FuFx+bPdNVNT0sjhnuyClk5KV38ph6Yqag
GOUkobOuLbNGigtwqs+t+WLT9FVwLLvMvbY4lslTxt0cvyMkF9guRvCrS+wfwYwsDqGqVszX/Esm
L+AU0MpUvYvrGB2XSy2rqwhcZGt8AD97f3siFtpaS7uZx1aKQuKgzOaMezczrllnd8RVlO6V5T5V
dxrem0JaIF6+AtYey3jFfn9C9SphTvvFsDJGr4pHcsN3LOOOMMeCprfoU+U1oNMeZgV/OXA67KpO
c2uY446cQsYwo4bemDmeqzvbymbce2S4Is4wtzP06q+u5lD2tmH78UKJDBfACXY3ifMA3+DnNTlW
BsSNkgRFQqQP5BTSL97EFHRnMLSkrXgwNWJcpSLFFXEK7a88y+sQKV6GLjU4jH68gPNxIvxX9P72
/fgLZ0g6/nyjGleeCRqgJ2Faxl7ivzmxwC94OmBHCTpdlfqdaH8+2qBb1sWb7vvH228/jq9//MzH
3z+P338c3/7l8PqcVL/p+MLQ0mxfBUz4UBukQJoS/VZ96jYtcmKSqbLQan+4A9zBCn+w/w76A8b1
UFVdQyHPa4og2ykfyCmkBtLUe/yiWDiDYufz7NiMvgPMgEPUcaHPoKbRt5RbGxMi8QglxzLuyKmF
zWSrryTmpFdN5ezUOj6R5EAFapIqHojLSGIk3mU9s4VrAd8K++wK18qR4oo4RYkjMdN2EatBdDpa
jGKFPLGc4gJEQ9QBztpFLdRfSC/3ppiXREs3WnoBLArPAHRXiyJnO+cq43jSyNs5wm03qvwQMmkM
QCYHCHwkDR88dC/SiN6KcJT1i1gX5FSKHW65ZRHoLqcqHofVep9xPJaeQ99XxEtBj/2O6Igcwx0i
/Kj7qlHcHBoq3+ATPKJzmsV5lhrOii8Fvo5TZe95rIX/8bsO9TROHGW1gd7/b4XOm0InGBu9gENo
I+FINX8ijFPpjqnYSfcbipM96oFwFyZ20CSpk7swsXqPIKk5LjmmrmyzvSPOkeL47GooJ4k4y4rj
PkKzPUR6ASzzNMwaHgUScZH1VM5H+MDkIYh41hZFXJFTSxu1KQcRbsaobq/GHF43Zow3XTkeyGmk
VvuP3pj6gsahVaEimxlYr/fvCN+H1xhYHD0WRNLsoIvFLnKgx+QqhT6QU8jsMYj6lR5mtJrjumLo
TS1SXBGnyGwHk7IcVLW3LW/SJxCvmHWrq7gBsY5lpx40OGYs3pdBF2bGGNvpUU5xRZxDjiA5+atJ
EgVOcmD3fBXochTv5xVxP9a0P4lguOK14utDZm70uPUVzmFm3ZFTSE/20UH3RA676Es0da3P+P3t
+EeAAQAZe0AUDWVuZHN0cmVhbQ1lbmRvYmoNMzg1IDAgb2JqDTw8L0ZpbHRlci9GbGF0ZURlY29k
ZS9MZW5ndGggMzQ0OD4+c3RyZWFtDQpIiZxXy25cuRHd36/g0l6oxVeRLMDwwq9ggvFCsYAxMAkC
Q7FlxS15Rs4gv5+qOsU2byMIjEAL9TndPCwW68Xe+VDGCJ3aIY0Ujls/Y/477id8s/0SHrbftxhu
t5wPTKPG2EM89F5Ty/JhtJaYwkWmQxu9x1gCx3bIpVWKOdTaDqVRpFTCzf324n24fPc5hW+fw+v3
4Wp7/fZl2C7f3N3+8fgxPHt2+fblT69CHeH58xev5Jsr2bqPfmhUxaR6SBTujaiUhSgHLhQU51EN
t8GC24G7QeosRzgjjkYQyWkpH3putiJWUaIkytVwiboiHmIZLrEy0KjqqcqH2NisSCyerMOt6Ice
k+FUkmnsGdXgg3haGDmROKiz+LNAsyT5z+nQVVt2hRl7QhS4HJJ4RTVJNDvTIRKZIhTEN6w7iLW5
mMSeORpTUgKjfrRfZMPUoVHaALaYOGegUVs3Jhdbgq+TupfHIVcIJvmvAnvmCCa6QCdbUwi/KNU1
SgXubWosDDQiFagWHIT1WtVMTqYROw7aIrnGykCjENa0ijWWIOqcCDtqx/c5D9dYGWhQ89MNnEWS
BL/QUyvGDWRml1gIKPTkp++woru/ai3Aw8+epjdWxq3w06eBXQcDxwQNNm+RpNG8lZWBBg9YrhHC
EusDDo4a+4JTh3NiqyaxZ47GZHdxtMNLbHukRMCa6slKSKwMJLSWmF1SHBR39atih4UNjphcYmUg
MQqO1gfWsFYA/YVc84iS15YVglnz5Jw5GpOLbyuXoLgwdmHJF8XE7j7xDjRWBho9+VUPX1M9ZCMD
x3nxNDUWBho04MFSYEej4b8AnnvUlF1jZdwOhpOr3JPi4ZkiPzToJUCjHxIrc3TG414Yw5VPEWg4
Ns/gOjUWxs3wjC1SagxHNyvhWmbc5zxdujLQ0Gg1Zh6FEXDZNQbBXYmmxsr4WfwWUt2ZHt2jHD3u
rficM26Gx3WyaEiSZu6w3A3PAldwKTviaERkLxOx2IpE04pkuMxM4uQSKwONMpInT8UaSn4psKrW
aRW7xsocd0xiaFD0cg6z2nQOT4mVgYRVT5PwNe7g3NlwJ69WZWqsDDR6cY0CjRmByVInSwHh2XJU
YkccjUjNI9SiK9t/HLUZTt5jUhousTLQqB7VtQ5b0zxhiQ3OoM88JVYGEjPIKRdbM3OPBsxgxveN
q2usjGoUny6aba84+9FkxDJcPRIKI8j3DDTI75VqhYb7q1GCRsOKHnlqLAw0Wp6WwY7qyVYaNHt0
u2J1jZU5OpP8/GxrqLlmBm4JeMyjLAQU2D3KVr2rZAhOwqZYxW49abfQUYk9cwQzELTMzdaon+ys
1aDbNHJzhYWAQG+4xs5Y0cfJSoXD67YOIVBYGUgMGBUts6qPf92Oo5htwlGcXWJlXMLNZoIVI5Nb
kdwquEbzCxoroxokFdzdZyeRWb5jiIwWoNI07ZK7Nfeb7ZyBBqfqDNma4U2Jh9ohtaFAEhey4qPh
UrCnpdmcQbuNRIq54fca/yqwZ47OMBhrQIJjdslieLjRiqGxMqohE06Gai2ikbTna5TIeCVXM5LU
aJ/Qs03158zRmGzjnjJYUy3eBWveCSYLFMHkEgsBBR2v9bEhs6hCu3Wd+lUvy1ukGWTUizNGFbQb
NXvRNF0j5yraWAVTgW+GljHBOkS7LxYGV9JPqhxwxckwtWE4Et5EhdjDYmUQnlzddB4IT701wdXT
bOj7RTXHKUsWxhMN2BUa+fcVedvcqsoz11cGCoSD1II8s4Zm/gS2t4Z+n6bEykCiZByEPK/SwEus
JQJ2ze69ZM94ES8wPbeGjhahmSqGP64IFOI5/K2MTyqWVywFmHy6qYZHh0bvWMFzcFsIKFRLLfa6
JdZAkAkTaey+QT1NwguDaZpLcgajX7T5UviAWbu7ST6OL4QP9AMmVDwjSgQ0Wp8ZpfkZiyusjL+Q
xvBTDHvNEEHDkl7fbc09N+YLaWX8zTmQqHYP+pKzpqqa0KjZj9XnQ21l5psTd5p00JI354RaAwSm
iOiN7ow9oxJSqhvW6BfsL0/L/mK4NkRabLBiz6gEWStFNKrl2ps8mSMbzvpkoGxjoWrsGdWQLluG
MaQPH8HZkln+65zPGSVZsD7gVGPPqEbCw1A1NCpZYk3foGqHdvCh5dWT12bHc0Y0hr9kZY2N2PIL
nVJkkyb5rl/bEEdygAqJPQOJqK89YZI6anSkkeColVhwU/P0e/JLqT5eaXm8B1MwHphXFPsw3ivu
uflDt/XkGitz3DGkA5/GxsDE0OymBec5CM7gWBloUPs+f5rmHCYN9TmNzoMsBNa7BdphFPmhNF8F
cvJnH67jjHEBf1GYQxTH+dqEQXNMLzYcnDPuiJp2a6j6TEhwxOr+m+2X8LD9vsVwuzWZv1shuTUJ
1NiyFM2gJS/qFHaRSZvu0GGZi7VqmQt7qFXyQN4wWfL95n578T5cvvucwrfP4fX7cLW9fvsybJdv
7m7/ePwYnj27fPvyp1dBIuf58xev5Jsr2XpoXIpl0lmjRMq9EJK3GsLOSCEdOsfpb7SsSzkXbLOD
YO29Y+hoRicslfSMUQ2ZhbXVn9bo6yEvmvLc0MnWd1WNPSMaNlf0HaP9V+5K54jEu98kezwdTafr
Te8Y1hIms4O9+8S2oTcus4POzifrHS/ncUY1ZEYgWtZIbdP0OWl29BLf9WY7Z45wPfMZUzRfI2MG
kLLSNU2ilHQdUKUQ6SYORXRPiIKUO5vSTitIZrKxKMrIq83hu11njGoMtO8dsx5OulTWR4YfnqUt
lrz464w4CpFEoCwrMhRcUTFpNzuZdc6IRiEZrcrKVClrTH79ffebGSKmY7avTJGRbIae2mYVx0Nz
Gn+K5jNC3cFm9SmYtb96cFswqwPN9lMwnzFHuH2MM4a0lYqKlhW9yqR9IcmwWfh0+Q6/X74TqiDV
QMvMXKEdpX4X3Kf6WnxkHwlfzkkesFH+LlYCWSbRo08liyticfn3ghP3BefKRGOQuUB6nSTaqDL/
cXj8uOx4+ad3Jdx+k8/XP1++uc/h1VdZeLVFfRlgDtf6l6QTftmkIcklykmaVFxpChclSXGWVniR
hxSJqtKftst3v3140DL384eH2/Dk0+PFm788Rc2jOGvei2uzTf++bEnfkqJn1vrnXEkrCJ6vWXvD
9f32JDy9/uf2+tor6v/YKC0bJe0GELdPWae66P1gSv/65PqpxNKTxw//uPvX3deHcBGkDf41x/j0
b9d//qE987LnOEhq6Jb2oXSSwaDw/3mYsghf6Ogbrm8C/v87nO+kc0TECFR0uvSzXUhCPLl++cOH
qetNyRCMMJAeKPtKEH/ZLq/T35Ow15/Mpmw2qUFS4Xozi/Apy5klPbR1zpOnGH77+Pjt68PDx2/h
/u7h7v6P+x91Bi2GqQ0RNkTdP+nYV5E78/N/OK+W3bZhIHjPV/DoHFqID5Fib2mBHoICPQToJb4w
Mu2qkC1Fj6Cf39lVLFgG7NC9JOYm3uXsizPaYFQ8ZeT0Bsm5t6eNhAw4PWX7+Fkz1aTH77/cuzM0
akID7/oYBrOgsTEK1MAW1LkYNIrxI4iyGdsotk1dR7HWJhM1bLGr+ph8gWKJ7zQqFp83eC2sQwGP
UZMd+8uOFSgFoAhrsWpP4OybPqx17l7HKML4VzyF6jB8egwlDH1qYJslIIJecLcisvKyYwkN4bFa
LHa0mhGhNGEfAaQN3T4ehip2YrMG/IdxN/ZDdUiNrC5HBgs1Ho+eVW6G9LyKg+iDeIvdZuzutVgd
24OC/x4rtAvfo6mrtyhE6lKwOiG1Eh8yp29LrbmS2pw4OlKLp9DOAJHbl/AWGFxT9dwu226shl5s
4oQzGVV+MbjWpKiUXARfrXWmUoHZy76JNZlsCWx1iOKx+dMkJ859XJEcz//N42uv7IUCdMKBxOLH
PL5ckTJQObYYYZneU1f2xIzA2tvH1V3ZA2BPNvMOj4mZx/V59as6UPN8bbpNpH6ammvcRdGM4qUO
h1I83IMi/PyWjM5d3hnSM2tWeGrlcnIRXKyhHuqBb0DpjKKtObkDX6Yl21DVuNPwPtqbqi/nfycC
k3zFK8tlLgD43c1D7a5sC5A7qRRaCHTPHB0/jW1b0/VpV4q26fvqBZvqS3LAK1sEOdbeSDBQPSNB
z97jOytaFgHB4oBkbqeq78MON8nel6e7iQi6ywtFKeLw0grjJQE/e8mxrVFRAdB9G8shlPhkp9in
Kfhe7cYuUvAp3rxkXu8kNJGRYM1WkyjZs0Fm9miQnl6qfDpi+dDZFNOfSTOVd+eWGhYUCcVyFooF
vqlzSYPkaApLLjWGCCFz9zm3hl0sLTVbDOhv7lkz0pE82IyUEJ1YlVrkxPl3B6cWcgD9CE5Bd5CO
gkJrKsdn0FGWOJpPVmv2sDDAQQHpx9qFOgEOCjDxwjMKrHicDUgJvpHnSJAkF2cW8oGUZPQdDRKM
ixcS+EiieAirHGfajKQrHDjh5GNpqdkiSf5hBDwUAcDgN50hzhCNfFqwb2cQQ3FBziw1Wwrn2cJh
kZuCXBjUSfEZATmEyQp2sbTUDE5O4sozekhVSifIsnd6yo6hCoL7FzlciH8CDAAlmUlzDWVuZHN0
cmVhbQ1lbmRvYmoNMzg2IDAgb2JqDTw8L0ZpbHRlci9GbGF0ZURlY29kZS9MZW5ndGggMzYyNj4+
c3RyZWFtDQpIiYxXy6otxw2d76/YP+B2PfQogfHAj0AGHpgM4vkh2IG+gSTk/yNpqY+rGxI8uNyz
Vu9apVLpVX3JMWi8ldshi9/nqy89xlBnxqH27msdXckhH3MOx3YwT8dyrM7vj9eTOZOZ1nNNF00N
sthkHiM17aAeK/qhsyQ2whWsHaOvJCh2dbzWSjNtuYL1wwiQJRTuRCjQYVpbLl/g5qeAH4cDr4O7
L5B2tJ4CN+JMIkzWY8URzA83Zh6J0wA5tEPenRXrb8SZhEi6sQsWmHJaSKGnh4pDskOJUuDOwII2
ey7pjDVrajpljIEz6Eg8J1+H2BhocFswQzXXrEmJxS+tm1+V4rvVQe7MmczisIOO6T4YrbmlCyHR
2LHvFpZ7AIRvPl5P5kyGMs7cK7mCluC77xWY86SOmUthZ6DAWszErtIRdnFxiRfgKIXfMdbroLzR
Lt1/P46mwFg/jsGUEdKGpMKdOcGskYz/yzV9xjnsGM0S05yJRak0dgYa6V9xHxmnNzMwZHqE5oVk
KgDiPjbifBKA43/Aj9df3/94/fPV3r++IhtX19Y9DDyom06z+EvVj/SVf5W13Et+DPEQWOYf5ptk
HMvmYv/tx5fXd7+8v/7Lb/3979/eP/7y/vn140/fv19f/+nvv/7nX397f/PN1z99/+cf3h5n3377
3Q/+5WffOg7YOnJzeDB8Scb8ALT8P8XN+RolT5Ee8TU9l+O7uqdmevHOhBfZCwQlI14gRvPcaKhj
c0WERe6ggPS2UuPOnMn0aSgyGQH+i9YTiygwPldU7zjWy0GMbBsW0cBHGuneI8pjjAiOSOjPY+xM
SJBXA4XZPFKicSoya0I1y1xkQ17cGXgClcnFJayQo+cv6MiQFLdmJVyrp8SdwUGaoLh14tzWJuo3
D1hlYyT2ECkzdgZmdBUwFmvInUiZf50p8WCr9E2JG4EENa4Ki7xY2UQ8AIe8n2EEd1JeyExjviTD
DVVfZ88rWARoiKssyfOQsa642pgzGW3wr1WVMEUZ14mM5+qOg3tl+M6cxQysyVicHnkwg2DGbvae
ot2T1w03jybvxxwO9FRp5B3jqxEdyNund7XZ1yEeeup+IIqrWCR+9384QdctQbtnBIqx14dwoxOt
0Sczuhf8bKaOI2Ed88DVtSwyTyac4DGezcqbhIYTvERmS/CwJCSowQmtS2XXRiA9FzzPeZc+RCzc
TB/AMZAgW7kUdiYkomNOxExbyOjFWXmmjjSKB7BO1Os7c+bRqElqBBPOyQIbHdRHlNE9Yrg6P6fG
gznBpIZ7OldQdGnfI8ah0b30MmctU8nIfjCh4LUm6psza8Uar4SQWJ49ASVuKCqLZYY+mDMZHqhP
a2HNrGq0CLhzfW9UGjsDMyySNlQl1vjUU5tEoXAoUUFjwYQZd6ZOwhiEJGqc42WoeRJVOCSjjMa9
K5fGzkCDbVVGjfSgZhn1kubBE7gj9rqucuhG4EY8gxCwK25x5LRHHluSdzxmr8IBG+7MCUZRRsV6
KqCIXknTc8648MfryZzPzPv/cK8Tw6sSL2pe6zwqlboM/2OJ+JzrlSJauWpr8z1n9LTlbiOvFBJT
WWPvsX+4Uti9Unh9GgI/cVYKz+pIl6hlMZQ5bgwsGaaeRoTJnxWhfWfOZObASKrpfA/xjjGXonP0
SNqMl6vY3AgoDARyE2yakb/KhiyqifvERdwZVxgd9cvTK2YrH68PQdRON2UMN5Z6TRehcCdCIJop
Ns1qldV6YWJJhbANMw6N7H8P5gQT02Uw3rbwC0rMCo1eEAF1J6AwQMSc7ihfAw4zqmd0UAamzM4H
AwVTg4TnWvyiD/xiUmk0WB1lvTQ2Bhqr1vSJc2jHLzgyZaDgBJbGdZCdOV/YF2vEHZ04b0SyGgce
hO8DvfzBQGNOuKMvnGXW0fywAWnCPcOsJHYGErTq+AozuFxOUTMDcx2+X+7YmTKjjt8X9pW6+Nah
oRm+MXVd17Iz0FCpq4QZi2FW86gLbAzvRMRAYmdCwps6wfSWx/fqEvNw4ILRbsvKj9eTgUQERdrl
E2RgnNVxweiMDlfrJbEzkIgbDkYX1mg2Jf9F3nM8TQzYZmnsTGiMijjOV0HgXjCagcN8fKZVmhJ3
BhI5TMRNr1pzJUJMzY6HUt07l8bOQGMyNOaEGRXD8UbZt4h54eP1ZCDBAheT31JgGbhmjj4WuCrA
XKs0duYspuI+PRoa/TMAcw9dlcFUGjtTdgwp2xW2a9mV8TY+w95H0EtjY6ChrZjrLAJ/jNKQgV07
Xxo7U2dpvcKcbra38qloxX1VnztTdlSa9woHXXUvA2e7Kty8rmUjoLAUVviwjhXjsiJOMr1aQrEZ
4vzOnGC4EjZqeeC62dlH4lH+m8NKY2fOG9MNGmOVd2bCeTnHLomdgUQOqymBNcRS5d0Sf178vDR2
BhrcZm0LjSsEUc/8kXX1HAh8Qqy2KjMjQyvm/8vbkqutelbvqwR2JjT8qVghTVl3yE/F1VASXlkz
DBJ3BhLXsWIITlyZx/FGc6wCSTEqjZ2Bhl0tKSQ45w9YJYlHFdhpCPA7cyYzO3zJRNCogBfu0Jj4
Hs/Q0tiY0rDLMNgxrpIg0KSKAsIc/2DOYsqOmJFCc8IdMgpX31vXUTYCClpN3giWr2o4looRAHjC
RNSExJ05wTDsMpNc0wWxoZQQb56YpaQkdgYSXIarYQ3zp50J9bKSS2JnSsLwtEI/jiEEs2BTnCQf
b4lHaewMNKQsNy4zKlZWlgzHNb4oHokPJjRcrRjLo/gsmgON8xmi/n4T2FmvmgcDDVlSDOcamdet
9MQrc9k1Z0lsRCj4TNwwuGaqXTOo5kgUWCc2iCQIhTtzgsESyQZkXqKpFCew/I4hsTMuQS2fWcm4
uM9r8Yx5x3itUxOvhnfowEz/YM5kzHoxscZLcNphmZWBZ4aK4wyNO3EmQTzx0vAPgfPeY+oPQS9l
ioeIoWY8GBgRBufrNtf4FKbAEbd59ChlHO9LupyxMbgSyjWharjUBbNYVgZXwZhHEFsbgfDUXoYb
VkikomOqTOOFHXh9psnGQIPiNRFMadCoXxCSd9auZFfC7ww05oQGTaRadrR0KHDPp2DLZxg0dgYa
zXAWVhQeE2iE37IQ4Qq0+smNqDpe1zgELYgVuBOGP80i7e8nu4a/nalJBYQY13CjiZdCggnf7Zrb
NgICqNpWhcsjnBGtxpjHV+Er0e4MhmltZUXN47qQA/bGqG1lUwlsBNZPhg2kuaBVgnA9VK6UkrrR
O3PWc8fqGAtvrAENa9Do89K8Hkg7A42WZcztaoS33dTSLA0DjkGtNDbmenPiljvjjTkHIu2/jFdr
b9tGEPzOX3EfJSCC7skHEASIYztoYadwLbQB6qJQLdqWQ8mtlPj3d+b2SB2Jog0MGNyhbu+4uzc7
awyCYeuYmHiVJRoTpItI6aSiMV7QZMnJ7XfRxvUVu2ySixyhiwo92KZixNEt21O6zJwrYGuGK9go
C+ljjNAHerOJQGBTtJQZMCH+WGkWFENZAtuV8iFjhB7AhaV4YDOCaY1wjmWDsyTXdHNFOE6QLiJx
tMOahhrYGskRNil52/E+yrgAaeZ7HzkCH0bySYRtnXa8RbApemh7ajK+j9cMSbPSNMmNOwG0CIQS
Uiva6ReVlyz7pIQqkzxkQJcAk6Sil7oIScTFJMNjatQh1cUYER/O25P8pM8kUEO0+kko9F+RAbI+
VGmqYwOEXTqxY4OkXacdUz7GiPgogwi22BDpM41wlRwpaD/Y6RQZkkJh/GiNM7KJDykUp+jfF7+q
ffF3odVjUWIcRL9gziAOMLPhCUwQNEXYwlKhmroBIaD2kdqGssmjhZfeo76RmF1x9lktb5+MOj6p
i8/qpri4/qCK5eX28duhVW/fLq8//HCuaq3evTs7x5sb7GwbtFvOUMZGoY16aEwkyx7pIkIeNhyv
lG20zKAwGzJ53cj8mGyEZYLAQ13HkhmWQFNZP3iseaGHDelgBGB94LjS5IhPg4Eh37rRbwxuQuQ8
umGVjZCSQt+AsTgo4VwB/QqiX8aL/uTJzr4lIYyGFgbr1yA6MYDJJcMXTse4L6ZIJ0Gv7QjBdSWH
6dQWGvAT26euEQlErKmEGpJNr2OEPurYfHvEaZBFM7ik6dgdh4NNkQ4ISM3UI8SJYE6fR7vhmvT1
TqfhaojYFKGPUshzWMOxwGc+q0jL+cnGCHx4LX0zQ9hbJLvjX/Q1Qi/gvwmiyUxSeDyIcUNZDicf
KnmKSDzqKmRrIIDDySE0TO2zUp4inUS9mgA2eqjAHDGLHAINtrbulPlkZ5lPCDPPybLJ1vAq5D7H
lzynHcMPco01OiiNv0UOyC2r6sq6vqwwZVQnrtETrrn9a70n01yt949q9nBYXP48T7RjTrRztio0
wwWpjbLAfxA+kgee+1IsV+YPo4xaPRQLYHi4V3U8GdgU+XIG9ekrzbuOl7vit9mnnz6pX+YQJrP3
V/MFjjp7f3Z1Mf999WNxsfr/g9n+YDjWsFNAG7XoJ/lOM9W1R/Xa7jeHdrM9vlHH9U4eNtvden//
1B7fzFfP37Wp+7dNkR7EF7RemtOmr+22477tV/X88u1wVJtWXd65YL+23LlV+5fXdvcnGP4OV0A9
r/ev2/aQn4OJ1goKjXLDqBrjEQTsoR2qACFmKSw/3jr1eCRwtbzcOXX+gmTdFOxDjeJUg599KdBm
43CC9owYefSmsmLFqIWjwjH0/PCfH++zj9dK/iTzVjIfj2Qg/HQpwemfXR1Ix0558pLBKWJevjfq
IdsYdwM07sV9enYIkaWMGLn/iLAjvxt13R7UQiF2d1Zr7qn+EWAAK3vihw1lbmRzdHJlYW0NZW5k
b2JqDTM4NyAwIG9iag08PC9GaWx0ZXIvRmxhdGVEZWNvZGUvTGVuZ3RoIDMzMzI+PnN0cmVhbQ0K
SImUV9tuG8kRfedX9COFQKO+X4LFArHXCySwN9g1kSwgBQFNjWQmQ1IhRSfI1++pqiY5M0jAEfxg
9tH06bqerv6wmH349F7N7j6/LLfqu+/uPi63z2r+tL/98Zebu0/v//iDylF9//27H/DRu8UsN6GY
qDT+1Z/BpqY4fOS1a7QpWS02s7m6Wfxj9mECeeqR32oQqMVKyf//Vr7JSQc+rf4MTjfGx4DTcuOz
4dPu54ubWxfVfPH+5m+LP006N/fO1U0syuBUYyOd7Yz65+xuYf5ugC6e2C7LdpFRpXE2s03yy0XT
+AQGl80lAEarl3Z/2G237UFt1tv15riZGpPSs218mo+6sb7EwWn3c/Uw/9Tu1e/U4iZrNW/3+/bh
Zmowiu4dSH5r8VuTz0Y3xXrDJpx+BxOanHUeujw158WMjrNynKHQO3s6iX/TATEHBNcnnGQDn/Rx
qVa740urnnZd16oH57XqgLX79aGdbIbtmfG/zvYORWcMjHCucSkY8XIyv7vC76xvAioHP2zjYkqS
yo+t+rw8bnZb9bRfrg/qp93+24ML5nndAjpu6LdaHtWXHf742KqvAOzr/sYh7Wpyyv1k59FoyWn3
RufDNecDSsiHpGyJjT3xI7FTD4jXDogFXYtaGxzwfip9ukafwJpsGdIvD4dd176+tpSYbroz+Vo2
fGh0LqNofZpKX67RB9eklMOQHnqCMlstv6y7bnl8nOqM0fpa7FxqTPDKZncurfs5tFLt1/9VX5aH
zZKq+XWt2ld1WKpv7f7xWAtcev3BWvv1uEbvP9LPXbf+1k4tfaPN1Nq3CUh5Y+kbfU1YXLGNcfjM
BtRoDrE2/k3yak7+oIzWXEVP7PVus3xGk+sagslNbvQ1Cbp4igLzPtu3unpNRlyEdEZc3BYnea/L
WeM2uxbaffyP+r16bbevNeOogdXX3WrXyfoNrl4TnIurVjdZu/BWV68JjoeKIyAQHF2aVKI5u7pi
Z55YuN/g0TUJOntk0LUm5PxWj66pDuxtCrTJoE9j5b+f/2W9JXV7t9s/tkvkT0r0+NyqHS6lbrld
qT/coJD/PHkYM/qaQJFilBBhSjJnV+/nkAeYoB60S53cgBTjVr3U8mGTXgh7JQ3bvlb9eFwfVufP
qegmW2quadslKSE1wRr/xqSYa+LkEIGSHQZWH5tQ+c8DEXQSbioI4+GlXb0uV107OPnH9fNx39LZ
9bizVv1r5l1oAm5kB9XzwaoNEEr8GegY8JhPyYiAjvDONoHXmGBgi3eYhS/L1WwEEINuoH+XHbbI
B5UQS4f5+3QkGEZIN3Mo9zQwy+VMrceIxpDc+wZTQNRsOvHEOEICTdIxN5FsJzqa51FrNp59qcuL
LxUgX+C9tb0dELtsL4SInrmcuJqNkU5insMIyc4xicbg6+myjMhKjHgC0RrzWDbnNbEOEXB4CrK/
7PEGF+2FEsuSUt+wEUIUHr6MkWj92Tu6MbK/OF/LsRevEUIU6InQ24I3nE4XRv6vb9UAwP6Mp1rK
A6Q0NpwyH/vfXIqWaFIYIYHycKo62BXJ0lNRniy/1PEIIQ74b1JvD6Z5E3qcCGC1rFbyCCEO22g9
RAyyn5kVk4GiTHp6/iS6Ry/Jl2Uv9wJQ+aBctL1sCE2y9sI36vHV7K9qi97X6hlqA231KAPEkRTn
tg9Ii6GobKlllaOGWK02s3e/qrvPX7U6fFUfflU//z+lOc8iP+M8es4h6goRbCzkfAMElnpYaCKi
hAhwtOgLh4cCPPCu0cirNxYvQhw8GyMdIw559cbTs5T3BMfLFITCWqIMTUHqhKKPEAV62kc2w+MV
46h1kphFcwyujybHzOucLHMMEXAgKTkLK/U2UuIwDpAnrDcuwjr6s2ksKgYUI4QoYDJdJ3h9FZf4
CepRO14jOhB/3ARNBO61bwxbMQQ6Bizs1ghSpA2gztCAgtbBnU6EAbn0Gu0SCjMMkY6RZIgDwmex
F0Y5TM+0zlTqNNNBqrzG2VY4hghxoOBiYTsKc8ABg2hp4KQ4FBzr2LGCUZs4hojE01Ax81OUOBAU
xAZXYgZMCaCGQxnoaGpGegARFBEc7BDnS4OhBoT438m6eIpuQsK4MEZIx6RRF0YiCp8Kw8TAa4sv
qXC0kx22FtcQIQ5ohCv13MQ1nqkrURkmUYGiKyhYVLCagzFCOkYs2QHvCt2LUCadDNeO9sSJUqau
wBm6eOYYIp0gXCwZlhXmMCVzyDOpHNZkFpbWCMUAECt0YiCEyBtKDY7nlEDoqaCxDic/ekBXHQti
gpUdiYMFsaZIIOVZltlHZhgiHSOBWxPp1hQJmhSc1AXkhtaZs45yTeLGEOkEyUWQLHvK6QuaH2gd
nayrHUNEOEqR7s0kj4FGNStrY2Wd699R+uAYIR0jhooeWXWURaxRFaJtVKFYh2i5UnS0laOPCEeo
1RSj7OEQkxriXUJrLhT0qA2VogcIQ6SbmISLRh14FrRnleYllYs9LSUnPUCyWuLle+RU1z/bpMai
3798QkB2TSIVpMjrBKGiXylhoLrFX2POljSdhq4c8H6D5Qnm4RlDwT7fQ+baPeSH91DmEKCOI0K1
4WT6mESfaiL44oR+Ucnwmyhk1lkaPCiKQ4TCiJQYBjznIdA1yofQDUdrV7UFGsEUQ6RjhELG/VLq
HlP1CDrA6yx/L7mcOHoIcXh6MkhTFqpLqAzVOlzLWVxxSe4U63J1pY8Qh21knQx5gtgnYUykE2D0
xXFPBrkMR4gEI5iqtVQEWGfreZ21WFW4KKhaTxx9RDiSMaLfNO1gHbXcAIUeE3RGCXJ/lkrRA8QP
GnAFEE8C3adY81yHNSmh9DD3+QiR7nDmpLSiFZin5FqKTo1qScIpooc7FyK+EaSIFAe6RIIIEa+j
FFeSDb5aMUQ6RlIVzlNBGi4/CGepXZ5lLU02RrqKuHqhMoWlCxOHOBasod2DIRF2JGcKnKAxgdQC
OdDU1rcWlwSmKdbCbDEuQp1RkZEmquBpKp3epWHQpQEVrCVb3vC0GKiXimg93ZyBpka5WVNdm9P8
JEU1ADoGtJX7JNAdiP5JRu5EwzVGL7N07jjpsD4iXWpqv4SSa1c67jDNHMD574RXK3pAx545LR1F
vYrJF2bW/qFJmyYZqRcjQ8UI6QRxRsTDkVSgsZwomCapiAavKMtyFGRwHiHEgWKPDHB/RQiYZQbP
zy2M1U4qu2reCOkYMTnKgGplD1+C9AUNvTgh57ojCscQESvosSLyw1tClOiaSuFtnUKkskeIUDgt
ewqNvVhHDhcUKxrh9FIGIYTK0Ue6ymprO3gOYPKiNp4UC2vrRY2SzjWgfYTyipkgS8FGzmrK0mCU
Gsp6yae2l0tkiBBDRg5kmnH08Aj0ipWpIpw46qRC68rRQ6S6Up1MTnt+Y7wKsiUJQdh+TtEXmP9K
RNA71b//doDEbrtWs0xemUI0ICbEr6erTpuLZE+LUcDD3u4x28grxxxrUVX/SrZj97xdI2cDW9eI
+SrytmaUhnwn/bfR7cvopnVMlagoiL/FjIXEmGfylYNQFiIvnDHVYc0qmQ8Gd3NWA44U4moqLGc1
zUYzUTx+dUze7pOBgufDJhxhA3/dRs+GXXGvVQaa9Ng3kxpWbbjeCTM1wq8LGrOuZljfhM+Ekvgi
UmH9iCMKye7hcSR8eMSt6y6cGXu9O0LhwdxgFM+ZODF8AJQOS7iAba9/Y6xGuwr71x/D9BCTNKxn
qyfGlXwwdzFaVgiJtIZnKwfOy1grLsyL2rfEh4ACSn3/4U/roZQ6XrBzS4bH9oOBglEyz7lwZwxR
AhL75dzm3sfJQKNmqvy71JKaLPKD7CaJCc2ocBAQWBfCys5eWKCoE0EsY65xpR4MgzCoSlY7jxff
wBdNgBv/wanhwdxgOpicKxNLgwTRRKqab4WTgUJnFG30WqPKKLIhJZ76jhIaJwONMZDgy63W+GIY
lwCPjDILk1LjZKAxSSjCWHUzsizlzYh+qEgw+vk3cRcBw2UQrVbIwgctB8rAOohR+B8MNIYh8F4O
G1VcP+nNzq889kWNk7mpyoNeWmtGo40FO9n/0LE1TgYaJjT6hTiqfSTOISSwb9/1rXEyN5nJvTg1
uLcJ2AetuzN6MkzHYugdKR38YEBiTKGvbO/kYBhFZxTdGTlryuqMiibQvZOTYTb4X2n6FXpzxOGs
U41m+2YYh23LI47JOPrEyS5jjZhKjZOBxtxlYxrWyI4jNa2uO9xXz5MHc4NpDKPVkj2g9i3BQrO2
wBvfJ5bspwFl4ypDeK/hvjYKnAwkOqOWyl7gXdIhqW3xlzuGk4GEfkp4vIp3CTIImFLw2gInAwFn
F+iKGObgvZnATnPn/qBxMtBYi86rE/QqYOglVnjvs2OiezB3MbIbavndKyfQ6IVVqYlJ5MFAw+hv
G63WmO1W4IVnZwtUp8bJ3H9e/wQYABDTOTUNZW5kc3RyZWFtDWVuZG9iag0zODggMCBvYmoNPDwv
RmlsdGVyL0ZsYXRlRGVjb2RlL0xlbmd0aCAzNTE5Pj5zdHJlYW0NCkiJlFfZbmPHEX3nV/SjhEBU
70tgGLBmMRLMwBgPYQ8wCgKGupKYuSRlLnY+P6eqmmRfZiGFeZh7jtinq6qrqqtdSuNcovLajUMs
ygFHlxnHEBlnxzDpqGajE6JnokQvK4qVFSEw9gTzWDsrMDhWGDK9MLaIhA4sUYxIRCdGlSqZYZxY
0TKiYV0SpiTe13nDuDjBMZBjfqxDrHa0jGjEJM4X72SNFteSM4xTqXtoWzVaRjSKFialwGuKdQdL
GYtkqQIHWFcH+XXh8APHaqMhC8pY+4oRKRIYMr0wpnqhxfMScrWgVIsEJ78/kZYRjUP0vOwbYzUj
Mkyh4uKqGS0jEnkf3sJLsqmeOYb7A0T8RKAhsD7rseVAepiCRAIuRfQMKWQzDhwqP/aJJU6YvjKi
4SHOWJuqKdgXd8Ci0TKkYZHHRRhkvMtIW07fMMbfgMk/zzgVwxpDpmfG+lCZyGtcEZxhD+HgY8Wx
arSMaERLTIR3siY7wcmRHWFsPFmesBcXyQkjGtoFZlLCocC3GC3jyHYZLknC3sd9PBpGziWYqhqs
HGwQO6iTEObahVl2nxoNUROUTyVyznD65SIKppaILJB4DrAUiXQYEFbKMnPCY32ShE/ZCHZ+X6YN
IxrJyZ4pS5nGUm1ygkOsOOaq0TKiEbyvnkthSWbArqrhokT70C0aQnpnDV30FAgcrcDgSQ/ZUrGu
kRgyPTPSsuLYJK8ES2ycTYJ1zRpdqkbLiIarayyfRxiLFy6LgnbipXF7K1qGFDyOxlSGPAfOVYMb
qee4MzYSzSEjGtFKXZWceY0roqkFmlS3SK5KtAxJoHfEWB2hAFIPNtWMwDhy6pKkJMaQEY0QxDAb
vawppWpWXNNgH9AhIxouyr4hUIJadFHRDDYwDvXQfBGNIdMz4/ZM9rzGFFvLn6H2pf7ZVYmWIQmD
HNjnI1Wq5uuUa9lGxtKV6OqUBB0y0Ijo6zozExBkwo77Ixe1i6B5fChjy7kxJEgArUWW0+0HpPk+
S9xUUQ0oHV9LmU04YXpmItc/rcdZG9ne072Ev1lOXdwertT1LSPrdZI1mUok+nqRFCl14MSnJY1M
QinTSEBzXDDOvg5FXKfAMdS5wHJO6P3fa24Omb4ydcapKZHkgo1WoK1Q+70NDSMZsb/HfZbs1lYm
jcDTiRsbLXNVOFjRMmKF2VshK0pFNjO2vo5yJlSFlhEFa2Rg9EmsMPtxbx+LYg+4xqJhaizqhCJr
4FkdOn2R5D7Gfzb6VS1Hv420ehpF3MXR0RWOatCwGV8ap6Yz8vnG4ujRTAryE2WGX2KgQAcLuKii
MRFZNVuM7r6o28/PRm2e1bsv6tPo3cc3avSJ9bUypmgu2ewN0lCtu2bz2x8/O/W0wffkw+37hVdv
V1j4aQQDYISDBZrvIdQQQvVtZEmLQmWRYNbDvph4ArtxmgcDqD+Obj+/TJfqu+9uP0yXT+rqcX3z
/ufr249v/vIW1iT1/fd3b2Hg3YTto3/fRgbVSVXEFtfvggFNpittkNyTxehKXU/+OXo3EQ//7za5
2cbQzI0yYfH6bXj2yWWg//Xqx9VuvZguH9TkOqexUVfden3t8J+6UfjxvdX6+m+Tv15mQ2lsoB6C
wJEJ9dN6FKut2f56D61u1G80FNRkpuT/PxSuoqQDb1c/bTDISC2Ny9OhssOT6xtMXFeTNxe7hQpu
ThB9TFHCGs4VjaL9NrqdmL8bsJNHNsyyYWQVGq2VM5YvHsmdDK2HCBitXrr1ZrVcdhu1mC/ni93i
4qDYxrbT3QxmFdSMG2z39UrdX13f4KZHKLLmA+/Un9THbn1/fXlMXLMvua/FfU2uG0z5Fp2d069+
W4eXC12LA9cvP3x/sp+V/QwdAdpP3Yq/qYw0XVQeF5XBXU07fZiq2Wr30qnHVd936t55rXpw3Xq+
6S43I7RV9l/2NsEix9EXHPzFkGXEzcs3iGc2CHiF0ByCoQDzCSZldq5Td/1qph7IvXmnntbTDYHZ
dDldP6iHnfq8e1A/7brN9nJL0sWuaprDtXutq/nMBvQooenVFoxte324+jhddLt/qZfpetEtt/Nu
rR7urbU/7J52m+18efH+5cz+xWBbXF42u4N/X6+6rdpM1e/d+mFXG6XkEpnwvJsjt9iaVT//HXl1
aT05fWm0LeY7XV4bbGfO6dOHx7yPoRtjNGYo9vbDNa6OK3JoutnMu+0W4We3V4vp0z1u8RqDV3hq
L/bU4/4nk17pqjuzARqQTRjHrfPQx7QvnnZqserQG5Baf1ZbZNaUXNvOV0s1e17NVr3gV3jqL/bU
YurQLrzW07PdyNNthDOlMblEc/B0xr484gDNK/w515sO/hhUrAk5v9afcy0HD5di8Cg0qMhY9b9e
/TJfUrO7W60fuilOT/Jz99Sp1U79o58uZ+qHa2TxT5df+e5cbwqB3iF0xZqDp9wbYIG61y71WzaD
Itypl5o7bNELcdt5D8O2tXk8zDezw88p4y439FwTO54JRuhgjX/lmfhzjSlnvCpwbRkfMSn7/WVb
b1s0Sbip0BU3L91sO531J5ft+/nTDvMHNq/7HRrVbyMT6H3i+ZHrA73iDGa6ENOB6ZnBSxQM/oJh
zwTN/9P7w8EcvJTG/OqseDY6ZaDhM0bj0qxJQ01g6/NhV9IYMtAwfhyzaxkdufiI0bjsmt9EmlD4
N6TzHwyF0UXElUyBaQnu4NlROMrV+IobdypDIYEJSIzDGoTIHQQpgu6442x0yvQc96BPGRpmSERT
ASL/cUkAR9QB4Yi5OB8wqQ4Z0oArxjZroE4xPGjivi9hYNmQgQYej06fMsEf3YtIGW2Pvkcvz9Nj
vE4YkuB3ZrMmYnw+HgEg3qCtXScMJAq9cVLDWI3XVNqffmx/c8wQ0in+hPHOHzMPpgUydp+Ze+OP
2XzCkAYmT9dUACI01LS4/1ybzSdMz5EvePcMmRQCq9LJ82km8ga7xWMCCGzOXwgSCPQyOvzeUWyP
asNKn41+VUt0AK2eUEdosb6kZOU1edMSUmQmc8lzYuWo8baZLUZ3X9Tt52etNs/q3Rf16X/1m8M4
8gn7RTwZjVPeUFlmNJyoxxZy3iAlcOJwOiMzvKHHDG4B1KonaFHX2HR0QvREJEwwHpWPRw8tKEgB
ginw+lhou4Btk6xvCV6PJwzv71EJCKr1AiPKACF1GAII5kRROyGwHtEOIogwo9KzTWx+KFFRn8hk
LQYiE2j5kOhH6C0Gbzb0l3HB7eypQIAQDPQXIIMu4bUfG9p8iLE4jpOJwG6sUV6Y5pJHldHzDIlB
WvDIa42rvMjylsB6vF4pdjhuj/cmYIqRYYZxgJlNQ6gtrx8SPXlDMxXtX7AeMGWCKCkkLmKRcmFn
CkIO54cE1lt6R7Lz/6a8WrLrikHYvKvIBtrjH2Cvp1Nn/9NKwml876Snoxdxgz8gBA7oI0M5sT8a
3wSD8RAzxRIMduX+adg0dIYLDrywGM/1EVPMF/iKXoc2g8REul94M5UlXAYHAwG95/cGhoEIliB5
c0P4YoQvfrbCVdcvDnpMOyWJJBdJQMLCm78Mmwbn3rjKwqYoAsOJSYsygnCQ5Fi9LGrQy7BlOJFr
YD2g+1BkJwQJq3cck7BJw14G7W/dZTC8RPj9hGJ0wUWWAtrX8b/xzuvU3B0SQXErCfGYA3ITmIM6
9cRwBlmZB4438AKcmXLIAqS2qTorhz86Pw2bhm6ehimHZAAgdqFUg5mCufnTIP/hZ0F8IFwZ+ImS
AjQ7X+tM/9sgf1vKW2eihhqt1Aj5cwrwEg2Ks2Bfhi3DIYr7pL9uNxQSfKwiBQ9t6X4b5F6P1oDo
CJ2kDklbCnvML5Rh/8abeDS//rv6+YqSeqny3RxQFnXWKKAPY1wC8sK/gqr7k0UzZ6Pycq7qaK8T
c14sjFgFD6723Sfqv/pEf/SJnlcHQR2J/aRh9Z7ikpE3BhLSQ2Kwq7NtQBmbiThPA+6Pm2pBEmDy
oeM1149hhDNrvw8l7oG3MDPFClj6d8aWUoIq5EfL8lhzHe/LAPeJoK+sL/ziLG4plBN15UxnFmef
mfYLb95l+jkrSOg8lNYK1jr2sGwgpg71MujmK44sMtco2kTMFE+mzENQkrJPg85eI0uUHZezpCdc
qDzBmg1tpfuFM+yjH6yzY5gQ5AyOm/k81azZ8WVQvUXEUcYuyh+pCRe8WaLQpVIhveiIn1yweBoM
Is/B8yAXaY6qjq/db4Mi347QiWVge0st86V6bZYwq+ZlUL22sU6Dk3t0Lc8x/XXWx0SGA0THYDA/
2Kup7Qh3GSD+zwY2tBaccupy5rhMHEpTuiEt/1Ny4y65YFUr0qNyMoucUaTNIBIGR6aEx42ERuXk
4ELePPEmHitDZ1AHwDqzYUFOCIv1vxUk99ugijsdjcuyohRIvorgXrOHAKpinngTh2e9FYgGZmA7
QxYqIyAdhwRVvf1l2DQMKivLH20bsJeRm+Ns4ZjClpTENJO+DJuG4KBShkomUAMkNfwHKgkw1mnG
0qqXYdPgCgafSXJI9cB3DJXB+p8J/fjfBvnXeQyd/19EYhyT7uDPSpisfRny+HmchSBysZ6zT7gu
U0rm2cxy99sg9znXofngfo3RoaCwNWBILakf/IX/05DRH6kB+MFrpllLvcKkhVQOOwWsuz/wFp65
G5+x8K49+7+l99e4QPj7x8cfAQYABmk27Q1lbmRzdHJlYW0NZW5kb2JqDTM4OSAwIG9iag08PC9G
aWx0ZXIvRmxhdGVEZWNvZGUvTGVuZ3RoIDM2OTI+PnN0cmVhbQ0KSImUV9tuG8kRfZ+v6EfpQVTf
L4BhIJbthQMLiNfEroF1ENA0LTEeUruk5AT5+py6jNxDLGIFehBPzZyu0zVV1dXFL0LzJjq3SKGY
cSh+4XN4NADaptAUt6iFf0dXzXr41eyHPwZrbgbvFy3VaG0xdlFKdNnjR83ZtWQufFrkWoq1wXiX
Fi1g5WYyONW1FrNZ74YXH8zl+1tnjrfm1Qfzbnh1fWWGy9fbm4fDxjx7dnl99ealcTGZ589fvMSj
d/Bc2sJ7CLJtUVM2OzLY7NiQ4aHUBe0NKJZCKOvDUOFzODGMZAguwYAH1ZSyqC0DlUX2vJhzETAv
YqpC7w1M95n8YbuJ/dXYGIboDYnNtFxc1OqIPzeMQ7WLlhMbPOJcEe0k/AqZ1bMMclci6HMMdsB/
8e4dXievRRaz1dSycK0ChkXMpP7EMJKBeGRIXt7PgvCfHrKWsMhC/g6ZGiKjIK6yE6r3gSA+s0Ak
FJN7A9Nb8sJHMtS6sEUg1DO/JIFB6d8xs6tPuhy9XYI4z0hGeijKstNddxhk8iXkHCu5dlZdp8Sw
TBtj6XMD833UvUIzQaoWeu4awcD5CZiz8HsD84Pg6HnnocnysbL7qItxwsyxOA+i1mf2lrzE1XmB
srRFUjK7w8xOTb6ht/x6LrITUV6SxMUVZfcGpld17lIgQtPscYGlt+QepTG/N4CPUvWyGwu/gF7l
0RcgSItTW+Fkn2Fm+1bEgJgASuCopRSCyYlYG4TdYWZL6ZBvR6+XrHtzvFjThHK2Cr03jEOz0K6f
MbHYqlnFkaRupN+0Cb3DoywnZGgmVJo+LoaX1rJMxD4xiPOmdYpIAbogzxO6I8EStDqU3xtGMSQV
X4Sve6mMrNPaC0rvDOI+qZ7gWK8WOzVBgrFqgWSV3xmY762WUBD3RfMClUNQc9zHSX5nEPma5R7d
t9PniujX3uK4Zk4M4l+blS/s36v/UBvBGKYai8LvDcwPUfk4NAi2yT8vl3LTKkrC7w3MT2XqGBy/
NPU+4ecps3T7HR577AvLzVU7gGcxJSu0uvvewPyicr2Eq/qsnZeXq5qqoan73sD8mvPUbIHa1EKw
yeZQPxpLy/S5YSSD10oKyArA4DQ5KkPvNLQuC783MF+7bazsTzeXkVpA09ZCTsLuDcwu0wmHmBOM
2vuR2oDN6pnWvPB7A/iYhbRUM3oZILU6UVMIBqsw0mFxYmB+yJJLlBPE10rImF4ApaXhHJfSmRuY
r6VAemg1r2cVozgd5ykIuzcIu03bTUzXwsiBxURdrYaq/M7A/KJya+PtVivqGtUxHToyu9jE6ueG
kQ1aONSym/Re3h31kSBjJ61uvfB7A/ODnr0F/atJwU76GvUnSY0m7O+QuVH20ijS1LqiSHPsOjmF
Ngm5NwhdG3yzvNfoNRIUOioOCWzhCeXEwPzHWEU4jAhNVv+ZoOeTMPKoDf7cMJIhTLFs/L6mIXXM
CDESx1aE3GHm5iKboSm0JVSQQEfsDAmNIY3IoM8NIxu8EGgkAr/lqsspfESgzzCzaxPl1P4bjdTE
xnCKvtUwgmRGVKhgz/BIWAqWDJler1lgRTdrmCBcUMgpNzeMbOBxDBN6YULg6Q4TM0YXQF4Ns2ys
Qu8we09WDIV6LSZiPogx3pIY7JQDVVDdWbfeGTjyTd731G2ilmvmW0ULOiRDi9ek6Q2cNMmL+KJJ
ywMY+E7yXV+X0M2wVAunAbCX8qpyV6mFM9jz5QAwRK22zsB8b8VdqVxtLquYwNAGhXybODEw3zrd
LXcX+e6ZLn8Mg0RWan2GpdF6UZMjH2vNy96SnFLeSSRt01OuN8iMEGW3NK4zFDFBR6wir0c7jVid
gSe0GsXgE8+mOYv/oNOlrB2cDpePkLmhVDUkejlGgUEHVQFOJ8vvUGbiKuXRKt9GapIwWEY5FN1U
kJG6N4xyP5hk8wzv9TkVI111qi4Whd5huQopGQ2Cbjq6Z58E6veVmJ0Y9Bom3hIOR8DoJOYJrQvQ
6heJPFmcGMBHpkwG6AHMqWrpEpIBnh7y3ucG0NEi6pRhGMkTztYkxUgXq6iNRG5M4M8NIxnkZke3
JHwndGzafcPlhoDlQQOXDv7iMwwu0pVjBS6Oourwb/KNz4AJUQvTs+sZHgk77juVXk3c2SlpnCm4
l0Tx03gaPDGMZEhBCBXqASNfZBpXaaFLU5GnfCYj6EGnt4QN7NigAxYVGsEwncme4HRtypJxc8M4
M8g316tIZnaoimxU752B2dFPA1RjehMxKfBqKevF5tF7Z2B+1rsHa896icto04DTrJddEnZvELbO
zrGw9zyNU7r31B6heO8Mol6HAiVEq5vBwXsS6vXwq9kPfwzW3AwZk1UOdLTQAAix+IWxOlkaxS98
QkY6NM1gfKDvnCrZE06R7FxGgNa74cUHc/n+1pnjrXn1wbwbXl1fmeEdr2+Nc3ypQASjQ9s1h03n
/PKn98HcHPF7+fby9S6Zl3cgEhWLF84izDY4giKkkAHpdRHk1jBbaHqKzloNue3xtJalfqnrYSSq
37X7R+2X739f7c2zZ5dvV/sbc/blcPH65/PL66s3L41DTj5//uIlb+7FkndHf18HR1MrtPJ+9TdC
hpLSb4Ahpprlbjj76bDaf97eHTfmwjiU40dv7fnyn8OrpUTtf7ovk3s4R3E3ZBt51J/OcXe0fu7R
PHn52i1/YenAXK6N/P+XiQggNkP+9Cf8ocOnKn0r0hgAf7+dLc8vAk4Mc7a8Ov/78q9P890637hF
NkNJSGMp/KP6vg6XS/cPB+vyC2vzrI2E4czy8snlVwu4lUFLoD6oQfjt7HqzfzDHzeH8wnnS9m1r
Vg9mvTocPgbk5i9v/kYfxJrfN4fj3X6/OZrddr/dPeyevIVkuy2QWitqLSl1NDOgh3KC6G/nAp02
GA17qU//XpA9d+jFoaOQoQWoL/7dikVbwdyHey5coc1xVN5uzPpu/fV+tR2RiT6cF3P2dmV+2W7M
Zm9+RprCGp8eAt8p+lMZrtLemwmh0GXGiYyrw3kwZ/Qhdqv9vfkMp/4v43G1hrzNYYtiWX3brPH5
jma1ezhuLj7dPaxvN8enCws/EhbowMapFBxNCkU+BcLz+g6xQNEezWeIWe1Xh8/m9ztIDSMnzurh
38C7HcQ89bPFH2kplPnoVIHGCZobOEibe4PMNN82B47WhgRd3+0/rf6zHcfV+umxSD/y7zP5r8bT
EETziOTKylytjse7cXN/z87HlbneHMyf6bq6XX0at//H98k/0oS0LQlXAWrrHofQY/7eiNf96vN2
T66/bVDXH0O0pO/LnTw93m//S3m17LhtBMG7voLH3YOJeT+OQWBfHSTILRdGlhcEuLuyLAH5/FT1
jMkZGoGUm6ZEFnu6q1+IlqoGnq6PGxbvKpoDNtY8TOYYb1IN1uoN0c0f0/x2/fCMPv/08XVeZrhL
+sDw6+U2/P1++XKijH55dsPT58drpk8PBDJnTCHGcnPRNZB/0jD4ivpd5qME7KtY+/46vZxE0tfL
7S9lA8xneCdG98ut3Ohx+/Id+7TSjgObGQzGjGBtyTp+/+19/ufRhArqnh8wAiuP8mq4XXAkLeJ5
Rpd+Yq35fKYvLtOmm9MNSXUqlQgaevTKQd/Nbcyy6JmDRm45n81Whyd696sUFfpcOtAL6w3q3+OZ
FO6W4IjezJ0E+xT6uK6VbkIjuJ1/JO/reXp5Oz0cgLvV1aHamxhZfLDIuBoAKIrlHn7+fj4dr9MR
v9YudBp+W6b5+3yhSb/PRXv/qxuFu4XWa06xmJyQHzCvBuMjBYjuXzSxIBDnRYJzxc/32yBiubLo
vl33kfk0v9wuJxpUbViLLSZahcE14buWzdhz4dHKsCH6FVoKFGE7qsroMRwAiHQaACPrEYCAJ8IK
HA8/QcKDnAqxfQ2Db/AtscPqE9aPC08PLYecMZu4FsC+iUwlAFObJ0LGq/UKjvVmD0FtgBL+GsS6
aPlWhANCc6kKtJeqkNBgb8I+07wGPuTTxpuwZGyfPh5+gpYaidAjGttP4UGtAJHFXuQsAKaJAA7/
hBUg8w4SHng9tm/JoNPyooFxEGsM3EFCg5/B7qGsGg86rEFg3FyB/SrmzoE9QhJnRu5vzUtW9s6N
FVuL9p15O4g0LCK+j3lCLbdVFqF7qNE2qfwe4TK3iZIWYk3cZFsv0Yi9R4SFO4NtXoKzYjYNLR1q
O6n3yFLjIMQdhDldiBWau8RXdItCbkOjinJuRVEQIYFVMTXvYAPIqSXtC8OxWWzRJEesR6hOZdn7
0AKSixF1LPwQYQpK622vVete+x/1qdlovx2yy2NSecAAPHIAfD1w7kIggYSRU1d2SEnNJ+yYHCu7
R5bgaKAifPewAxYBAi7v0Oux48gbCaHimQsJzz6REWrRsVK0CDkcpJ/ECgf98KxtOQfFs8VQKMcU
jVB0ABlQ6l3hhMcz5SEP2NFn+NGmUfjwFJQOgh4AAfM4O1l18VsWhoR/HEYKa3EtRD1nfEDBNDGh
BxYBAn45ZUcV+AYyD63QZugwp8KITHAKWvZZKHqEHBhg0EcdNOBgP88hGDnTGp4hB5zhflM4eqTc
hP6HGVkokPi4qYLTYxTPhFTuhTFBGHqEzoRM5WroVBYUdC5qCHYVyBjeRAo7Y0QEKhRV9MgiCCXG
d+T24PCOX8kSWv6P/QdnND8fK0eLFI4cjSABqmfUvYlyNhAhZWJzecNUafUIOXArZep3o4wqxkVR
ho6UJ1LC6iJXJf7YIYsgPpbbZatlWXHWinqUi3K2Tj5BCR0PO2ARwFSPGkmSNPogLk/aiRFGWzkb
7aoRLVKMcNYI4n0o71TnOFvO7Eg8+/UeG1AYkrgPRrC4eJTyXM7ByNG7IMfkWOr2yCIIs4NRVehV
nLAC/U1lwNzszagltaHXyIsM/wowAAEfS14NZW5kc3RyZWFtDWVuZG9iag0zOTAgMCBvYmoNPDwv
RmlsdGVyL0ZsYXRlRGVjb2RlL0xlbmd0aCAzNDU2Pj5zdHJlYW0NCkiJlFe9zmy3Dez3KfYF7lp/
JCXAcOGfAClcGCns/iKwDZxrwAny/iE5o886WyXdzuzRiKRIilrSXnWu56j1NW08r8dypkkDM/sz
8ZzAKol7E+Chz8+PdwYaXajaFtasDlxb4jH4f53UOBlojBmqvnZYrjED1j4TrzYc91fRRo2Tgcby
tcGoYs1s6ni8yqiO/UtriYd7EBp35gKTa8S9C18iDoHtlbC8xMaGoXAjriR6a+eCoh2wuV9jvWZZ
iSPOnx8/P/94/Pkoz18fIn441Uq1Z2xarK8Vv8xme37yf3XOVqpzpcur1TZs6tPWS2qZpXtQvjy+
/eX51T9+q89///b84ZfnT48ffvzu+fjqb7//+p9//fP59ddf/fjd379/VrXnN998+73/9ZPvHT4W
q89R1OMmzy/JxEmOIi/haYyIbOmZN0uGO+lwePKMDMONiDDIqxuYkWdhbib2sCGJrXhci/l54zzv
zAUmstUZWVijhi/cX2gM/L/m2hoHExrquSjJjBXn4R5JTc/mHJkT1jXtan0yJ07mSudMG2yvMzVa
h6bVkXhK4Om5AF/uDOIxI5/LetXIA7erTk0c+ZB2lqi74vGCxp2BLyVzrXgq1Nx3KfBaDVgsq6ot
mnEQPJW+SMw8x1XxgVScq7gyKll5sCeDKlNDxyijZ4XYsvTVFPjMJkR02kpfVVfmV3fLk4ikiE1a
J1ZkV8f348OKk8GZRBxjV2Rkf0mriXWh1isOAGX2RqDS6wBjHQKKLXo2rbvRZ6FWt8J6XR5BPwlR
PwM/gRIV8qmpx6nZ8oh4VUby25ylPbV5JYkf1f9TpvNepssDrBn44Wn4JZkaReUJMC1sdlcyCP4l
8VgjXVzIqRtxJdEnwih15YqSXs/oRVliiwUVJYcSOxmUqbBgZE2WpWSJldTwzfJ/T75JKw7iSj8i
VUKzdD8L9ZRfLB83ymM3Go6iera6whtzJZN3TnQPr83ADSZEp1C/AcrIbhTZHAp35kpGW08mq0vD
OnQKb7SJNXfQ3fTemCsZyeB47TasQffxLzzhA7cxgHVrnAw0yqQqTF+Z6N4wUsKb0QRmZr8xdEVx
IktXblsazsy0QrMgDUSEGidzUVVYDyPX1CJoR9Gw1C/ZguZjBXbcGR7KQKsYYXr1ipvoed3ymPvY
ZY9o3JkLzMS2vUhqlD7Qsaix55XA0DgZaFTOJ7nG021xCpLne1mdhd58oJA5SjEvcLNRvQ+XmAeq
H+qnFjeyWSRYrXEzds9Fr1n3ek3vDjEu/c+lvm6lrubdrSNS3hG91NWPUhAZtQi/95kKPMwSS7T6
OK6ZPfONuZJplT0SyWmrZVZog2RB3x4yqXAQEKgysyRUsOmu9DjnNFtx6U+W2Z0JDW/YWjEqzNDw
8As0gl/mA1UTDgohcSdcwWqOhLEi3FnWvYRQuM3zbplneza5nqNHSNyZK5laMND49IsPKmAUWfwt
WKAU+AtjOS6snnd0YKktcYuitbjtId+QlW8MNGZWQ8+cD+zBgZFeRlgBm0b/kPggoIB231/cVDug
D4+JjUZq3XE4GUgsauqAI3Gt5R5+Kss8BfJWDEfhyJ25kqmDzsetE3jSsbhTHLeG/7sqNU4GGi1v
gJ4XfGJsEq+CgPnmiAVIrDeGZjRGWLHtqMC1EXMLviDeGGjg4nGNgjViMJSeqCBa1bbEyUDCGryv
0nPNLIh57XBlDv0wExonA41V4X6xiIZXkdCM0oCz+KM/oUjuzAUmL6d4FPVckxGN5mQJR4XhuNfv
BASEEY55LrAqXa0QnMy+igvgjYHGyj7mpyQw3OYR3pgUlKe+KHEykECjc4k1sK2xlhsc2VsM2Ron
QzMmqz3jN3GJBI7HSGDm9OjQuDMXGKMnRgl6NmHFMhbvjufJ0AqhXR0BXWwa0V8Tj8HK0q1xMLAC
Ae6dRihTfnUaBavb+PDjYOgH49nquFleY8xJP4lZaneGVnQWPMyoNKPPlbizevsclDgZSDR41qbm
kjZZJZQcOlh4QomTgcSw3Xcq1uyGSg3ZybeDcRAXia0Aw2XnZ4NVKjtfdyxOBhrK3GqMn+3eNqBp
k2e2thknAw08MNnI/YrcXSg72XqVnXsFEnfmSqay9no28pXHi4gDs7pbVUocBBS6sPQmdhUmihZN
vB3teNe9MdDQfa1mvTvmtRljuMVjF44pHiRvDCT8FgLjnXXN4hnMWy8al+NWiEfeSG/MBYanFG86
x9TTXF8XYm2osjcG63vTD6tSj1fJAOx7nJBOiZOhxNqXsUCCRaR9QaPCxIlX0RsDDVmomrnguhXk
74rynz4LN4xSReDKnbnAwLC8BVxisVQtepD/XRmpeKVC4mQg0dgLzSTXtCkfhgbuBfFbVPgLY31n
Iq08AccY10qFCYMmF+H6g6AALFoFbvfG7RfMoXWYk+4E1n/EbcSOzaPUaIEmrnndOl6QuDNXMnvJ
wgpeQtF3HXbmxzKuPwgsF4VgTsozSiZhTQH/rkrimOZD4c5cYGBBTmYOp3YqEot8YEicTEj4m24h
tHGfrBkvgHAjnrphVUz6mji+C407cyWDEg9Gc40J8Cw18SqLWKlxMtBYOSG6enTuGbMKsPWWWHJm
8plloDjuDDR63ls+MUTvnvHGHYk17XLvM4A+1wzd8TgYnMo0qka7ikOusGMuZCrG+pjpdm6dzMVs
XWB2dgteTbOyOriCIb0RrK9MFicaa5JGGNK95vPGcR+7RA8GEpVPNZso0SI7oOg+q9FI3d3mZNBt
VoY4nEeHQnK4WdSwhoCzU9wItu4Gz3Tg+pzEwqsw5sLAZe3r9GQ4nmDTKDDML4hN39OeMnPKx7R3
MJizjGuaYHoWhRmdo29fcLT2So2TgUYz2pFTu38xgDun6coVve7h92Q4xU9U18orODIEx1YApXe6
2vkQOJmLr5xJV/AAqfwiiz6fb0LJwSfeyfCJV2FY08EnXaUmMTNhh/TO7Jcm9pW4lB33ghDHG2HZ
eDFVBmecG3ElwXiOOXKBCLElxOMj/u4UOJlQ8Jtz7nyM2cLfJZnzxidjY2PyUbJjuLgzVzIkxOIU
/WLIDumzUHjhFZBVE7NTCtwIX6+e4Rk7F4irz3EWouVrxfMwMw6VnCa8MVcyJfvlzO+HYf8RF5N6
78rM9W0wsr4xVzKjY028gwLnTbJQ6Q5rnpT/jZnAz6pxuIwy+AKGo0mWqcO2Z4KWePBv5uWNuEiQ
YTbwOaVY3+ae+nZSngwUettT3YIE7mzpUNzDvvxlw8FAQvh8ghPC16m2mVgLR7gqVDgZKnDcHwYj
ZI95OxAyPjCtOBg6Mm9L+MKLge0t9J8fPz//ePz5KM9fH9rcny6ewD5KFDfZfxU/svJfyquuN20g
CL77V+wjSEXcnY2xpShSQ0iVKnlI41aRSlVdzAEO/qD+aNJ/39mzE5Goqh3xwGHh27nd2bnZAFye
KLwIFQnhDaRUmHhhoAJYmBlkyZfSR2/FmXN2R9PbnaRqR8s7unGW1wtybmwAgfdCYZs18CQEnUpz
FH366dalbYV1dDW9yHw6L/DijQO+AwV4JNjtwHnPaO8E1ibgGAo9jCt2ovy5tV4TV1hXgK03zvT2
oHM6OZle6XxLo005ufgynl4vLs9JzgWdnp6dA91ZZMHxZ+9INIeAdlu43Xou0QusKZw0wa4gypwR
jaMHZxm1J/xvJHkUSbLXRo/Y/bs1DsAa773a//toOQafR791lRQ5TUhC9lZKiPGP6POwuOooLsSB
FZfDdstACZzqTdR3nMo92n2CskiKYmq/H8mDEKBQHK5b4tbFsBO6Vqg8tiH2kNF4AqkYRYvhx/KO
CwdjRcxSCYq2U9nemUbyp8TTaGOBKQuMUYX25mJQ7Wou4IlDvOmy/X5OgRR0MGVV5LmpKEvyJGuy
wVmZHYFjHKLFIRiDZH8D1bK179boMXBbvUYwvAj+m3CqDSc5Fej9LpJd+3YGgR1wPci9BJ051JWh
Q5PHO1o3dNDx7s/alJmh+9Q0g0HMj/n9r8h8Y7B5dd05z0+yLb3+bWKqkGOdNfia3BdNvMNP8zSe
06iok1+NqYbTIuhDEfKVgCZyJdwHXFx7fk1V0RwMCl0V9KAPRa6Tygw+e9gXNcAlyJx1MeCEoZgd
nb0uxi72a8jUpNNtY+hR73W2glcffOxA9AGYhUg+JinFw1qAJxbAFddYc/yVQAOuQYMiqUB6fpzH
tHI9QammaBxAhPQuqRODhhiOS/YmBm4qINxFbA47NUgN7bFX0ZSMrGg6GCul1MemqkudvhOFGlAe
xXMnepE9e1eerxw+p6JMtkmuU5BDZ7RpQWV6a8rhCNze5sCA5/pAAD2GkVPPbZkVJkUXPlFcxAUX
yKYBCVHQpcrQQiMT+MdQqgZeDxJ4NQgEJEWGcHbsJZ+ZEluibN5HzFkvMT3uR59bF8bc71L/Lckr
6sq/hRqABJaR1Qe6rG397bML1ohS58jHHA07HJbfCwtz6wy+RkK14G+7fkGLGg0+YvJLawuPs4Gu
aZuoNgzqwM/qJAVePLDcXSdV/PL3Gjf5cKS9shqioWHFSHo8fsgXQYutoIExi53ODnqbD+dIr4j6
PERhVsAEyheYLRr9FWAAUIc4hQ1lbmRzdHJlYW0NZW5kb2JqDTM5MSAwIG9iag08PC9GaWx0ZXIv
RmxhdGVEZWNvZGUvTGVuZ3RoIDM0NTU+PnN0cmVhbQ0KSImUV8uqJccR3N+v6KW0mFZVZdYLhBZ6
GGwssGyBBbYX4mqQBnqEPZL+3xGZ2edUNxgjZnEnok9FZWXlq/7x0Q+/ffj+51+34+32y7/fvv76
/Sv+989S5OO+ffTnt9tfju/f/fLuw/bD2+2v7z58LNtHb/FVt4//9e2fXr769uWrr7/YXj75w7sf
f/vwdvv000++/uKPX255zO2zzz7/Ep/+89J17L1u0tOutWzvQbR9qDyYw5g2Cpi819S2rnXvIwOX
XbICK77LA7++3BlqyF5HXdYU/EIXzbLX8tyVGlcGGmnus44Lk/cyuzGpjPU3be4tufXQqfPGdBJj
b7RE9gY1aX2fpT1PE3g5TTBUgAdyXda0vfb2lIQL03PL15c7c7jf+9XQiUO4SILBvaZdGtzcsLYT
5312fWCo3hhoVLp5LGsUBuqiWffcV8OuBBX6fvUfiJHH42wVf3p/Hr3OvaexuuvGQKKlHU58rml5
fzoLYIiuNt0YCEzBccrCjFR21fPm2/qbZ3RQp80b0/Mz6GDXoKVnUJ6WPwP5xtAdsDovwQ/3dN7s
qUn/6VgD+cYc7vTZbkySYqoJacJ7bJXBL4iB59U7XG7eCQokZEJ7LEB0zVyfetcsf335+/Yzkj9t
P75k5FDW2Tu8mPDvzUpEgmlhQbCYGi3h9K/vXz7/bvvkbz+l7Zeftq++2775H6VmprPUfIP9Wp+4
kbpp7ntBmL4HM/aMKNDcdkHctd6QFh0Yt6kFuO6wBZj1Ahu/3JnDmC7U0D3laWumTsO9ukbTBgwe
we4aK0MNJIpZ1qBeN+I83a6WiAUWd8OMMmpcGWrkXVI1Vfi8IViR4DxJxc00hLsK94RLcTVQuDFQ
QIJkWKwJ1ycda6DUBRjekWk4VaxIsM6MuBJUQK1CzGuSPTWuEIQnAmsic+YwBfNNSgiwGRIrQ422
Z8E5cPmKCkzc8zQ8cjU8agbGDRTXuDJ+kknvwI5pGghAgTdSRaXs7hwtdrI5xTSuDP2ZULmbeaML
NOhf4b0ibeG3huDWYYGQmofGhTiMEK22wk4PBdYPRZfIMkxBGv2LGld7SKzMYfecyjSGiU9ch/+i
oKgxUrQGjui6MtRo1pV8X5y+d0SKWmzkzghFXozhEZvMGzfmMIa+5emm0A5Ez7TgSdoNCtMCW6Sp
JnFlDmdqNYcWSxTWsmYuH1nNjNINlqxhxUK4EUqzwPBqiCWco+J4MqSB63mOhTjiYOI2oMK0kRDy
jlsx2JLDoSx1d+YwZlpuovYneGKgqlOCcZERJ6PgZjyvRrdz3JjDGEnuPppj+PwF6oBhzDyGw44r
4xqaYw2cYLg6zMUgO4LjERIr4xJVxS5VeIvAQ4oXNwYo8ESRY6CkVkJjZaiB/1nZQc9ovmaMKIdK
9yDIxKAWqztXIhR4JyxcOs2hTFqWaYO4gQeKG3lgvw+xSvf4eS6OSt/uNX/tPeyDI6PJ9I1uTx1l
iv/DYFS2N/jaxigs6R1FqrSpTDjo1ZwG2+WjDeX/14bypQ3hfNmiFsUdpr03Zozm5SnuoTJBk1jA
YFTFEbvV2VI9pK4M3YDGZKrwq90DQr55rmBgNNzZ6pAKon6XV+YwhsFl6TJjDeOB5SiJ4ZH8+xwz
NFaGGu1RfnTyPuDH1O1sjAveNoYlz2oZERArc9jpRnYP9TxMo0y3o7NSDDZOb1TV2+GNcX9MiWLL
QIBdnCOIOQsTS/PirBHbV8bPkj2z2esJU8mG5yyOs3oHnaGwEG6EzOix7AA4GAcn4pr9YplonsMt
LnZlPEnZhK3SimXHqOptqTleo8n96UVvWjN+b6KMcjKVTQTY/QncPLyiVOvDipXxK8nDt/WQRB9i
1rFwTk/zYtc8Is/uzBGMREe1Ja24nWIV62r3ZUyEHV3yhA85J2DOwN+ZOIO/KWgfpfQJe9FG8GpT
Oq6xtFVc1e/J03LNU0RKcc9rtnERTG4xArBxDn9F0eIeOBrc9Iha8WFY1R1Q2QGBfdQZrESGk7nM
880VVsZztEa21DkiJ4vlVwqNad8ReiMkFuKwU3SGMTQTB5vJQSesglGTY4zfffaJ4sYczqg3XsEB
iEv1JE8sFFNtBmIxqj4335jDGFRnYyy7JgpYzGgKpxL36lXBa96VOIzgdGzzafEVWn2G42uEOMpK
OwWe2NczW63umM1zOMy2GkVI47NH9I3xM/TimpPz7uQl+HXhteeaLcpSraGxMkeo5kgDtTWZv2AZ
YqGabKxedfgYpMaV8ftg87JQpekoN9Y/EMEc+CalNPLdXXFlDmfUt+UzghppZi9VoSExXxC7xsq4
Bp8S65p0/mK759Oa36VwQlWGOs7UlQ5AjuGUaENvCltx74ysIcLJNBdPccwimMXa70hxuaT4xIvH
83egEL43ImXvEgzONpuVOyuEfDgAt/guw0rljTmMKS1Ko0fliFzhBM3PqfnYq3WExMqEBB2JXGjV
tz2TnK2aZhYzHLET+XVlqDHsdWkjwqDGtMHQGjGiB+5EJpYYECBxIw4QeK9Mt6JkrhDLH+gh6jrY
bK8usYGDAlfmcKb5IIPENKj+POSjtIcwcQuBJ/blxUoXNo4tfaZBI0EkEU+rn8AWk3fGNWZyhiN2
T2zizY1EBtj34poqp8STcIXee2jagjb8Owcb+xxGtnz6YWUowU1doulwI6obpfhLnMMoSX6QK+Ma
ecbhe7E1ReNgHFKJuztXWguNlXENKW4Z+7phdbt0uB32yuAKi6s7E3YMv1MMxbZGu2MOIsS1+Ap/
NNwZ16gRKSX5GntdUsMhC5vBfkqsjEv0MIMvOOIRocaeSjyTPMx0jZVxjdndyanTHUwil0jFIDfT
xOrkKXJlDmNKdULFlrhDWZu6YW3u4CShsBAuUMPBqWdb0XOcNLvi6IHTCImVcY2IDKlu95C2ePcc
EcSeCCGxMEeIxj1PtTU+Pou9o5YttJ4SC0GFYQOqJbd5DzhyXavBXCLkxRWuzBFMj4P0VUKGo6qR
uRIKKxNGRAVRcW/OiO9qEpFRnh9PFJvX2Fx6GBxxPiWMCa/qeYCVie17hFjWMFkibP0IWQJHfl2Z
sGNEueluRwk7ZEzDMiLvh4bGyrhGOS0bzdfoaYdr1jPSZw2NlTmCmWFH9jXxKJVTIxx4euOJjxWz
CBG2szIXN6nnwOl0xcq4RNe4gnBfPwuauuaQc8/TiJVxjRH5VPwWZy1L9ZqoSXGq5BJX5jAmRwMQ
q95zP6N0OMyR0iW3kFgZl9Ac6TR82xqB0lIzfJ5UWg2NlXGNdjZTS3PgeTYiMTya79FmCY2VgQam
uxRp3VCADY+zAXTDJW6Nj6vXlzvjGhL3VOlCasQv8DRzjejy3RPtxoTGkIdl9osetcChxi1plZBY
GZdQPY9f/8t1teu2EQSxXl9xPxBn3482gcsURoq4dxEX5wBB/h/IDMmV91RJpLS82bnZWQ7W5Mz0
tMywsiQHJqFHhhoeMpjJ7es+mN4CzKmGTgsVKndyZU4yOmq4ARzriu3egQx7DeARIUljZ6iRVVG9
V6xZx9UDBVaGpxQ+sdarmibegOGhKCNj4KVjOFQp7Aw1ii6NGbj3rKIfSGe8W4VOo/TAUGOlr/hj
kyVrKowGHJF/w5MSV+YEk1aCJ5akHPVGAO8b7RLYCK5v8E0FTrlHqxe54AgF/2MCdkPvElfmFEMN
uDPHSZKC8RNLYmNcwoc6PtavF+trNmH4PirsVI9mgDA1uFVE93tgTjA87840rBmReIQIPFsVbtLY
GdfonMBg0nyN2xXinhNwbf5U4wsPyZVhHAW3bEf39b2EEYEb4sqyDmZtSlM+doavhXbCn5/4Xjvj
GJMVi7vXwkqruDZC9akVXTVeYA4a+juqsREroReCCglG1Yikk5n5jNFZ8Zx+Ri7rnN4x18cV0+Ap
jXHlkg1oDo5xva2GszNsOBPZ9X2zSY3Kp0xp0NXae0uS2AjeArNzW63wHh3CVXdibIwqzLvF2BjZ
lMmdxC6bMpmZnOS7kgbScLc6G0PD2LUmVXrnFhlHXs63cqcxx2V9N4YaGae7ybPbPwJxlptOyk6O
y/vuDDVC4Vg7B0erQYlAVKee0PMaRjZGQ9Go2gmnj7WRwkEi5CzFIomd0ZDZyaRWKAHT4ZLEYVwT
emU0ZnKJj0YOsyqlJg+jPE29syKvc2VOMH1KdBSsaTHq9AOWNvRzlsTOuIQ386iCdJNhYwmKvmti
TGpK5jAzTcaVOcHQxg+YnB6ivRLfitmiChhwbqZPW65wIVzAHAXSZwJ2/7U54U4YxDRsdjZmnWQP
4pE5wUR0y4H/V3Qf07HNtemdqwBPmNdH5gRTJoMedkaAcZFMnHbHCNF+pjXwFyajWc10fYBJsoE8
qoY1sqL5Gmb27XcV55U5r4yqgkaqUSAX3o4tlBXExlAga1qk86zwcQgzU3EZ/3oPYmeoUVcQWNG0
0ZYGsXxpi1UKO0OF5f5LZxR1+T2loi5/rLK6MkpF7pc1ywUVN28PL+Dt9uv4c/t7C8fvW0uWxVyt
t1hpBovavnnnDcNq+kuqbjKsH+dj1P40hplmS7Z9tY/odfH2cfv2enz9+R6Pf+/H8+vxcnv+8f24
vdyO/wIMANBFps8NZW5kc3RyZWFtDWVuZG9iag0zOTIgMCBvYmoNPDwvQUlTIGZhbHNlL0JNL05v
cm1hbC9DQSAxLjAvT1AgZmFsc2UvT1BNIDEvU0EgdHJ1ZS9TTWFzay9Ob25lL1R5cGUvRXh0R1N0
YXRlL2NhIDEuMC9vcCBmYWxzZT4+DWVuZG9iag0zOTMgMCBvYmoNPDwvQUlTIGZhbHNlL0JNL05v
cm1hbC9DQSAxLjAvT1AgdHJ1ZS9PUE0gMS9TQSB0cnVlL1NNYXNrL05vbmUvVHlwZS9FeHRHU3Rh
dGUvY2EgMS4wL29wIHRydWU+Pg1lbmRvYmoNMzk0IDAgb2JqDTw8L0FJUyBmYWxzZS9CTS9Ob3Jt
YWwvQ0EgMC4zOTk5OTQvT1AgZmFsc2UvT1BNIDEvU0EgdHJ1ZS9TTWFzay9Ob25lL1R5cGUvRXh0
R1N0YXRlL2NhIDAuMzk5OTk0L29wIGZhbHNlPj4NZW5kb2JqDTM5NSAwIG9iag08PC9BSVMgZmFs
c2UvQk0vTm9ybWFsL0NBIDAuODAwMDAzL09QIGZhbHNlL09QTSAxL1NBIHRydWUvU01hc2svTm9u
ZS9UeXBlL0V4dEdTdGF0ZS9jYSAwLjgwMDAwMy9vcCBmYWxzZT4+DWVuZG9iag0zOTYgMCBvYmoN
PDwvQmFzZUVuY29kaW5nL1dpbkFuc2lFbmNvZGluZy9EaWZmZXJlbmNlc1szMS9maV0vVHlwZS9F
bmNvZGluZz4+DWVuZG9iag0zOTcgMCBvYmoNPDwvRmlsdGVyL0ZsYXRlRGVjb2RlL0xlbmd0aCA0
MTc5L1N1YnR5cGUvVHlwZTFDPj5zdHJlYW0NCkiJPFVrUBRXFr5N0z3IoxGGHnUMPRNKEXmEp7CG
h7zEKCACxsga8AloNKKIoOIuViorSitRcVejbjRZ11AbFUxtrViCCjhgC+jITEBAhI1ERWPU1fU0
nrFqL1C1dX7cuvee9/m+exlib0cYhhFTMuKTMtL9UrduyS3IXLlxS0BoUNDohZf6HqPq7FVPZxEd
Me+t9a2Gg5muUDgRDrh9957H++6EZRguesHcrYUFCQWbtheuy19bZPRZPdMYEhT0O+Oq7cYFBVuM
8VvXFeduzF/5gTFuwwbjmM4WY2HultzC4tw1HwQmZS7evinXGGRck5tHCEOF8IQ4s8SNJTqG6Bni
ZU98CPG3I0EMCbUjEYTEO5AUV+JAyDpCPiekiJASQhRC2gi5xRArYcoJIxjJdOLHBrGzmNlMnP08
kmyXxmTYLSErHda7knhaOkkmC8kgwzFTmUAmhtnHXLGzt8uy+wfrzBawFazVPsz+C/sm+4fcIm43
d4K347P4w/wLTbRmqeYrzVuHLIdvJjATPplQ6ejimOm42bHa8Y5TrFO500/O4c7HnQdcfFyWu/zN
pVdIEb4X/usa5priWuh61fXfEzUTD7o5u+1x+81dcv/rarlB/bWBOdCgTmtgD+jUPSOLbHt4qEST
iDFQxcFjHo14TYTRje2QxjZNpx7SQAxWcf8/H9sJeE6Aj8qai4ohrxnmNMOHzWUl7s0tENFyvRXC
W7SXr8FSdb7Yc1O5251yMzo6NWVOjJLaY9CWXEO9bb5o4dUfRjK5RN7mjXli9traSwZqU3f+wqVL
Nbk5ElXLzs/Llkb9/N7GinOoLfXVfXfcV4zUuk+sOzeuPKqYva72kiSAdKoYqkwM3LrB3ocqEUqx
6gbNeIcJd0DVQqzCUl7AFl+Yx9TAZLbGVzTxP8E8LpYX0uGgwryCWvYVHBShVsFaqtks9zEDveyA
rrcvihe6ytrV4XbmjgWGLSx0lImQ3AJhsAJyFsEsTMbkNJyFObiiFcMg2dBuj/o8mARREFlLFz1M
qcVJGIlReXSZYhAiZGVELGHgs9tss051UzBwREzmMRRDLuZ0dXHfnzl0TNbv5+WKbSV621EM0QjH
ZEUd6GBau6HWwrbp1GTFxvL7IA3gLOzSg13kz6jHmcmolaWrazm58el/HpjSYyTMQNt6lPV/2Lez
slQSjpR1QFMLFCuMGtvJ1g2I8qAfSDDl2XNwBn+c1BByQII82M1dsgWmwglN7clK2bBXI2/fsW2r
hIm46sQq7jL/aHCpT3BMagSShPuyQaiiTu+3wcfUaaKFbXwgyh0zwAieb16ADrTeL/H9lOWbZGkv
L391rPK0dBI+4uCsgo/5XBy+WMrJ1y50Pe9J8vOLTvI1ftIvS0JdWTs8UODTdqa9C/o7WbDQdrs+
GwJvmBI0jB7xieuz1hn28uB5pAumw4yppouFsuHvNzh5aXU0fh6Im2mqGS/QCAFSRbvoFQ8uw9e7
bw4/vTl/hm9mgr9BuEgjfKrAg3am6Q70d7GwiUbY+BA2QyJkeIMRA9DVNwS9ccovAeBh7fyh4bxh
P4+ef4zD6egzNX35admweSEnX914V2qDPtEvpeP5r82WJ6+t6BKQEZtCQ+Cf5T542se86WXfqJHi
KIhssv0YljooUIta4TerXOJ+VP1Ze1c9o7Py+BdKiTi6vMvkrHwfFHFQw2sfo1H1FeVj6Uc+kx6N
MnE3P0zpeeTsMZOsF7plBapboVxxf2mGf3WusGhfv9TBPh4cH1vAbTDbnHDSsF+jVRvPnL9mpSiJ
uoWshF/yZsp5KIcYTVfdsoT4ZVmJBpyDQyJUwzyN9nX/9cUREUuWhBsESCprU5+2MU0WtglUEVeC
D0bAGoh7Cowsra7n5FkB6EWB7QieFOwfgiN4wGyY3B8tS7VXODn8IUZhNvpjIK6gDM2gIO5WmJdm
NdnC0kRLeMgHL2pSBIXoBSLmG7CEN78TRbUb/DQQCw7TMQ0XoWY6xhmEU7TarxU4POqBmqshCj6D
r+GkgifhMPQpNiMvwJqytg3FcEaB223uTRZ1T4e2vglei5hL8R0Ii8Hn3hNZ2s9rd8oVO3fql7TB
EC5MBWd00mjr5Yhp6Ilh6ERTioNI0FDuxoBH/1xazVVODuvHCMpxf6qxXBKu0CkOKWAqGc/GDEPg
xEM2DnH3eCxSOW6/hlJpkIviMR1NHHVqSuKF9ePMHy/AoGDviEhP4Tp1NsmqlpcwfSML2D6dmf9R
3cVVXqhQxt6BbxccXyvBbHzHtfO0v++44zWnxm8q0ipzpR9tuzgznzn2pGKKLZgrzd+WJesp47Y3
lNZImKIGcwk0ypnxaTZaVDMl6uhAV0EohsMyKqEQDqsgB0MhGJdRCcVgzJEsOjpWLZVQCAEP1NJx
xqIHTsYQqqCFyRArCZdp7tUKNI+OBaydY72ohnge3B8O0AbqgvrR3YDlvNnGiEA/C83jG4v9/RZm
BBiEHmpar0DNmGnLuGk9zOVpVvVcL48BUMPt+ubLw7RUTe+3jdYn+sHVt+ZXS0cK1h9KmIprKJCf
iVADXprG03/adcrwz63frUjXh368OFwSyso61EcdTFsnnO1kG3pEuTcYpsHke4OvJfo1vFoGkXrF
1PLLIyVNls6ZOHn+bRRQFxLqLeFGeFWHc/VzUrJjkI2/S5+kC6eKR0SFgaNmFo7qzCMiHFBsnalw
kBduyz0Z/2O9SoOiONMwY9vdIjoa2iY64/a4SwjgEd3oeiAaTDCgGEVAjShxdY1xVSLHcikwkUPF
dkRBAxpULl1PFg0YAgQJ5yCM7XAVEhCNlpu4ZIuqZfdt8rFb+3ZjDJWUKX+k5lf3N/3ez/M+X+SA
f5R9hvyYC4FzDi0MnFShzBWSdYOX6PgP4gLUZsRVxWMz1smX8EwbbKwNw31VDY5m+yIrnJG48iL4
De/8dWAP2Bcr8FKHNGVPmC6gCdpZsPe+TcYSepmfKFxeR4t1ZfdaKndMFeJ34+DOIaEHyGKDNZUH
Cl4/0ilciGDmrHae5rGtrFTQXjfWh0TK6xvAN8q+W4JWKxfb7WBhuPISNi8lS3EklrjiApj45F/Y
51nzwIboCb95qsrZptO5OjjoxVoG1/Pg2Fnf822TOxmHJOzxOrFZ19cnaA8ZzbJLg6bUSpVCKk9m
ATsFXGGC1CkKuypp0dfTiVBzepAaxjzohhGPq1eKQgFyw8oWNONCRhENmanEaN4dKQealRjLrdCK
5SiHo2ith9iAHiYW9f1QkLgI3VrLgL8XSWEjTXvUGDc/IVqBKycTZziS2QYrbp3W9kdgc9PZiTi6
r5o3Y3knjBe0R4xm2FANr9VgqNByZyjamUCjg6lAt1oxXAT5ypUzHWdbgT8oyA6YfW6GDl7y/A8x
kMlkpAtZILRW8n2ftFb26NsbA3+Xijy/JztSXlEDU82afonqd5DkFcDXED6PgZFtJ6+fPJEiCmZW
NJqi/YhtJHETwlf43WK1l8k2M0w3y1TL+gYlYYvEdSELMXyoPx1WXhtbq4dxMLoB5hi4Xtm4LID9
6HCykivXJe7oIZOIfv4rZBqZ9mgK6O9WXK6+qDQxZU+0LoglIxcFuS55p0AUYD68zTsvv4utHVPT
/N0j63vEmbgsDXQ3aG9g0OsasdgaHIhKiep2kCCZyTPlHjsr9OS21T3Q92YsdTeQKhwXFsZvaibj
CeO9eEP0s5HI92K1aESMAv19NEJ9Jf+Pb77vyZj+689LsujFaDcguI/WQUAUhChuVB9HuxhwJ0cV
igyAAoUi34Ld9AIGcwmgF8qTvRThdaBhYFKUpkOiOsCOJyPa4oszM0xqFRMPJYQGn7AIsgW9yyOy
lak2qkN9SYKLWELFRwKTa8o9mi10ZDc0d+uffLzkDQOpxtfseVNeWo7QduaW1KH/e5bXAvW1kt57
zUQ7983VXiGY3b3YDTde0y9a6OsVjhIDd4LpdI6u3Zt9WrIhb5US1/FjybKFe88pmZ2PW1CM0rWS
Z2ZahtBSYpUnW6kSSOPJdLAjDDjjzw4YmA6uuCpGYqeciR0ZSVwFnGfm4X2wAZuHcwlDbGfPJjbE
ZvZDsFWhLVMPcYSGcF3STTbyEiQx51JOq7j+bBqMBYfhuJ60xVmdow7RlJWjK1/OWsgxniv5CbQF
rsPRv6/PoOBSpu8Hmo0/wPLKcFjyxd+pblJiQnVkv8RyWQP+y1iuaSMbcXiv6uaK+Mde5FUVmcLz
kEnWKhiS9kflKNXlzEpptzOXU6+euCy05VRWN+szM1JEA5d5m+XMYvyROHf/1W+EK+YvqHV9hHWd
goG6mjW1VgiyUkVmXmx8E7R9zXXdAriRvGCgdNXlORX3bgSJwiWEeWDVb2e5Bf5eIPMh7zwZoVu7
MWTNDH8zUj3ZecAsczWaPonqAx+euINtdO3pj4cGMCEl7n2PUzBagCNgX0PswcmbOHn7WVjtNUV3
IBzs2yUok7iSduXbl7/wQd6jLHfLzyrsFY2FitB5WBAeJJnlSojG81XCTjVaOwWowoleLratVW1k
yptwlWxxaGMgQBZxq+MqMQzS9L7QxD+rqySxICFfQGlIq3s9VWyDx49MUfZZA+lcIazC77g7yB/f
0+n5aRdUnZD24fEwAcaR72k8K4TFaPUthmgH7ejEsKQPVZtJFxPzBO4OGS/b0t4MGT9oSyeGJwUP
OyskWtlO8eirIl+TL79DQQoE8+ggPfZ4vABaspr+iiFL4RTKiWR6IYOjuohOjE/YK+oOMWLCJ4mZ
Ak7OIjyBuSSZLCWn8P+ghdX08cx0vPRo30ViHJgSpUmTI6g04s2Lfwu+eftmUeM5AQ7L/YpAdhqk
6H1hSbuHCvHXfVgIF5nCexxsGzywy5MOitr1wSb9zt25eDfZItbLXL2mWF5IFTvIC+vJVWZHDI6S
iRVzcs7kCXAV+umSQadVkMFeyTKpl53IiOhwgVwl/8aL7rfyNfDQ1ABF1cjX+CqmGjyU/MlOuRDf
V8NeCjzlQrzQXseDAAbvHR5PH9YwWhNWya8G2Pv+Zvt+CWIkpPJXcUGI5IvTSOTP2Q8xuB8G/STZ
D2JYrjcFPFRa1RJXcIHrmlq4RkEQuPCdtxo7O1c0urv7+Li7N/p04iYKfRosBrV0WLSo1Dx+DH2Y
7rgDdu9feyo+yn4uPva+mPgo+0XxcV5exaPU+OzLLhpNln3pRluYeWCH3fpJJE/jqPh5HPEvFkfF
L8YBthhIA/M2usYbmEg2l0pg8K1DKrYvs8L2Sq68TJEDr/Q6wcRYgeuKdqPFtMPpBTnGiJCwpNC/
RB8ThQ2seHb/xfLS7NpPg/P/dAwVR/oNGrSpTe2i7sWVzjMZgkn/mkqELIErmOGDoQxVgPapDUZG
/abbQd3Jf+hSmtEx1IxvhjfjU6MFtld0VcBGC1L9P5q5/iI4g+bIvAKYRFhYrK///JRo2NtEi1vj
1pOXnb6Gl3YJkM+cqKDJ58zBc+LF1PxRUK8+1zFgd/WfXTBBX1z4EfJ2b1YTzfWLWzLWkAV4d6DI
zK2Cz7tVzMFwceuRmFEBjNaYIYsZ4JvBNIyW7KTDY8ZC7AS5lP+/AAMA09sEew1lbmRzdHJlYW0N
ZW5kb2JqDTM5OCAwIG9iag08PC9Bc2NlbnQgODgzL0NhcEhlaWdodCA3MDAvQ2hhclNldCgvZmkv
c3BhY2UvcGVyY2VudC9wbHVzL2NvbW1hL2h5cGhlbi9wZXJpb2QvemVyby9vbmUvdHdvL3RocmVl
L2ZpdmUvc2l4L25pbmUvY29sb24vQS9CL0MvRC9FL0cvSy9ML00vTy9QL1IvUy9UL1YvYS9iL2Mv
ZC9lL2YvZy9oL2kvay9sL20vbi9vL3AvcS9yL3MvdC91L3Yvdy94L3kvei9FdXJvL3F1b3Rlcmln
aHQvcXVvdGVkYmxsZWZ0L3F1b3RlZGJscmlnaHQvYnVsbGV0L2FncmF2ZS9hY2lyY3VtZmxleC9j
Y2VkaWxsYS9lYWN1dGUvaWNpcmN1bWZcDWxleCkvRGVzY2VudCAtMjEwL0ZsYWdzIDMyL0ZvbnRC
Qm94Wy0xMTggLTIxMCAxMDg4IDg4M10vRm9udEZhbWlseShNdXNlbyBTYW5zIDMwMCkvRm9udEZp
bGUzIDM5NyAwIFIvRm9udE5hbWUvTFJCRlJRK011c2VvU2Fucy0zMDAvRm9udFN0cmV0Y2gvTm9y
bWFsL0ZvbnRXZWlnaHQgMzAwL0l0YWxpY0FuZ2xlIDAvU3RlbVYgNjgvVHlwZS9Gb250RGVzY3Jp
cHRvci9YSGVpZ2h0IDUwMz4+DWVuZG9iag0zOTkgMCBvYmoNPDwvRmlsdGVyL0ZsYXRlRGVjb2Rl
L0xlbmd0aCA1MzE+PnN0cmVhbQ0KSIlclMuO2kAQRff+il7OLEZ+dVeBZCEx4JFY5KGQfICxG2Ip
2JYxC/4+ffuiiRQk8DF2VZ3rpkl3h/1h6BeTfp/H9ugXc+6Hbva38T633pz8pR+SvDBd3y7Ps/jZ
XpspSUPx8XFb/PUwnMekqkz6I1y8LfPDvGy78eRfk/Tb3Pm5Hy7m5dfu+GrS432a/virHxaTmc3G
dP4cGn1ppq/N1Zs0lr0dunC9Xx5voebfHT8fkzdFPM8p046dv01N6+dmuPikysJrY6qP8Nokfuj+
uy6OZadz+7uZkyr/CDdnmUh4rzdJVWTxPBwCO7IDv5PfwTvyDrwn78E1uQ5csk+JPmVOzsEFuQCX
5BLMWSVmlUIW8JoMt3JL3ga27GnR07KnRU/LnhY9rSVbMPtb9LdKVjBzWeSyzGWRyzKXRS7LZxQO
SeWYyyGX41yHuY5zHeY6znWY65jFIYvQWeAsrBXUCmsFtcJaQa3QWeAs8lwnMP0F/rIir8B8VnEd
hbkEuYS5BLmEuQS5hOslWC95/g6QUZlRkVHprHBWOiuclc4KZ6WzwlnprHBWOiuclc4KZ6Wzwlnp
rHBWrq9ifVdwKLItnNdF5Bz3rEty/N6SkWXtIhdwq+lfw7+mcx2/p0MNh5pza/Ss+RzCARvmuTOw
dcION5/7sr3Pc9iS8W8g7kXswn7wn/8U0ziZUIV38leAAQBvewc0DWVuZHN0cmVhbQ1lbmRvYmoN
NDAwIDAgb2JqDTw8L0Jhc2VFbmNvZGluZy9XaW5BbnNpRW5jb2RpbmcvRGlmZmVyZW5jZXNbMzEv
Zl9mXS9UeXBlL0VuY29kaW5nPj4NZW5kb2JqDTQwMSAwIG9iag08PC9GaWx0ZXIvRmxhdGVEZWNv
ZGUvTGVuZ3RoIDMyMzcvU3VidHlwZS9UeXBlMUM+PnN0cmVhbQ0KSIk8VAtQFFcWfU1P9/AZG52m
R+kxPSMfPwiIYJDsigoqIoJRcE0WjTLIoFTQcUEZURAsPxtoIYmfzfqhVt3ETxHNphBDFDYQtVwB
xQ9IzLpZJTGrQkgqoLfxzlbtm5G1Xk31vPfuPfe8c897DNF5EYZhpNT0xKT0JZPTNhXaHRm29YUR
06Oi3BtB2lhGe02nKQYJR2HuixcvZA6m+oNzJBwcVTt2ZISR6BhGN2PuktxVuXMcG4oL8tas3Wid
uHqSNToqKs6aXWxNcRRaEzflFdnXr7FFWhPy862emEJrgb3QXlBkz4nMsK/LS3Tk50xJylhavMFu
jbLm2HMJYeggPgwxsGQUQ8yEBDEklCVhhEToSIwXmU5Ioo4ksyRNRzJ05PeEeBOSR4iTkHpC2gjp
YJg/EmaklUxkJrNRzG9IAjOXXUBSdeley4hNt4bN1xXoNhMynWpAFpJFZBe5SP5NnjMGxso4mE+Y
a16jvbZ5NXv1sqPYbex+9qxO1mXrGnRDXAb3CXeFZ/h1/A29qC/W3/RO967xbvZ+4RPuc9yn3/cN
3xrfHr8oP4ffeb+fDckGm6HC8Lmhb8TaETeFBcL5TLVJ62tiPmjSQprYD0zae0OLXe/xUI1XJJwJ
+zh4zKMVmyVwT1x79a4Qk7ZXDzNxH/dq3TMT8KaAVeFD3zDtwLGQGi4952eDYocwmCTDuDowd4K/
YuVnoSELZQyRMa4BI7pwhDKcBmPcecZwqQtGNEAExMkQkgXyLDDQrE70r0MzjpNxUg6GJaCiCF1H
i6C8n4GaX9lGKJcgH8t/hXLI78d82B6C2zGfF/BCEGxjjsBS9kiQ1Mv3wjYOR/FCKGwBlrkHLew9
2CJBC7DYQoO/VkGk7EW23QQiiCjywq0y8NV2gR9zmdKrhkAWbpRJsKwN4iALshZCLC7DZakYi1mY
1YpxsMwCvrowB3iBFZSTwPT1nUQGFbQ60CvMIqxQgdV6nQzkgJFtMWlJtHKk1oscj0k4q/u3l1u4
48f3HVHlKl6tLCyUXQpG6gX8KyUG+ym5+zTtviZKYKT0jLxrr274n3CPqpEyCM3grzqNe4b8xW80
1QSBPFYPZXJopt//ZnJ0fhVSOKjixcfor02S1EPz/rxaacV0DhfxrZDOHaw7fEuVhe8oT7ANwHxg
jY9AgjwYHQJjxMFHJjjAw2jg2yDoTu6d+OOWKr2otZyqvXxdBp+o6xig4F4eJDwv0Vx//dXTuW+/
/e7qDAu9stcksIGiFwfbP89a/GZu1gKLAMluPUpoL9xFnlJ5aYHdPDggmMq9ETZiMJjQYUG6Jrl6
Ja3kmR6CnsRiNE6bEoshFuGwm2gG/S16CUIBtDQqajtd3EG/O+hGI7CueF5YRxWqo5HvvIqkNeug
jEaV0cVaGhXOC/AO7XhsERymkVvA11gPgdo08BYb60GTsBBex1B4E8Z0dasKVbFErSwpkfPAS/PF
TcgCoxcb4/Tq3AQrBgb9DJEgP6BWiAGue76qtPVy6tRHmIhrcApOw2xq/OqjRUOZzld0hjJR4gXn
sEmGj5NMCV6lHqE7cIeeQaCMljuZjqEtbAfN4U9r47jqCxVtHtMcm3ckWwEeT3LA8aCHk9yRc0dv
erYqUqtXKKdd4zgI4NPdplB4tOAAt9W2OU2VK3jVeW1rvYIWGHBvUSFecYNuCPDw0yL4+p0d7pOr
tUknaKFjrggKR2kHuCJ52156SIrz7s0N5xQ8pkVyHs4H3FdoN/gy5yjxtbTH58AloR2icTrY6YgG
93cVRkMM2umIxhhcpUCgCawDA2AC00AwfWnGByNBE5qCgcB4RfiaClEBOtg97J2dMPplQysglIfA
x72ggBL5GAMteMLtx2cSDfXXd36xIjFh1fLZFqGfAtRQgIJhgM3/B6iBkTyMwxoOQngcDzVc6cfb
D1AB9XdPN3z7QH6ysmNurXIwf+2HM81Y7IZ+KEHBT/pfTtnmz83KTrIIu8vAT9tJn4y/U/I22sPP
HkhqTxg958SHT4FTwIk9+WCUmy6cvfpDR5qqXBrk1Dnd9IxjQ2PQV8H18P0xFOUlmY7fTZh5V1WE
L44Wab2UJ2ynaLDd3YheKKV+/Q+1XCkvPFAhGAV3t4yVQ7K4Af5koj2Gj4abPNW1mhP/ll1allpp
ruAry1rPlVowSlvNoYUXCsr6p/XA+J6+QeMJCIAV4CM2noAJUui/0n9UwLvuUaXZ4/OKrU7ZBj5w
Rw9SfBd9wEfMSFWVi1GceqOx81L9xmRl5xa3+dFRjrEWCPhQuj24v105VsanLZ+T/FZB7RlF+Krs
efhTuA0MLHYab9En7X0IEEtumcDAi42n9H+pOOSx1peznoG5fxBiIToG3I8nWZngMVZVzccyOFDU
g79rpQTctYvX736VGjZ+Sfq8WNu9bxWhtIy64zYQ5lMq1KewT8KJQNAP4uG1zu9UJfMRpy5MeT0s
rethzz9uP/ln81Iqfg+npnZjIMZTfwkY6mGZUKRNfcnyLNXkfRDFxrNutOjvkaHG8jnfM3z7K0o3
U1UM9AKIuFG/dc82D8+17ahTxEY0Tw7yaGH65crlWw/q42cgl7Z8wey3WvsUt0sImHue/cScoTZx
0gt2xl0hdBAFSle810np/sipKRlvzEr68ocdCgzyavWZQzKYZzzHCRhuRS+cqoDcKl3/qKGu3Xzp
fG5SlUVowFyKq3sOTUBSmo2fUfqVMFLsAyFJsodxf2jsKG4zQyCMvQ5zLOJ9rRD9cvQ79uz6H6tV
H9NGGcbXlbsrjDVrz2LS4hWyBZY5XGGJdHyImUrkcyIkClbBYDJCxofLBiizQLcsdFcI1q3dAMtH
pxNZMhIjNDXABpMNVqRsQZmpUyeGMIlBgzxn3pn4XAeMRUL8Y39ccu+9d89zv+f9/Z7fw3P1NDvP
F3qIlEQmENHzw+6QIIiY6HO6usRTMR+rUZcwupTixOfSLvIc+n6mat+b4zM/9w5Pe68eIjLCvFqU
qZVfQbLuAhkWTyIecSU61qRop0ba2dDxYRs36hjs+0bjaXk7Q0uG0L18DGjSRggVk/Fa3uHVUz6F
pyzHSNbKJaDEQNJJYU60PQrN7p+8AGAFq+jPpBA2CX+t9xIxBNy3M/qXaw8aTQ08F8bwzfXOSdje
Dkmc0IGmeuEkUDEVfxsqlWOgZMvHYK+K7SERd9+bbHc0IkApw5tO1RVXnRvmhM+IkpHD0gNo4XN+
8hrwegOp4fPDO0J3WjqbHJynpXdwXHPttCFHS66KzxmnpaOpjbvR3Dvo0YzY8rMePEfY6sxr4fEp
uTlliNpbkXspUROfmZ17WGtGNfANLQ71CJEzK/VcTorlZKdX69lpbeeuO/p7J9ap547s9IKjGJl1
PYw1vqKPbmx0w6iRbpFz0aAgm0EHe0CBZhUNOqJAy9GhSSmQDToOVCFzXs+dH7ypUbuT0/bpk2/c
86tEVHLsrVUhT08Sgwrvi+lPzB/7hex6aQHUa4UcnB/LP/ylHiJDJRObip1+RMsc64otuP29Vk7i
EHsIbEMeKsQ0bI8f+Vt0V+OFj85z3zmvf35F03rWzGtBwfC1DTWJmVn7j4gJvHxDq0P9i4g5bAVz
L2Legpg/HVPxN5/HOFunJn7iQE8splvq7u5zF2+783nOPUfx2V8Thmx+Nmc3hxOd5UySuuRQ9UF9
9jC2YpJ6EgL2VgiRC8pZ/KHyWTggsiYJwituOptXaGP+oCjF/iMHeSBbIDKIJNtIZHLEOCPvrwGZ
XmQ1co5F72FZ1xikqoh2Igckdz2XL58X+0qVv9tmgVzkODEyrEv3etye9OovRzkYEoVRyEPg0/4w
vNCM/T4jBHbRkCZYKaKm2Z5w4qVK6k4Y/O3+hLurThsOXnFLXuSXlKRVMEpxwnlBxVurrbXcDNlJ
QThNEsCGc20TRXbQCURLHTeaqvyDgclx/CyXAFpxA+vVRBKITfxgBnZSVpu1BQdG4hN4KJP0gV7a
J/CqX+kpKKNIIAo0RrBAqeQL8EmhQLCoIJB2QykVTRMTKRVXX/lXcqJfDoDvvbM2Ak5LZbj6VlwF
0Y8MfG4I3Xjmg/1u1Z90EoRS5Mm1VjcAoatuN/BftzP+T7cb2MjtRgX9mtyr7R5TP9aOT3QY5A96
cZ08OUPK5Uzs0mNJdQaDLNLs7/0+Cqu01B9HLdLPiImxEYMGqRW1cA8k9ZXK35Dc5UjueeEAClaI
AskCkdjpqdHTl5ptZp5jfbCJQbt5v/HdF8lTR0k8d4yU25mN9tMjxu5H+WOVM/Iau2C1wyt2GqRB
wG6ZdQQHz3cFb7UEy6HtCWFY9a8AAwD5L94GDWVuZHN0cmVhbQ1lbmRvYmoNNDAyIDAgb2JqDTw8
L0FzY2VudCA5MDIvQ2FwSGVpZ2h0IDcwMC9DaGFyU2V0KC9mX2Yvc3BhY2UvcGFyZW5sZWZ0L3Bh
cmVucmlnaHQvcGx1cy9jb21tYS9oeXBoZW4vcGVyaW9kL3plcm8vb25lL2NvbG9uL0EvQi9EL0Uv
Ri9HL0kvTC9NL04vTy9QL1IvUy9UL1YvYS9iL2MvZC9lL2cvaC9pL2ovbC9tL24vby9wL3Ivcy90
L3Uvdi94L3F1b3RlcmlnaHQvcXVvdGVkYmxsZWZ0L3F1b3RlZGJscmlnaHQvRWdyYXZlL2FncmF2
ZS9lYWN1dGUvZWNpcmN1bWZsZXgpL0Rlc2NlbnQgLTIxMC9GbGFncyAzMi9Gb250QkJveFstMTI1
IC0yMTAgMTEyNiA5MDJdL0ZvbnRGYW1pbHkoTXVzZW8gU2FucyA3MDApL0ZvbnRGaWxlMyA0MDEg
MCBSL0ZvbnROYW1lL0xSQkZSUStNdXNlb1NhbnMtNzAwL0ZvbnRTdHJldGNoL05vcm1hbC9Gb250
V2VpZ2h0IDYwMC9JdGFsaWNBbmdsZSAwL1N0ZW1WIDEyOC9UeXBlL0ZvbnREZXNjcmlwdG9yL1hI
ZWlnaHQgNTEwPj4NZW5kb2JqDTQwMyAwIG9iag08PC9GaWx0ZXIvRmxhdGVEZWNvZGUvTGVuZ3Ro
IDQ3Nz4+c3RyZWFtDQpIiVyTzW6jMBSF934KL9tFxZ99XSQUKSVUymJ+NJl5AAJOitQAcsgibz8+
nKgjDRLhM/ha33F8k3q/24/DopOfYeoOftGnYeyDv0630Hl99OdhVFmu+6FbHqP1t7u0s0pi8eF+
XfxlP54mVVU6+RU/Xpdw10/bfjr6Z5X8CL0Pw3jWT3/qw7NODrd5/vQXPy461ZuN7v0pLvStnb+3
F6+Ttexl38fvw3J/iTX/Zvy+z17n6zijTDf1/jq3nQ/tePaqSuO10dV7vDbKj/1/361h2fHUfbRB
Vdl7nJymIrg3qsrTdRwfkV/Jr+CSXILfyG/gmlyDd+QduCE3kQuuWWDNIiNn4C15G9nwvcF7k5Nz
sCEbsCVbsJDhbBzZgelp4GnoZuBm6GbgZuhm4GaYPz5UZelp4WnpYOFgC3IBpo+Fj6WDhYPQX+Av
rBXUCmsFtcJaQa0wiyCL0F/gL9xzwZ4LswiyCPdKsFfCXIJcwlyCXMJcglzy+F+RyzGXQy5HNwc3
RzcHN0c3BzdHNwc3x4wOGR3dHNxKrJOnGdzKggyf0pDhU3N+jfkNHRo4NMzVoLZhrvjAYX2cShzb
2F36qye6WwixHdYWXPsAHTCM/qtL52nWsQq3+ivAAEnh7VgNZW5kc3RyZWFtDWVuZG9iag00MDQg
MCBvYmoNPDwvQmFzZUVuY29kaW5nL1dpbkFuc2lFbmNvZGluZy9EaWZmZXJlbmNlc1szMC9mX2Yv
ZmldL1R5cGUvRW5jb2Rpbmc+Pg1lbmRvYmoNNDA1IDAgb2JqDTw8L0ZpbHRlci9GbGF0ZURlY29k
ZS9MZW5ndGggNDI2OS9TdWJ0eXBlL1R5cGUxQz4+c3RyZWFtDQpIiTxVCVAUZxb+e2a6GxRanbEH
GXd7JiwSRUFgHIqYREUDEUFWRMkGDZccHiCHCpIQcbPr2QUlajZrMJ7R1QroYlYlAko08QDvhYgH
i+06yHIJhOT1+GZr9wdN6lX1X/9Z7zvea4boNIRhGDFq4ezwhTGT569bk5Ydm7x6jZ8tIGBow0v9
LaNKOtXsJqI7pr9oejGahWmjIHc0bBlz+Ddio56wDKNzmRUem56YHrYuL3tOdk5h3oqM5WstE5dN
sgQFBIRYUgot87LXWGavW5Gftjoj2d8SmplpGT6zxpKXtiYtLz8t1T86Oy8rOXNqeOyiwpw0S4Al
NS2dEIYGcWfIGA3x0BEvDfHREF+G+OmIVUdmexIXQlYQkkVIASEVhFwjpJGQmzrSTJgtDDPCQqYw
AZpgXagmTBPBROkW6pI9ybsUMYkk0SSVrCeXicq8xexjrmjmaSo1V7V6bZ72vPaJTqNbpdugq9Jd
Yf3YbPYyx3AJXAV3hSd8CH+Q/59LqMthF9XV5nrKFUZ4jPj9iK0jqkZaRmaMrHQT3LLcvnIbdPd1
X+V+WBCEDOGM8NMo91HWUZ+MOjbabfTuMW5jNo3p1CfpbxiCDCmGa2PDE+Q6tbuO2VGnetdpdxjV
rY4Fzq0clOL3Is6AXSx0cGjBehGGJs6dvNPbqO7kYQbuYn9dH54JeF7Aeh9IYY6CTXvUR2zh2iCF
ncgJIbBZYexQrbXDZhGqFazmhDvF7Wp1O9PQB3V9WrheLELMVQiGJEiMBhvG4IJotGEiJl3FYFhg
btchvxLcwR/8KsANeHCpQDf0Q/+V1BguZiFCVhykgIHlXdpLRtVXQX8HsXL4NoZcmX/jOnvky13l
sqmEk7evW2dyLsUAXtgrK+rJDkadMKC9YlSXKDjAlYAN7CehyASC/yM0ojUSTbLUFM/KdfaO5vql
YRJOx94M3GH6sKSwdL0knC1uh3NtMKOdufwjnO7Rwj0KY1xnN5jBI6gfTfMjc5Zlmbdx4Pr5TZq1
cfyl6rWy+avHrLz4WAhmT8RMjMAPgMVxMFna3i4Ghg88O99Y89B+Mcr2RnzUdLOQeyDfQRTmhJqp
VYz9HPzToWdvOTNtcIs/WV4qm7fxcn5ewTJJuFD8VK19qv+ub24PyN2B/YaO7yBJxLGDVnhNMjyF
12lWmqbks4srzIaW3Z/+8PA/JnAJaEIPnPROgN+8iqRvVkqGjvUb/OYiMRmeqsZN4uyIJaGzwi48
unet5lC51PnBYNZMk6EFd4Iifnvm7P3mCynzQv+weONGKeCU3/H7pmE2Zv4LzrUztT1w+kct5FE2
snshEyIgATnwQF8cN8UXzejx1AdM164f+fqYuYRD16K5VEvj+NiEw7J5lY2V61e3SXegRwxY3KC0
1jS02m97T30/Mv5Ns4Dl8gDUDzCd/dpO9XWxf2AC5yzVDQ1C04F8SGyFlm65QL9LVQ0t6h7jAIc7
HXHs7+jw3zi2n7sDiSzs4wwd6KH6ivLnkZ9lSPdxLYsruQewlv3sZHmjbBIeyApsaoUMRd/VCzv6
ZvcZBruMUMbB6IFb4Pkg+U7oQXMJb1C//Vvlxdsm4Gw3cKSEMteLdSJkgA9/qyp5/vxlCZFmnIj3
RNgEQbxhsLkmfs6chCUzzQK8Sa3/jZ2p6dfWgEPEZTCJenw5hHWDTpbi7rJy8FT0xEAvGAuTwXeA
OicIhNYZslTbzMrTOnAGJqM/BmCyJHxBcy1QIFdhunq1XUZ1poKPoADKFCyDXGhUnP6csIIyc1GB
oldneuEiyArKUARnFKcnJ0BycXtMPhxU4IhdX9uvJtkNtbXws4iZEIi+sBAsLYoslXCGInl7UZEp
8QkAJtuA5w21E3j5bSsKFKcOWAiByc9pjU4HtwfhslRHk7U+piWYQpOdhkmSgHupm+MKXqXhiKOd
oZBSUaUwx3sgr1d7HBJFnPJT1MDAz9fAT1JlPG6DcOc03n/RqkWxsRVd0vFJvJD7stRf4rUqeNtB
6EPQSFEa+tXcAqbZkaJtNvZylWoMW3pme8Nw4R98tzxNAgveZf/NwWtwl9176sD14Z1t0aVJ0gln
DNvDLXxplmCnnv0odX2sbNrGyesvfXRKwmBVT3cESPgFgaodBqEmcF//uWGIHbki8kiqBLecCWw3
heZM5FJ3RskSfWFlY26VhDfVRHYSfWHfL+KrXwzp/0LEVLDiUONLojIHQyokYhAlPomGFQMxUeo3
0rbnCi7gTcMFXSidVvp1Q28artQdVlr+FP0eKuCQxlDRNyzzHrByIHbYwQQm/ycomvEv1KMowhHw
5tsuvB8c/F5csFlQ6NVKhVpm6Or+l1crYTJHXVnJgo6jFjjKbjj0p92ULb7ly7p7dlPH0rtzjkqf
5mSWhY7HTProMxHKgOMvHtr0x33mkwX7098zvbUkfoYkfFL8TD3zjPn+OWx+rj39SJTb/MEXLG12
YCQoxM5U8DFdqj/3g/16tCxVt7Jy+F3akjynTEONhFnQWYF+prmx6RFes+7JklD1shuC3KsFmTqI
0P+K86ENNlNeQ4vbHXwBo/TCi16tAqUiBgLrBW/QYAchUFKXTnTG86h5JwoZJGENQIaWeKFFBk3Q
kKj6Mgcx5MB+6hz4KzWCF2f4O4Y5t7Ab0j5eMGyFjy9voELOUbewFk7IKb6fkA9bmsCtVX+iBzbS
ojkBXqLP47gn4P6P568KZtuHa01L7NDEw9j/017tUVGcV9x1nRmtuEkZZ0uW5NtoDG0RfCFRBAIK
iVII4KMQG2t9nxpt8AWrolAeBmFYiqABCcpDqY9Ei4iIgmgkVQExICCsEBYfKI9xi4Lc4Xwmp9/M
IpJ6wskf9uyes2f22733993H7/6uRzUei0fO8ePRaU+KLy82VJwPmokig0kbvYc3RGNn7aNE7gFY
Jdaiw6G0e4Cjk8+60/lIVRje7HkTfmwBf51lvQB5j9gd9eqHNFucy2TFfimX3rnppPveELrJ/Jrq
CMPwm3j0Mke59vQHDmsg1JZpf/YJB1z1pXrjFU88HDNeXs4Tl7S2IlVUuBF+NCpOm5SnYQ/pPhiB
KXAAq+omHq0iVPTRXPvxs28/6a6rf3znm/k8OvcdxfvUYZaUIBnJ2BapzoUbPw4RPzRK+ApMkCew
xQWSqal38DB4C36d3/6cPHbqNJ887AuwxWHMVv0OGd+qRjwKscVYY/cOdtSa1MBUVjZ2np86FXOe
Ae4z/G/CcKQiEJ1rgWtQ5P8HckzKfMm6LSgwQ4COuVXDo5UEqI//9KkupaD8HIkUzSccTdXAb9ye
4ndIjyiIbfTkCte8/+q5Ouvr3yyfnkBGSVBmiOhkgLHG3TrLJ51s2xN1p+gEFgZskUW3V6Xkpu2L
5RHb0MywbfyOhGBvbBmCndFmH9dyRnUKrzGClREEo3u5ZcEjONHBCjBmMrfOjdpUXL79mjWhbrYC
nLVsk7ht0hImMj5aui4r8GtuEbp8exYeht/FNi0k1uNqzx+9cEzKYlxoqGYNM8FjlYObzwkegTP8
gZuysKbnyYWKe7crVmMrbOW9/AOtqogAn32fhFtByiFdUNarBYigD+mz92Sg2szyi/XWTWkLPbX4
sgANDHCLruPRNt7efwo218MhDaTYMip8hVhJ0MEYE7GivCV2c49Mv6fjfwjgBDHBllbhq3iFsW+k
+QedL36Al3DP9jO/8whfExYZz6OZDJ8am1kO6gxwRWIGo/qMsEnk9+Crgw0SPhlcZC0NdjiSAorG
fnCC0jPgApspPJzGCPtSnqJaclgQc7dPqVNUC8pqQBxmm3ZcTk/T8+gOw0fFRf5t8xfXkFhEkAMm
yG263e5J3RAlvdliyUsonR2fnZiBag5evFZnbdjn66XFpeRrJkefnZiJqg5cunrTun6/FJlSc2QC
rmPa6YM/+gaRyNRvX5z3nrWL5wL/zUSwsU28Pj1Dc8OekaNt0/3+fUs52GyhOdqH+6NdVtLwcrTx
cD+Pv+ikfDcMmKky91meCbpMyjxI4vAkUJGpOZG8VDBCErZYBUo8kbxUWIntkUndc/tWR6fBffw4
V7eJdi71T2UuAGic09JPBIX1JB0C6Oic2AMyEZydCUqwGkwE7LLJ/AskBdOYdpzMsYX/wwWkzict
bm3VSs0MP9R6GPs7uXBwJ1ucuSs7id22UYNDBYZt6AuYvJrRxcutzBbyy1rwKHMno5/pZDyPRNOx
Y5fEZGyVFMqV9PGE43uPolvZ354ts05L3c1rOxk+XB/m6j9/9hbJbi5Bnqm5R2L4tjmGJSZwNClP
lnH8d7PhdVDWlBsRzMKpugeas/kHzjQWLuVRXi3FB5ZipY1T4GSEnSD14CTNiuXByx0WXCFzBC+O
uQMPDQpBUArwEYddgdNdz9hvLrbI2J1rPFO7EASDykByYmOPbT50rWRUBeGtC6SesawSIIXEpor0
J9Zc8QPaVFl5IVMiua18bGiIZl47aSEcwbCFv/WdMmHWztJqBJdJ5QbwHbNlA0niDjJpPlaT6Qp+
YgL1rjRqXsMdVFBE9Io461g6blf+kQgtfg06qAlktqXwgminy9RZpvdlsrkwTw3D6G4wUMk5e47K
GmbPZ8kbUQ82UL00zJANjsNARW2MCZIH164jUTmIrcIK6KWm0STnveTsc/ksLuZITpSWzR0PILla
IrOCIktcpSRb3WKOTw5NCkdPsSsFpFvdIRVmQByFlTRZvaiosMjtsv3I9KhUZA+TpAOYgeOwO06V
/vAUXKmkFGn1Ui0ljNlnoVPoxThlIp7L8fnrv71Zlm84jiBCbCfDlty/hYrcGLXWbPFkRA7CLBgp
rKDhr892b5pP/Xnrp0GrrNcHZfJa1Wq+GdqaFXmilzJPLXo14330p9tjeaLL+ayMzBxEwNdRpc8c
Z0IE8/WXenlR0umCNyCcjGvJpnpfzIBARQm8pSwRM7ga+joEUvaEhHzFg+T7YvhKCQvEg1wHXUAO
PGi8EgcOPKiOkSC5G7pMLkYyOGCtwAriFDWhTVyeRpjjxewQyOxoGjQ7tpPZ8cy9U3SHtQwrxMFc
mVJVOLAfDHG6iKCpldHY0diHOK2hK+WHwftNFbDyitM0xIojDLXiYAQ2XAt9sZHS05ecqRbaAVjK
5iea5hqwS873C5uil4RN6C8TNkVDCZsI0ZNgYM/KKNiin8fRj6LkJRRhvwxFyVAoHhAU39NziF8i
76Pxyn+XgYNfiOhntMw3gdcNtlhWG9q28fDmNsQ26Vwofm/83uNZESFbtkRtCtYl8Wg+w2dHf1VS
klVWsP7wikSUfIqC1xMr63nNUAJKUj39Gko7oHDIbV+lyMEzIINrojvNtxvkhKRWdsP2vho/KcQP
yaXJnMvewbl87vVuF3F5rPFuY4yJ/eGVeGV73eAc19jlTGNnG/nz/xbHaeR+A1XyXDqN7rLUN+4S
YhrZHnAVH/8ECdtWNyClYJTMFzDGrDQhupMQhrda4gFJbaYNUptNhDGEwYyBo9OYIY4HCCWaUf0r
vB08y2sqwPVhuM6y7THbcwq+4Cpp7JALVlgJ71tXFKXz2q2tFL8ibDEeMfVmz3oE0XRqOYWz6d3Z
/D//kTUSTtKpFRQ+QT/++s4NGGF9JvfvvJYVDj2g2B5+acpC7ITfIPuT3Uo0z/syvTs4fp1+28hF
JPApYkIK+KfQxl+ZRhv2JFlYiBfHihe5/wowAE8oARUNZW5kc3RyZWFtDWVuZG9iag00MDYgMCBv
YmoNPDwvQXNjZW50IDg5Mi9DYXBIZWlnaHQgNzAwL0NoYXJTZXQoL2ZfZi9maS9zcGFjZS9jb21t
YS9oeXBoZW4vemVyby9vbmUvdHdvL3NpeC9zZXZlbi9laWdodC9uaW5lL2NvbG9uL0EvQi9DL0Uv
Ri9HL0kvSi9ML00vTi9PL1AvUi9TL1QvVS9WL2EvYi9jL2QvZS9mL2cvaC9pL2ovay9sL20vbi9v
L3AvcS9yL3MvdC91L3Yvdy94L3kvei9FdXJvL3F1b3RlcmlnaHQvcXVvdGVkYmxsZWZ0L3F1b3Rl
ZGJscmlnaHQvQWNpcmN1bWZsZXgvYWdyYXZlL2FjaXJjdW1mbGV4L2NjZWRpbGxhL2VncmF2ZS9l
YWN1dGUvZWNpXA1yY3VtZmxleC9lZGllcmVzaXMvaWRpZXJlc2lzKS9EZXNjZW50IC0yMTAvRmxh
Z3MgMzIvRm9udEJCb3hbLTEyMSAtMjEwIDEwODggODkyXS9Gb250RmFtaWx5KE11c2VvIFNhbnMg
NTAwKS9Gb250RmlsZTMgNDA1IDAgUi9Gb250TmFtZS9MUkJGUlErTXVzZW9TYW5zLTUwMC9Gb250
U3RyZXRjaC9Ob3JtYWwvRm9udFdlaWdodCA0MDAvSXRhbGljQW5nbGUgMC9TdGVtViA5Ni9UeXBl
L0ZvbnREZXNjcmlwdG9yL1hIZWlnaHQgNTA2Pj4NZW5kb2JqDTQwNyAwIG9iag08PC9GaWx0ZXIv
RmxhdGVEZWNvZGUvTGVuZ3RoIDU1Mj4+c3RyZWFtDQpIiVyUzY6jMBCE7zyFjzOHEX9290RCkTLE
I+WwP9rMPgABJ4u0IYiQQ95+XVQ0I20kQhns8lcNTVrvtruhn036c7q0+zCbYz90U7heblMbzCGc
+iHJC9P17fwYLf/tuRmTNC7e369zOO+G4yWpKpP+ijev83Q3T5vucgjPSfpj6sLUDyfz9LveP5t0
fxvHv+EchtlkZr02XThGo2/N+L05B5Muy152Xbzfz/eXuOZrxsd9DKZYxjlh2ksXrmPThqkZTiGp
svhbm+o9/tZJGLr/7mvGZYdj+6eZkir3cXKWieBYx/H713gVx0W2jOMp6pq6ht5Sb6MuOafEnDKn
zqEL6gJaqLFHqdQK/Ur9Cr2ixr7lhnoTtaWnhaelp4WnLalLaEftoLmXxV6We1nsZelv4W/pbxd/
5rLIZZnLIpdlbeIpatYlnpLKMa9DXkceBx5HHgceZ6ktNNkc2BzZHNiEuQS5hD4CH6GPwEfoI/AR
+gh8RB7PCZoZBRmF9RTUU5h3eY7CvIK88kb9Bs3sguzC7ILs8ngvkF0e7wSyK7Mrsiv5FfxKfgW/
kl/Br+RX8Cv5FfxKfgW/kl/Br+RX8Cv5FfxKfgX/KxiKbAPmVbHoHHNWJfVy3VIjS022Gmye/B78
ntf9cp0MHgyeDB4Mngwe/p4MHgyeNfSooWd9PBvu0VlovfiFMJ993d6mKbb08hlZehld3A/h80sz
XkYTV+FI/gkwAELgFHoNZW5kc3RyZWFtDWVuZG9iag00MDggMCBvYmoNPDwvQzBbMC4yNSAwLjk5
OTUgMS4wIDAuMTQ1Nl0vQzFbMC4yNSAwLjk5OTUgMS4wIDAuMTQ1Nl0vRG9tYWluWzAuMCAxLjBd
L0Z1bmN0aW9uVHlwZSAyL04gMS4yMTk2OD4+DWVuZG9iag00MDkgMCBvYmoNPDwvQzBbMC4yNSAw
Ljk5OTUgMS4wIDAuMTQ1Nl0vQzFbMC4xMyAwLjk4IDAuOSAwLjBdL0RvbWFpblswLjAgMS4wXS9G
dW5jdGlvblR5cGUgMi9OIDEuMjE5Njg+Pg1lbmRvYmoNNDEwIDAgb2JqDTw8L0MwWzAuMTMgMC45
OCAwLjkgMC4wXS9DMVswLjEzIDAuOTggMC45IDAuMF0vRG9tYWluWzAuMCAxLjBdL0Z1bmN0aW9u
VHlwZSAyL04gMTMuNTEzND4+DWVuZG9iag00MTEgMCBvYmoNPDwvQm91bmRzWzAuMjAzMjk3IDAu
ODUxNjQ4XS9Eb21haW5bMC4wIDEuMF0vRW5jb2RlWzAuMCAxLjAgMC4wIDEuMCAxLjAgMC4wXS9G
dW5jdGlvblR5cGUgMy9GdW5jdGlvbnNbNDA4IDAgUiA0MDkgMCBSIDQxMCAwIFJdPj4NZW5kb2Jq
DTQxMiAwIG9iag08PC9BbnRpQWxpYXMgZmFsc2UvQ29sb3JTcGFjZS9EZXZpY2VDTVlLL0Nvb3Jk
c1swLjAgMC4wIDEuMCAwLjBdL0RvbWFpblswLjAgMS4wXS9FeHRlbmRbdHJ1ZSB0cnVlXS9GdW5j
dGlvbiA0MTEgMCBSL1NoYWRpbmdUeXBlIDI+Pg1lbmRvYmoNNDEzIDAgb2JqDTw8L0JpdHNQZXJT
YW1wbGUgOC9EZWNvZGVbMC4wIDEuMF0vRG9tYWluWzAuMCAxLjBdL0VuY29kZVswLjAgMTc4LjBd
L0ZpbHRlci9GbGF0ZURlY29kZS9GdW5jdGlvblR5cGUgMC9MZW5ndGggMTQzL09yZGVyIDEvUmFu
Z2VbMC4wIDEuMF0vU2l6ZVsxNzldPj5zdHJlYW0NCkiJYmDAChiRARMUMEMACwiwggAbOzs7BxBw
cnFxcXNz8/Dy8vLx8fHzCwgICAoKCgkJCwuLiIiKiYtLSEhISkpJSUvLyMnJyysqKikpq6ioqqpr
aGhqaWnr6Ojq6ekbGBoamZiamplbWFhaWdvY2trZOzg6OTu7uLq5e3h6efv4+vkHBAQGBQMEGADk
nRH0DWVuZHN0cmVhbQ1lbmRvYmoNNDE0IDAgb2JqDTw8L0JpdHNQZXJTYW1wbGUgOC9EZWNvZGVb
MC4wIDEuMF0vRG9tYWluWzAuMCAxLjBdL0VuY29kZVswLjAgMTc4LjBdL0ZpbHRlci9GbGF0ZURl
Y29kZS9GdW5jdGlvblR5cGUgMC9MZW5ndGggMTM1L09yZGVyIDEvUmFuZ2VbMC4wIDEuMF0vU2l6
ZVsxNzldPj5zdHJlYW0NCkiJhMXrEkJAAEBhlfaCtYtYbKKUoijdpOT9H8s243/fnJmjKP9NRtNx
P+pMUqW5BAEACEKMEMIYa5qu64bMIISYJqWMMsYsy7YdZ+G6nse5z/0gCEMhxDKKVnEcJ8l6k6bb
XZbtD3leFMdTWVbV+VLX9fV2fzyb5tW270/Xfft+EGAA9YAMwA1lbmRzdHJlYW0NZW5kb2JqDTQx
NSAwIG9iag08PC9CaXRzUGVyU2FtcGxlIDgvRGVjb2RlWzAuMCAxLjBdL0RvbWFpblswLjAgMS4w
XS9FbmNvZGVbMC4wIDE3OC4wXS9GaWx0ZXIvRmxhdGVEZWNvZGUvRnVuY3Rpb25UeXBlIDAvTGVu
Z3RoIDEzMS9PcmRlciAxL1JhbmdlWzAuMCAxLjBdL1NpemVbMTc5XT4+c3RyZWFtDQpIiWzB2xKB
QAAA0Jlcl81eqy1aarVEGNcikf//KavxYsY5lvVX60f7q9PoNnofAID+wBgaEELbtkcGQhgjQjAl
lFLGOHM4dx3PFZ4Qvh8E43AiQymnMyOKY6XUPEm01otlmq7WWbbZ7oz9wTiezpe8yIvrrSzvVfV4
1vXrLcAA0rUPWg1lbmRzdHJlYW0NZW5kb2JqDTQxNiAwIG9iag08PC9CaXRzUGVyU2FtcGxlIDgv
RGVjb2RlWzAuMCAxLjBdL0RvbWFpblswLjAgMS4wXS9FbmNvZGVbMC4wIDE3OC4wXS9GaWx0ZXIv
RmxhdGVEZWNvZGUvRnVuY3Rpb25UeXBlIDAvTGVuZ3RoIDQ0L09yZGVyIDEvUmFuZ2VbMC4wIDEu
MF0vU2l6ZVsxNzldPj5zdHJlYW0NCkiJYmAYFIARDpiggJmZmQUIWFlZ2djY2Nk5ODg4OTm5uLi4
uQECDAALcADKDWVuZHN0cmVhbQ1lbmRvYmoNNDE3IDAgb2JqDTw8L0FudGlBbGlhcyB0cnVlL0Nv
bG9yU3BhY2UvRGV2aWNlQ01ZSy9Db29yZHNbMC4wIDAuMCAxLjAgMC4wXS9Eb21haW5bMC4wIDEu
MF0vRXh0ZW5kW3RydWUgdHJ1ZV0vRnVuY3Rpb25bNDEzIDAgUiA0MTQgMCBSIDQxNSAwIFIgNDE2
IDAgUl0vU2hhZGluZ1R5cGUgMj4+DWVuZG9iag00MTggMCBvYmoNPDwvQzBbMC4zMSAwLjQgMS4w
IDAuMDZdL0MxWzAuMzEgMC40IDEuMCAwLjA2XS9Eb21haW5bMC4wIDEuMF0vRnVuY3Rpb25UeXBl
IDIvTiAxLjA+Pg1lbmRvYmoNNDE5IDAgb2JqDTw8L0MwWzAuMzEgMC40IDEuMCAwLjA2XS9DMVsw
LjI4IDAuMzggMC45OSAwLjA0XS9Eb21haW5bMC4wIDEuMF0vRnVuY3Rpb25UeXBlIDIvTiAxLjA+
Pg1lbmRvYmoNNDIwIDAgb2JqDTw8L0MwWzAuMjggMC4zOCAwLjk5IDAuMDRdL0MxWzAuMjIgMC4z
NCAwLjk1IDAuMDJdL0RvbWFpblswLjAgMS4wXS9GdW5jdGlvblR5cGUgMi9OIDEuMD4+DWVuZG9i
ag00MjEgMCBvYmoNPDwvQzBbMC4yMiAwLjM0IDAuOTUgMC4wMl0vQzFbMC4xMSAwLjI2IDAuODkg
MC4wXS9Eb21haW5bMC4wIDEuMF0vRnVuY3Rpb25UeXBlIDIvTiAxLjA+Pg1lbmRvYmoNNDIyIDAg
b2JqDTw8L0MwWzAuMTEgMC4yNiAwLjg5IDAuMF0vQzFbMC4wNiAwLjIxIDAuODggMC4wXS9Eb21h
aW5bMC4wIDEuMF0vRnVuY3Rpb25UeXBlIDIvTiAxLjA+Pg1lbmRvYmoNNDIzIDAgb2JqDTw8L0Mw
WzAuMDYgMC4yMSAwLjg4IDAuMF0vQzFbMC4wOSAwLjIzIDAuODkgMC4wXS9Eb21haW5bMC4wIDEu
MF0vRnVuY3Rpb25UeXBlIDIvTiAxLjA+Pg1lbmRvYmoNNDI0IDAgb2JqDTw8L0MwWzAuMDkgMC4y
MyAwLjg5IDAuMF0vQzFbMC4yIDAuMzIgMC45NCAwLjAxXS9Eb21haW5bMC4wIDEuMF0vRnVuY3Rp
b25UeXBlIDIvTiAxLjA+Pg1lbmRvYmoNNDI1IDAgb2JqDTw8L0MwWzAuMiAwLjMyIDAuOTQgMC4w
MV0vQzFbMC4yOCAwLjM4IDAuOTkgMC4wNF0vRG9tYWluWzAuMCAxLjBdL0Z1bmN0aW9uVHlwZSAy
L04gMS4wPj4NZW5kb2JqDTQyNiAwIG9iag08PC9DMFswLjI4IDAuMzggMC45OSAwLjA0XS9DMVsw
LjI4IDAuMzggMC45OSAwLjA0XS9Eb21haW5bMC4wIDEuMF0vRnVuY3Rpb25UeXBlIDIvTiAxMy41
MTM0Pj4NZW5kb2JqDTQyNyAwIG9iag08PC9Cb3VuZHNbMC4wNjU5MzQxIDAuMTU5MzQxIDAuMjYz
NzM2IDAuMzU3MTQzIDAuNDI4NTcxIDAuNTcxNDI5IDAuNjI2Mzc0IDAuOTI4NTcxXS9Eb21haW5b
MC4wIDEuMF0vRW5jb2RlWzAuMCAxLjAgMC4wIDEuMCAwLjAgMS4wIDAuMCAxLjAgMC4wIDEuMCAw
LjAgMS4wIDAuMCAxLjAgMC4wIDEuMCAxLjAgMC4wXS9GdW5jdGlvblR5cGUgMy9GdW5jdGlvbnNb
NDE4IDAgUiA0MTkgMCBSIDQyMCAwIFIgNDIxIDAgUiA0MjIgMCBSIDQyMyAwIFIgNDI0IDAgUiA0
MjUgMCBSIDQyNiAwIFJdPj4NZW5kb2JqDTQyOCAwIG9iag08PC9BbnRpQWxpYXMgZmFsc2UvQ29s
b3JTcGFjZS9EZXZpY2VDTVlLL0Nvb3Jkc1swLjAgMC4wIDEuMCAwLjBdL0RvbWFpblswLjAgMS4w
XS9FeHRlbmRbdHJ1ZSB0cnVlXS9GdW5jdGlvbiA0MjcgMCBSL1NoYWRpbmdUeXBlIDI+Pg1lbmRv
YmoNNDI5IDAgb2JqDTw8L0NTL0RldmljZUNNWUsvSSBmYWxzZS9LIGZhbHNlL1MvVHJhbnNwYXJl
bmN5L1R5cGUvR3JvdXA+Pg1lbmRvYmoNNDMwIDAgb2JqDTw8L0xlbmd0aCAzNTY1MS9TdWJ0eXBl
L1hNTC9UeXBlL01ldGFkYXRhPj5zdHJlYW0NCjw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVN
ME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+Cjx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0
YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuNi1jMTQ4IDc5LjE2NDAzNiwgMjAxOS8wOC8x
My0wMTowNjo1NyAgICAgICAgIj4KICAgPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3Lncz
Lm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4KICAgICAgPHJkZjpEZXNjcmlwdGlvbiBy
ZGY6YWJvdXQ9IiIKICAgICAgICAgICAgeG1sbnM6ZGM9Imh0dHA6Ly9wdXJsLm9yZy9kYy9lbGVt
ZW50cy8xLjEvIgogICAgICAgICAgICB4bWxuczp4bXA9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFw
LzEuMC8iCiAgICAgICAgICAgIHhtbG5zOnhtcE1NPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8x
LjAvbW0vIgogICAgICAgICAgICB4bWxuczpzdFJlZj0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAv
MS4wL3NUeXBlL1Jlc291cmNlUmVmIyIKICAgICAgICAgICAgeG1sbnM6c3RFdnQ9Imh0dHA6Ly9u
cy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZUV2ZW50IyIKICAgICAgICAgICAgeG1s
bnM6aWxsdXN0cmF0b3I9Imh0dHA6Ly9ucy5hZG9iZS5jb20vaWxsdXN0cmF0b3IvMS4wLyIKICAg
ICAgICAgICAgeG1sbnM6eG1wVFBnPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvdC9wZy8i
CiAgICAgICAgICAgIHhtbG5zOnN0RGltPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvc1R5
cGUvRGltZW5zaW9ucyMiCiAgICAgICAgICAgIHhtbG5zOnhtcEc9Imh0dHA6Ly9ucy5hZG9iZS5j
b20veGFwLzEuMC9nLyIKICAgICAgICAgICAgeG1sbnM6cGRmPSJodHRwOi8vbnMuYWRvYmUuY29t
L3BkZi8xLjMvIj4KICAgICAgICAgPGRjOmZvcm1hdD5hcHBsaWNhdGlvbi9wZGY8L2RjOmZvcm1h
dD4KICAgICAgICAgPGRjOnRpdGxlPgogICAgICAgICAgICA8cmRmOkFsdD4KICAgICAgICAgICAg
ICAgPHJkZjpsaSB4bWw6bGFuZz0ieC1kZWZhdWx0Ij5URVRFIEFORSBiaWNocm8gZ3JpczwvcmRm
OmxpPgogICAgICAgICAgICA8L3JkZjpBbHQ+CiAgICAgICAgIDwvZGM6dGl0bGU+CiAgICAgICAg
IDx4bXA6TWV0YWRhdGFEYXRlPjIwMTgtMDctMDRUMTI6MTA6MDErMDI6MDA8L3htcDpNZXRhZGF0
YURhdGU+CiAgICAgICAgIDx4bXA6TW9kaWZ5RGF0ZT4yMDE4LTA3LTA0VDEyOjEwOjAxKzAyOjAw
PC94bXA6TW9kaWZ5RGF0ZT4KICAgICAgICAgPHhtcDpDcmVhdGVEYXRlPjIwMTgtMDctMDRUMTI6
MTA6MDErMDI6MDA8L3htcDpDcmVhdGVEYXRlPgogICAgICAgICA8eG1wOkNyZWF0b3JUb29sPkFk
b2JlIElsbHVzdHJhdG9yIENDIDIyLjAgKE1hY2ludG9zaCk8L3htcDpDcmVhdG9yVG9vbD4KICAg
ICAgICAgPHhtcE1NOkluc3RhbmNlSUQ+dXVpZDowNTA2YmM3My1hYjlhLTJiNGItODFhNi0zNWEx
MTQ1ODI3NjY8L3htcE1NOkluc3RhbmNlSUQ+CiAgICAgICAgIDx4bXBNTTpEb2N1bWVudElEPnht
cC5kaWQ6NWY3NGEwYzktMDMxMy00NWI5LThmMDItYzJlMzM3MmRlYWYwPC94bXBNTTpEb2N1bWVu
dElEPgogICAgICAgICA8eG1wTU06T3JpZ2luYWxEb2N1bWVudElEPnV1aWQ6NUQyMDg5MjQ5M0JG
REIxMTkxNEE4NTkwRDMxNTA4Qzg8L3htcE1NOk9yaWdpbmFsRG9jdW1lbnRJRD4KICAgICAgICAg
PHhtcE1NOlJlbmRpdGlvbkNsYXNzPnByb29mOnBkZjwveG1wTU06UmVuZGl0aW9uQ2xhc3M+CiAg
ICAgICAgIDx4bXBNTTpEZXJpdmVkRnJvbSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAg
ICAgICAgIDxzdFJlZjppbnN0YW5jZUlEPnV1aWQ6Y2EzOTMwN2EtNmZkMy0xMzRkLTlmZmYtYjBi
YjFjMWNkMzJkPC9zdFJlZjppbnN0YW5jZUlEPgogICAgICAgICAgICA8c3RSZWY6ZG9jdW1lbnRJ
RD54bXAuZGlkOjNlMDllNGU2LWMwNjAtNDhkZS05M2I0LWRhNjMwNzc5ZGJmOTwvc3RSZWY6ZG9j
dW1lbnRJRD4KICAgICAgICAgICAgPHN0UmVmOm9yaWdpbmFsRG9jdW1lbnRJRD51dWlkOjVEMjA4
OTI0OTNCRkRCMTE5MTRBODU5MEQzMTUwOEM4PC9zdFJlZjpvcmlnaW5hbERvY3VtZW50SUQ+CiAg
ICAgICAgICAgIDxzdFJlZjpyZW5kaXRpb25DbGFzcz5wcm9vZjpwZGY8L3N0UmVmOnJlbmRpdGlv
bkNsYXNzPgogICAgICAgICA8L3htcE1NOkRlcml2ZWRGcm9tPgogICAgICAgICA8eG1wTU06SGlz
dG9yeT4KICAgICAgICAgICAgPHJkZjpTZXE+CiAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBh
cnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICA8c3RFdnQ6YWN0aW9uPnNhdmVk
PC9zdEV2dDphY3Rpb24+CiAgICAgICAgICAgICAgICAgIDxzdEV2dDppbnN0YW5jZUlEPnhtcC5p
aWQ6Nzg2ZjliM2YtYjQzZC00YWVjLTk3OTUtNzExODA1NmYzYmI2PC9zdEV2dDppbnN0YW5jZUlE
PgogICAgICAgICAgICAgICAgICA8c3RFdnQ6d2hlbj4yMDE4LTA0LTA1VDE1OjQ4OjE4KzAyOjAw
PC9zdEV2dDp3aGVuPgogICAgICAgICAgICAgICAgICA8c3RFdnQ6c29mdHdhcmVBZ2VudD5BZG9i
ZSBJbGx1c3RyYXRvciBDQyAyMi4wIChNYWNpbnRvc2gpPC9zdEV2dDpzb2Z0d2FyZUFnZW50Pgog
ICAgICAgICAgICAgICAgICA8c3RFdnQ6Y2hhbmdlZD4vPC9zdEV2dDpjaGFuZ2VkPgogICAgICAg
ICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJS
ZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgIDxzdEV2dDphY3Rpb24+c2F2ZWQ8L3N0RXZ0OmFj
dGlvbj4KICAgICAgICAgICAgICAgICAgPHN0RXZ0Omluc3RhbmNlSUQ+eG1wLmlpZDo1Zjc0YTBj
OS0wMzEzLTQ1YjktOGYwMi1jMmUzMzcyZGVhZjA8L3N0RXZ0Omluc3RhbmNlSUQ+CiAgICAgICAg
ICAgICAgICAgIDxzdEV2dDp3aGVuPjIwMTgtMDctMDRUMTI6MTArMDI6MDA8L3N0RXZ0OndoZW4+
CiAgICAgICAgICAgICAgICAgIDxzdEV2dDpzb2Z0d2FyZUFnZW50PkFkb2JlIElsbHVzdHJhdG9y
IENDIDIyLjAgKE1hY2ludG9zaCk8L3N0RXZ0OnNvZnR3YXJlQWdlbnQ+CiAgICAgICAgICAgICAg
ICAgIDxzdEV2dDpjaGFuZ2VkPi88L3N0RXZ0OmNoYW5nZWQ+CiAgICAgICAgICAgICAgIDwvcmRm
OmxpPgogICAgICAgICAgICA8L3JkZjpTZXE+CiAgICAgICAgIDwveG1wTU06SGlzdG9yeT4KICAg
ICAgICAgPGlsbHVzdHJhdG9yOlR5cGU+RG9jdW1lbnQ8L2lsbHVzdHJhdG9yOlR5cGU+CiAgICAg
ICAgIDxpbGx1c3RyYXRvcjpTdGFydHVwUHJvZmlsZT5QcmludDwvaWxsdXN0cmF0b3I6U3RhcnR1
cFByb2ZpbGU+CiAgICAgICAgIDx4bXBUUGc6SGFzVmlzaWJsZU92ZXJwcmludD5GYWxzZTwveG1w
VFBnOkhhc1Zpc2libGVPdmVycHJpbnQ+CiAgICAgICAgIDx4bXBUUGc6SGFzVmlzaWJsZVRyYW5z
cGFyZW5jeT5GYWxzZTwveG1wVFBnOkhhc1Zpc2libGVUcmFuc3BhcmVuY3k+CiAgICAgICAgIDx4
bXBUUGc6TlBhZ2VzPjE8L3htcFRQZzpOUGFnZXM+CiAgICAgICAgIDx4bXBUUGc6TWF4UGFnZVNp
emUgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICA8c3REaW06dz4yMTAuMDAw
MDAwPC9zdERpbTp3PgogICAgICAgICAgICA8c3REaW06aD4yOTcuMDAwMDAwPC9zdERpbTpoPgog
ICAgICAgICAgICA8c3REaW06dW5pdD5NaWxsaW1ldGVyczwvc3REaW06dW5pdD4KICAgICAgICAg
PC94bXBUUGc6TWF4UGFnZVNpemU+CiAgICAgICAgIDx4bXBUUGc6UGxhdGVOYW1lcz4KICAgICAg
ICAgICAgPHJkZjpTZXE+CiAgICAgICAgICAgICAgIDxyZGY6bGk+TWFnZW50YTwvcmRmOmxpPgog
ICAgICAgICAgICAgICA8cmRmOmxpPlllbGxvdzwvcmRmOmxpPgogICAgICAgICAgICAgICA8cmRm
OmxpPkJsYWNrPC9yZGY6bGk+CiAgICAgICAgICAgIDwvcmRmOlNlcT4KICAgICAgICAgPC94bXBU
UGc6UGxhdGVOYW1lcz4KICAgICAgICAgPHhtcFRQZzpTd2F0Y2hHcm91cHM+CiAgICAgICAgICAg
IDxyZGY6U2VxPgogICAgICAgICAgICAgICA8cmRmOmxpIHJkZjpwYXJzZVR5cGU9IlJlc291cmNl
Ij4KICAgICAgICAgICAgICAgICAgPHhtcEc6Z3JvdXBOYW1lPkdyb3VwZSBkZSBudWFuY2VzIHBh
ciBkw6lmYXV0PC94bXBHOmdyb3VwTmFtZT4KICAgICAgICAgICAgICAgICAgPHhtcEc6Z3JvdXBU
eXBlPjA8L3htcEc6Z3JvdXBUeXBlPgogICAgICAgICAgICAgICAgICA8eG1wRzpDb2xvcmFudHM+
CiAgICAgICAgICAgICAgICAgICAgIDxyZGY6U2VxPgogICAgICAgICAgICAgICAgICAgICAgICA8
cmRmOmxpIHJkZjpwYXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAg
ICAgPHhtcEc6c3dhdGNoTmFtZT5CbGFuYzwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAg
ICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAg
ICAgICAgICAgICAgICAgPHhtcEc6bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAg
ICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MC4wMDAwMDA8L3htcEc6eWVsbG93
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1wRzpi
bGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAg
ICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPk5vaXI8L3htcEc6c3dhdGNoTmFtZT4KICAgICAg
ICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MC4wMDAwMDA8L3htcEc6bWFnZW50
YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjAuMDAwMDAwPC94bXBH
OnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6YmxhY2s+MTAwLjAwMDAw
MDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAg
ICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPlJvdWdlIENNSk48L3htcEc6c3dh
dGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBH
Om1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1w
Rzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94
bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MTAwLjAw
MDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxs
b3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8
L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJS
ZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+SmF1
bmUgQ01KTjwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
Rzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
OmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzp5ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAg
ICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSBy
ZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
OnN3YXRjaE5hbWU+VmVydCBDTUpOPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6Y3lhbj4xMDAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MC4wMDAwMDA8L3htcEc6bWFnZW50YT4KICAgICAg
ICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjEwMC4wMDAwMDA8L3htcEc6eWVsbG93
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1wRzpi
bGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAg
ICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkN5YW4gQ01KTjwveG1wRzpzd2F0Y2hOYW1lPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAg
ICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+MTAwLjAwMDAwMDwveG1wRzpjeWFu
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjAuMDAwMDAwPC94bXBH
Om1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAw
MDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAu
MDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAg
ICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+QmxldSBDTUpOPC94bXBH
OnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwv
eG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8
L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj4xMDAuMDAw
MDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+
MTAwLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
Rzp5ZWxsb3c+MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAg
ICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlw
ZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1l
Pk1hZ2VudGEgQ01KTjwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAg
PHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAg
ICAgPHhtcEc6bWFnZW50YT4xMDAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAg
ICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJk
ZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOnN3YXRjaE5hbWU+Qz0xNSBNPTEwMCBKPTkwIE49MTA8L3htcEc6c3dhdGNoTmFtZT4K
ICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjE1LjAwMDAwMDwveG1wRzpjeWFu
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjEwMC4wMDAwMDA8L3ht
cEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjkwLjAw
MDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNr
PjEwLjAwMDAwMDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+
CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2Ui
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MCBNPTkwIEo9
ODUgTj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
Om1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0
eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
Y3lhbj4wLjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
RzptYWdlbnRhPjkwLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzp5ZWxsb3c+ODUuMDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAg
ICAgICAgICAgICAgPHhtcEc6YmxhY2s+MC4wMDAwMDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAg
ICAgICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJk
ZjpwYXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
c3dhdGNoTmFtZT5DPTAgTT04MCBKPTk1IE49MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAg
ICAgICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAg
ICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAg
ICAgICAgICAgICAgICAgICAgPHhtcEc6bWFnZW50YT44MC4wMDAwMDA8L3htcEc6bWFnZW50YT4K
ICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93Pjk1LjAwMDAwMDwveG1wRzp5
ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94
bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAg
ICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0wIE09NTAgSj0xMDAgTj0wPC94bXBH
OnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwv
eG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8
L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj4wLjAwMDAw
MDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjUw
LjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5
ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAg
ICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBl
PSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+
Qz0wIE09MzUgSj04NSBOPTA8L3htcEc6c3dhdGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAg
ICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAg
ICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAg
ICAgICAgIDx4bXBHOm1hZ2VudGE+MzUuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz44NS4wMDAwMDA8L3htcEc6eWVsbG93PgogICAg
ICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1wRzpibGFjaz4K
ICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAgICAg
IDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9NSBNPTAgSj05MCBOPTA8L3htcEc6c3dhdGNoTmFtZT4K
ICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjUuMDAwMDAwPC94bXBHOmN5YW4+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MC4wMDAwMDA8L3htcEc6
bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjkwLjAwMDAw
MDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAu
MDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAg
ICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0yMCBNPTAgSj0xMDAg
Tj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1v
ZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBl
PlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lh
bj4yMC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzp5ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAg
ICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6
cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3
YXRjaE5hbWU+Qz01MCBNPTAgSj0xMDAgTj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAg
ICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj41MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAg
ICAgICAgICAgICAgICAgICAgPHhtcEc6bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5
ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94
bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAg
ICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz03NSBNPTAgSj0xMDAgTj0wPC94bXBH
OnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwv
eG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8
L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj43NS4wMDAw
MDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bWFnZW50YT4w
LjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5
ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAg
ICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBl
PSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+
Qz04NSBNPTEwIEo9MTAwIE49MTA8L3htcEc6c3dhdGNoTmFtZT4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAgICAgICAgICAgICAg
ICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzpjeWFuPjg1LjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzptYWdlbnRhPjEwLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjEwLjAwMDAwMDwveG1wRzpi
bGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAg
ICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9OTAgTT0zMCBKPTk1IE49MzA8L3htcEc6c3dh
dGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBH
Om1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1w
Rzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjkwLjAwMDAwMDwv
eG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjMwLjAw
MDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxs
b3c+OTUuMDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6YmxhY2s+MzAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8
L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJS
ZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz03
NSBNPTAgSj03NSBOPTA8L3htcEc6c3dhdGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAg
ICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzpjeWFuPjc1LjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzptYWdlbnRhPjAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOnllbGxvdz43NS4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1wRzpibGFjaz4KICAg
ICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAgICAgIDxy
ZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzpzd2F0Y2hOYW1lPkM9ODAgTT0xMCBKPTQ1IE49MDwveG1wRzpzd2F0Y2hOYW1lPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAg
ICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+ODAuMDAwMDAwPC94bXBHOmN5YW4+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MTAuMDAwMDAwPC94bXBH
Om1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz40NS4wMDAw
MDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4w
LjAwMDAwMDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAg
ICAgICAgICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9NzAgTT0xNSBKPTAg
Tj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1v
ZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBl
PlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lh
bj43MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
bWFnZW50YT4xNS4wMDAwMDA8L3htcEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAg
ICAgPHhtcEc6eWVsbG93PjAuMDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6YmxhY2s+MC4wMDAwMDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAgICAg
ICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJkZjpw
YXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6c3dh
dGNoTmFtZT5DPTg1IE09NTAgSj0wIE49MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAg
ICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOmN5YW4+ODUuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+NTAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxs
b3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBH
OmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAg
ICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0xMDAgTT05NSBKPTUgTj0wPC94bXBHOnN3
YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1w
Rzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3ht
cEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj4xMDAuMDAwMDAw
PC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+OTUu
MDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnll
bGxvdz41LjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8
L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJS
ZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0x
MDAgTT0xMDAgSj0yNSBOPTI1PC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAg
ICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAg
ICAgICAgPHhtcEc6Y3lhbj4xMDAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MTAwLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MjUuMDAwMDAwPC94bXBHOnllbGxvdz4K
ICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6YmxhY2s+MjUuMDAwMDAwPC94bXBHOmJs
YWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAg
ICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz03NSBNPTEwMCBKPTAgTj0wPC94bXBHOnN3YXRj
aE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzpt
b2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6
dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj43NS4wMDAwMDA8L3ht
cEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bWFnZW50YT4xMDAuMDAw
MDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxv
dz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
OmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3Jk
ZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNv
dXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz01MCBN
PTEwMCBKPTAgTj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8
eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAg
PHhtcEc6Y3lhbj41MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAg
ICAgPHhtcEc6bWFnZW50YT4xMDAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAg
ICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJk
ZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOnN3YXRjaE5hbWU+Qz0zNSBNPTEwMCBKPTM1IE49MTA8L3htcEc6c3dhdGNoTmFtZT4K
ICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjM1LjAwMDAwMDwveG1wRzpjeWFu
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjEwMC4wMDAwMDA8L3ht
cEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjM1LjAw
MDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNr
PjEwLjAwMDAwMDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+
CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2Ui
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MTAgTT0xMDAg
Sj01MCBOPTA8L3htcEc6c3dhdGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
OnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
RzpjeWFuPjEwLjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8
eG1wRzptYWdlbnRhPjEwMC4wMDAwMDA8L3htcEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6eWVsbG93PjUwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAg
ICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjps
aSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOnN3YXRjaE5hbWU+Qz0wIE09OTUgSj0yMCBOPTA8L3htcEc6c3dhdGNoTmFtZT4KICAgICAg
ICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+OTUuMDAwMDAwPC94bXBHOm1hZ2Vu
dGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4yMC4wMDAwMDA8L3ht
cEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4wLjAwMDAw
MDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAg
ICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MjUgTT0yNSBKPTQwIE49MDwv
eG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptb2RlPkNN
WUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9D
RVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+MjUu
MDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2Vu
dGE+MjUuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOnllbGxvdz40MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAg
ICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNl
VHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hO
YW1lPkM9NDAgTT00NSBKPTUwIE49NTwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOmN5YW4+NDAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+NDUuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz41MC4wMDAwMDA8L3htcEc6eWVsbG93
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz41LjAwMDAwMDwveG1wRzpi
bGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAg
ICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9NTAgTT01MCBKPTYwIE49MjU8L3htcEc6c3dh
dGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBH
Om1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1w
Rzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjUwLjAwMDAwMDwv
eG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjUwLjAw
MDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxs
b3c+NjAuMDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6YmxhY2s+MjUuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8
L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJS
ZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz01
NSBNPTYwIEo9NjUgTj00MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAg
ICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAg
ICAgIDx4bXBHOmN5YW4+NTUuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAg
ICAgICAgIDx4bXBHOm1hZ2VudGE+NjAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz42NS4wMDAwMDA8L3htcEc6eWVsbG93PgogICAg
ICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz40MC4wMDAwMDA8L3htcEc6YmxhY2s+
CiAgICAgICAgICAgICAgICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAg
ICA8cmRmOmxpIHJkZjpwYXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAg
ICAgICAgPHhtcEc6c3dhdGNoTmFtZT5DPTI1IE09NDAgSj02NSBOPTA8L3htcEc6c3dhdGNoTmFt
ZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBl
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjI1LjAwMDAwMDwveG1wRzpj
eWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjQwLjAwMDAwMDwv
eG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+NjUu
MDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Ymxh
Y2s+MC4wMDAwMDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAgICAgICAgICAgICAgIDwvcmRmOmxp
PgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJkZjpwYXJzZVR5cGU9IlJlc291cmNl
Ij4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6c3dhdGNoTmFtZT5DPTMwIE09NTAg
Sj03NSBOPTEwPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
Rzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6Y3lhbj4zMC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAg
PHhtcEc6bWFnZW50YT41MC4wMDAwMDA8L3htcEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6eWVsbG93Pjc1LjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjEwLjAwMDAwMDwveG1wRzpibGFjaz4KICAgICAg
ICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6
bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8
eG1wRzpzd2F0Y2hOYW1lPkM9MzUgTT02MCBKPTgwIE49MjU8L3htcEc6c3dhdGNoTmFtZT4KICAg
ICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAg
ICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjM1LjAwMDAwMDwveG1wRzpjeWFuPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjYwLjAwMDAwMDwveG1wRzpt
YWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+ODAuMDAwMDAw
PC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6YmxhY2s+MjUu
MDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAg
ICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz00MCBNPTY1IEo9OTAg
Tj0zNTwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpt
b2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6dHlw
ZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5
YW4+NDAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
Om1hZ2VudGE+NjUuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAg
ICAgIDx4bXBHOnllbGxvdz45MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpibGFjaz4zNS4wMDAwMDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAg
ICAgICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJk
ZjpwYXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
c3dhdGNoTmFtZT5DPTQwIE09NzAgSj0xMDAgTj01MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAg
ICAgICAgICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAg
ICAgICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+NDAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+NzAuMDAwMDAwPC94bXBHOm1hZ2Vu
dGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4xMDAuMDAwMDAwPC94
bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6YmxhY2s+NTAuMDAw
MDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAg
ICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz01MCBNPTcwIEo9ODAgTj03
MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptb2Rl
PkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5Q
Uk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+
NTAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1h
Z2VudGE+NzAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOnllbGxvdz44MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzpibGFjaz43MC4wMDAwMDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAgICAg
ICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICA8L3JkZjpTZXE+CiAgICAg
ICAgICAgICAgICAgIDwveG1wRzpDb2xvcmFudHM+CiAgICAgICAgICAgICAgIDwvcmRmOmxpPgog
ICAgICAgICAgICAgICA8cmRmOmxpIHJkZjpwYXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAg
ICAgICAgICAgPHhtcEc6Z3JvdXBOYW1lPkdyaXM8L3htcEc6Z3JvdXBOYW1lPgogICAgICAgICAg
ICAgICAgICA8eG1wRzpncm91cFR5cGU+MTwveG1wRzpncm91cFR5cGU+CiAgICAgICAgICAgICAg
ICAgIDx4bXBHOkNvbG9yYW50cz4KICAgICAgICAgICAgICAgICAgICAgPHJkZjpTZXE+CiAgICAg
ICAgICAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAg
ICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MCBNPTAgSj0wIE49MTAw
PC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+
Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBS
T0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj4w
LjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdl
bnRhPjAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAg
ICAgIDx4bXBHOmJsYWNrPjEwMC4wMDAwMDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAgICAgICAg
ICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJkZjpwYXJz
ZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6c3dhdGNo
TmFtZT5DPTAgTT0wIEo9MCBOPTkwPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAg
ICAgICAgICAgPHhtcEc6Y3lhbj4wLjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzptYWdlbnRhPjAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjg5Ljk5OTQwMDwveG1wRzpibGFj
az4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAg
ICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MCBNPTAgSj0wIE49ODA8L3htcEc6c3dhdGNoTmFt
ZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBl
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBHOmN5
YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MC4wMDAwMDA8L3ht
cEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjAuMDAw
MDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6YmxhY2s+
NzkuOTk4ODAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4K
ICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0wIE09MCBKPTAg
Tj03MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpt
b2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6dHlw
ZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmN5
YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzp5ZWxsb3c+MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzpibGFjaz42OS45OTk3MDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAgICAg
ICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJkZjpw
YXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6c3dh
dGNoTmFtZT5DPTAgTT0wIEo9MCBOPTYwPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAg
ICAgICAgICAgICAgPHhtcEc6Y3lhbj4wLjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjU5Ljk5OTEwMDwveG1wRzpi
bGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAg
ICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MCBNPTAgSj0wIE49NTA8L3htcEc6c3dhdGNo
TmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1v
ZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0
eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBH
OmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MC4wMDAwMDA8
L3htcEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93PjAu
MDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Ymxh
Y2s+NTAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjps
aT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJj
ZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0wIE09MCBK
PTAgTj00MDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
Rzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBH
OmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzp5ZWxsb3c+MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAg
ICAgICAgICAgICA8eG1wRzpibGFjaz4zOS45OTk0MDA8L3htcEc6YmxhY2s+CiAgICAgICAgICAg
ICAgICAgICAgICAgIDwvcmRmOmxpPgogICAgICAgICAgICAgICAgICAgICAgICA8cmRmOmxpIHJk
ZjpwYXJzZVR5cGU9IlJlc291cmNlIj4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
c3dhdGNoTmFtZT5DPTAgTT0wIEo9MCBOPTMwPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAg
ICAgICAgICAgICAgICAgPHhtcEc6Y3lhbj4wLjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAg
ICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxs
b3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjI5Ljk5ODgwMDwveG1w
RzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAg
ICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9MCBNPTAgSj0wIE49MjA8L3htcEc6c3dh
dGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBH
Om1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1w
Rzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94
bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MC4wMDAw
MDA8L3htcEc6bWFnZW50YT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6eWVsbG93
PjAuMDAwMDAwPC94bXBHOnllbGxvdz4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6
YmxhY2s+MTkuOTk5NzAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3Jk
ZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNv
dXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0wIE09
MCBKPTAgTj0xMDwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8
eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHht
cEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4
bXBHOmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAgICAgICAgICAgICAgICAgICAg
PHhtcEc6bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAg
ICAgICAgICA8eG1wRzp5ZWxsb3c+MC4wMDAwMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzpibGFjaz45Ljk5OTEwMDwveG1wRzpibGFjaz4KICAgICAgICAg
ICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6bGkg
cmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1w
Rzpzd2F0Y2hOYW1lPkM9MCBNPTAgSj0wIE49NTwveG1wRzpzd2F0Y2hOYW1lPgogICAgICAgICAg
ICAgICAgICAgICAgICAgICA8eG1wRzptb2RlPkNNWUs8L3htcEc6bW9kZT4KICAgICAgICAgICAg
ICAgICAgICAgICAgICAgPHhtcEc6dHlwZT5QUk9DRVNTPC94bXBHOnR5cGU+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOmN5YW4+MC4wMDAwMDA8L3htcEc6Y3lhbj4KICAgICAgICAg
ICAgICAgICAgICAgICAgICAgPHhtcEc6bWFnZW50YT4wLjAwMDAwMDwveG1wRzptYWdlbnRhPgog
ICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MC4wMDAwMDA8L3htcEc6eWVs
bG93PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz40Ljk5ODgwMDwveG1w
RzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAg
ICAgICAgIDwvcmRmOlNlcT4KICAgICAgICAgICAgICAgICAgPC94bXBHOkNvbG9yYW50cz4KICAg
ICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlw
ZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICA8eG1wRzpncm91cE5hbWU+Q291bGV1cnMg
dml2ZXM8L3htcEc6Z3JvdXBOYW1lPgogICAgICAgICAgICAgICAgICA8eG1wRzpncm91cFR5cGU+
MTwveG1wRzpncm91cFR5cGU+CiAgICAgICAgICAgICAgICAgIDx4bXBHOkNvbG9yYW50cz4KICAg
ICAgICAgICAgICAgICAgICAgPHJkZjpTZXE+CiAgICAgICAgICAgICAgICAgICAgICAgIDxyZGY6
bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8
eG1wRzpzd2F0Y2hOYW1lPkM9MCBNPTEwMCBKPTEwMCBOPTA8L3htcEc6c3dhdGNoTmFtZT4KICAg
ICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAg
ICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAg
ICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBHOmN5YW4+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MTAwLjAwMDAwMDwveG1wRzpt
YWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MTAwLjAwMDAw
MDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAu
MDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAg
ICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz0wIE09NzUgSj0xMDAg
Tj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOm1v
ZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp0eXBl
PlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6Y3lh
bj4wLjAwMDAwMDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpt
YWdlbnRhPjc1LjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAg
ICA8eG1wRzp5ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAg
ICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6
cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3
YXRjaE5hbWU+Qz0wIE09MTAgSj05NSBOPTA8L3htcEc6c3dhdGNoTmFtZT4KICAgICAgICAgICAg
ICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+CiAgICAgICAgICAgICAg
ICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBlPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzpjeWFuPjAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAg
ICAgICAgICAgICAgICAgIDx4bXBHOm1hZ2VudGE+MTAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz45NS4wMDAwMDA8L3htcEc6eWVs
bG93PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFjaz4wLjAwMDAwMDwveG1w
RzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgICAg
ICAgICAgICAgIDxyZGY6bGkgcmRmOnBhcnNlVHlwZT0iUmVzb3VyY2UiPgogICAgICAgICAgICAg
ICAgICAgICAgICAgICA8eG1wRzpzd2F0Y2hOYW1lPkM9ODUgTT0xMCBKPTEwMCBOPTA8L3htcEc6
c3dhdGNoTmFtZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94
bXBHOm1vZGU+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwv
eG1wRzp0eXBlPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjg1LjAwMDAw
MDwveG1wRzpjeWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjEw
LjAwMDAwMDwveG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5
ZWxsb3c+MTAwLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAgICAgICAgICAgICAgICAgICAgICAgICAg
IDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNrPgogICAgICAgICAgICAgICAgICAgICAg
ICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAgICAgPHJkZjpsaSByZGY6cGFyc2VUeXBl
PSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+
Qz0xMDAgTT05MCBKPTAgTj0wPC94bXBHOnN3YXRjaE5hbWU+CiAgICAgICAgICAgICAgICAgICAg
ICAgICAgIDx4bXBHOm1vZGU+Q01ZSzwveG1wRzptb2RlPgogICAgICAgICAgICAgICAgICAgICAg
ICAgICA8eG1wRzp0eXBlPlBST0NFU1M8L3htcEc6dHlwZT4KICAgICAgICAgICAgICAgICAgICAg
ICAgICAgPHhtcEc6Y3lhbj4xMDAuMDAwMDAwPC94bXBHOmN5YW4+CiAgICAgICAgICAgICAgICAg
ICAgICAgICAgIDx4bXBHOm1hZ2VudGE+OTAuMDAwMDAwPC94bXBHOm1hZ2VudGE+CiAgICAgICAg
ICAgICAgICAgICAgICAgICAgIDx4bXBHOnllbGxvdz4wLjAwMDAwMDwveG1wRzp5ZWxsb3c+CiAg
ICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOmJsYWNrPjAuMDAwMDAwPC94bXBHOmJsYWNr
PgogICAgICAgICAgICAgICAgICAgICAgICA8L3JkZjpsaT4KICAgICAgICAgICAgICAgICAgICAg
ICAgPHJkZjpsaSByZGY6cGFyc2VUeXBlPSJSZXNvdXJjZSI+CiAgICAgICAgICAgICAgICAgICAg
ICAgICAgIDx4bXBHOnN3YXRjaE5hbWU+Qz02MCBNPTkwIEo9MCBOPTA8L3htcEc6c3dhdGNoTmFt
ZT4KICAgICAgICAgICAgICAgICAgICAgICAgICAgPHhtcEc6bW9kZT5DTVlLPC94bXBHOm1vZGU+
CiAgICAgICAgICAgICAgICAgICAgICAgICAgIDx4bXBHOnR5cGU+UFJPQ0VTUzwveG1wRzp0eXBl
PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpjeWFuPjYwLjAwMDAwMDwveG1wRzpj
eWFuPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzptYWdlbnRhPjkwLjAwMDAwMDwv
eG1wRzptYWdlbnRhPgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzp5ZWxsb3c+MC4w
MDMxMDA8L3htcEc6eWVsbG93PgogICAgICAgICAgICAgICAgICAgICAgICAgICA8eG1wRzpibGFj
az4wLjAwMzEwMDwveG1wRzpibGFjaz4KICAgICAgICAgICAgICAgICAgICAgICAgPC9yZGY6bGk+
CiAgICAgICAgICAgICAgICAgICAgIDwvcmRmOlNlcT4KICAgICAgICAgICAgICAgICAgPC94bXBH
OkNvbG9yYW50cz4KICAgICAgICAgICAgICAgPC9yZGY6bGk+CiAgICAgICAgICAgIDwvcmRmOlNl
cT4KICAgICAgICAgPC94bXBUUGc6U3dhdGNoR3JvdXBzPgogICAgICAgICA8cGRmOlByb2R1Y2Vy
PkFkb2JlIFBERiBsaWJyYXJ5IDE1LjAwPC9wZGY6UHJvZHVjZXI+CiAgICAgIDwvcmRmOkRlc2Ny
aXB0aW9uPgogICA8L3JkZjpSREY+CjwveDp4bXBtZXRhPgo8P3hwYWNrZXQgZW5kPSJyIj8+DWVu
ZHN0cmVhbQ1lbmRvYmoNNDMxIDAgb2JqDTw8L01ldGFkYXRhIDQzMCAwIFI+Pg1lbmRvYmoNNDMy
IDAgb2JqDTw8L0JCb3hbMzc2Ljg1OCA2ODYuOTg0IDgxMy4xNTkgMjk4LjkzOV0vRmlsdGVyL0Zs
YXRlRGVjb2RlL0dyb3VwIDQyOSAwIFIvTGVuZ3RoIDU4NjUvTWF0cml4WzEuMCAwLjAgMC4wIDEu
MCAwLjAgMC4wXS9SZXNvdXJjZXM8PC9FeHRHU3RhdGU8PC9HUzAgMzkyIDAgUj4+L1Byb3BlcnRp
ZXM8PC9NQzAgNDMxIDAgUj4+Pj4vU3VidHlwZS9Gb3JtPj5zdHJlYW0NCkiJZJfJbiTJEUTv9RX5
A5UT+3LVDKSTgBF00FmgRhpgugWMBBDg3+uZeRZZpNBAFyMyFl/MzS1++Pnb319++cfPP/3x+OHP
P6bjDz/9eNx+v7U6ztTqUfY+d91HzZPffNSl+X7855fb345/39Lhf+c4frv98Ke/puNf/739fmTP
5mOkddZS6tFWPntO7Xj57i3fb3f2pH3kfO69j37u0o6cztzm8XbbZ9vrWFw4jnmuvI52pqEv42ys
uJdzrHpwRp/7uK9zdb7dWbTbceeYWrsWJf0M1hZ9Tmcq67jXs5dpA99u/7z95cncPteZep9H2xnr
uPDd3MW9+xjnYms9y8g2NmfOSGfZWY7Mxen4M2X0zFt39nPseZRz4p4GuehnYoftbbvK/K0fjp1e
1JKOxfzat7xQTD7MfUS8EfGnSBfMyKyvg9jgyIfpfBhbsUq9sq/35cHk0HOt4UHF1duvn84fn87v
ZZyz4dNI5Wy9lU/nb9bnqv85nDER4OyZZSYev5C2Qcju8xwlH9/wvJ1bCayZICqDyWG7L4JAUN/H
uZEtAv9ye58qpZ8LYPKNfGpiE95djrFwdH6MX265Y9DTigKGe/444jH+uOUxA+hrBpB7nXmAob6Z
rkcek5SRwkpWhm6YRKPqUk4YA9dKAsuLmc6dlTvKPEtlyybtaX6Mny59TBXCURLXdNUDZlSC3XN/
d+0xJhwZC9fT1H2Tsr0/DnmfeIrhY4pYVu3pfBECiId+lU98KvikAAPPlUlwxqXRMihOLFrzrNgi
YLeHYTEgzdQP6bu+UQREX4OqQU/FA+OhcogcPWsTIAZ44IPG1NIALtQZo0aUrzuu0cttUYvk6Brn
xDVjqf4G1Z7lShNfzNbeMf1UJ43li6tYxCXrCceTQlvgG5ixH+eViUTEOP1VFi9ZQdwXdf4YJuPl
9TZZxx/AYUGSWfAYoh7l6JUS2Sr8cpYVhrAhgARKEl58v6lql8dd2AafO74m/Z76lKlTp/5sAkdX
ReMx5MdVbZz5acSa5RKIcd02LxNu0l6hcn4pTgEISp1Ch4Y1xipi7Y+BuIo6YGOTB2K3Z9uhKmIi
41si40vkDjlOHXbN3MlOFztiVxYRKEDwrMaThMspZnIsEDGoL7Q4QGSm8RBRME5Gga6Ah8IZmgXc
smw+8EzTIetyFbBMBQJ6XXVFJKoiQrZHeJRlCAWBS6S9VNdXp5foflXGVia7v5NRkMlle+b3IctV
wdnL7a/Icvq4JU5/DAUaF+JjQmEo6gCQzXuwPkdTroquFH5ugWu/u/r1l+4jWfeikh++YDf3OpVB
iTMUnBJN8F4pQGeMHckMw68TQgFmhQXe1kk0fXErn9e2gyyool+YT/34DlHOEgiZalOP8TvyPmYq
Ec9ekYpNHvL2i1NswMgupxaXU1u4CTFmcxvANXHP6KDw2MzTLRSukr1TJEGg1XA4nDqEtbRgKuYk
cgjBfFm0VWkGCjYrsUvEND2WpAiSLG5WVK2StAVJjJgEubszb106PVObFwy66X1sV4etFZ1zJexs
dCxI6Qqn8NBEcNVgFH6UDzKnPiK8DXc5uqiKfpoKWZE5LVffYqFRGl8wawEBOfglei8RG9VMNlOI
yUX4SknuK6phyDDlZsh9hYf0Je8h9AbfrlScKrI358+Ul4QAvIjaTOiijSm5qqqiPTHnwsesYkaj
iTSvLrpKq+lcI2q7QijXNpGcGj94a1IKOVVyLbwI5NMnUaTLM5SXsq6Z7iMJcMuBV+7L08hmuRCq
tIQj/DGLu2AEA2hvp54utcUG8n62aJDFYxqyUENId2iPaekpXpkRSrXZ5qTS+G1elRKw/CC3uqiq
7Zq8ijbNMDhhBI6q8pwtKmr3YDKJNA6Wcgj2/ZRPJWcRnBHnIDbI8J7ujgRnUztik4Y0W9ftW/CU
nTMm1nKwVjQ1J7CqVl1wI3xY0tRbSmGGdbRN380nB0uUKwRy01QA7IGgsqFHg4kVLWQLa1ZbMdVd
jwDfol1MrTyD5+1NMMmykytHqXpGoJpwTiwhHa79ZByRlNGbCy64RjNZ4nf26ArCbFNOmAAYEdya
fQ2cESBqV6swRaxAkGSN4CEt4009cM5Ujil1CFH9sOwLhChbTFjHIy68QpsU1FiiXscwX0dIa9wl
huJeQjFsG1N+8MiU5kcNuWthq0SWxiWurdbY6mBYuy5gpqF+zblOvNrOziFR96Wy83BSe7Zud6zN
PxRrta0wq9Y23mbGMmTXvEVe9HZBQ0ZJbwaSqdgSncx8aTQZ/+rCpcUxCo4a17xsrSu7K6SIEbFv
3oMpJV0F7eYLeV7yVg9UmT57vwp+ONAsGS4PI8MOl8gFHxhKn9UoqByG9e1XrkliyFEJPbOdgqXo
SdaKd70imzboA9v+QReSZELX6DM2mV8nUTPc9CJxS1iUpeu0S3BON6KZS9jWR4smN/oFravcOXeW
B2pV3JSejWnSYh7PiCtMVloQYQoNqPxE4TOTzcmUu2XBFxqRS9C2QKlqZAXEstitqsDwpYeOJvzw
WOkSMT20BlsXRr7e5PVSB2VGzk9pKg0xsvL915uiq3eV+CZtyWD16zmjjekRoU1xLQ6l6lOpBfm6
xFEKNpEUyjhWmXp1fUmfypDl0nBFsj6lFvf26OVmqOF7VUACnIhODWjQnFJ0DTHIq1csP54oV5cT
jVhJvuxghQTxiohY7EKD8leRSyUubi2CpcQ1xxVayAobpgyz/LaGU67TsIRpV4dRSEqI0GBKaiRE
jnjQHW0GhVFweQeEEgrl0kni3S210I+vdrCiKn0RAJEOloGOKfu1R5zJuKiuQUud1iS1xUvAbVvG
A7Hq/kjXVo/WGrAVAiC5uarVjdM6SRhrx9eb30wP1vba07rzI2KwSyqTqlPaJRVQY2vHG8fCaOvJ
kK+rzXPksPkVhHW+psxxfe+yFod6j7fBp2tD6onmlPQ+bYhm8gW/HFmpNeA3OYw9zkvMCDrfPCMV
59pZeu+6uK9z3Q+/3PPmFVutS+pohnoTRZj10/Lz1siyGEdK9WIocIA7N8FtQueMZEUvdkIQkJZt
RDJZGZMGa0CSKCX55gIKumLKvKz+M2Zc1ErQ4k4tJkI2s6SNEqkfiurUU+JyIM0e+liRy7xeQg1w
T7Vw5DG3JeOpqZR7KLqdo6h0bguVqXRbvdUYpxzghhbT+piyrja5EqhAlF9qNgYa91OJEFp3oJOk
m1nTVdgjyLSV4IDi/qhmR46fwiuC9XsTQVPTJXRr5H9LE2hGOZ3H/2XyzcHSOyALIc30o+eJjkEF
XcHrMg/RO8t6GoOPHXLlMbNC5yqtykhVo442NeK9lmu5KD3veOL56QdLDXmph0QQDVwbIoKo+RW7
DWleB+S4HF+sfjF91zhBr8Xv9quk+j5jKSOawWxHUsASFBivOS4ItBorXE6Mi/ifE+Z1QDx2SqvX
lVvxJrhVJDIyfN0jUEo5CPKjgu+rlEsH6S89sSxl/bIZfjAVyS3eQkWVokBGy2TGLRloVCXOvaFG
5BzbHOrFY2ugobdi8w7Vod+htntFU38fq4LntSNmsEL+jNBb74H7FNmX/3FdLrl59FgSnXsV2oAb
STL5yGX0GgzUpOFBTX6gdt/nxE25JI8kJvmR9xk3ItPWES21BuEJtXpowToknKGPWLOwgerrPEHn
NOBZMqOWup5XE3BrI5+fRwwKiGStZgqpBHjmGJPM0ilr7R+Yd1n3ikDeb1KstCcbWPJBaY9iv0oK
6ob3/sk0f2jIPjPe/3Lin3RuxKVipRqBvnxmxfZxHsugDAx1LA+0SaM1Wc9VlA0X9vsLm99fmC1i
f19f139a58+Xu+CC9eMYIwjTWuTGfVXzvVWHVbe00KoURv6y+z8/mgJxZDZ3dVh7kZk5O0Egbhri
p31gBmjFEySkkHygOQKDe+JVU1mJLZTI9HBXzGBCkJbhjrFNITBMlEXdLkJOEJQjCJNKp9UvSWWG
R2fSiG3Hc9NyTJBrzNwVwiuYfu/CWWYiXwC6hCzVSa85pFbJBmBduXeKsYv6xTfLXHDxjgjAY/sS
XNuBljTfzkjwuD9XoWF4y35QTQidWZ4ry14g1q+Sftgt4SH+zgZ+tItIOKVwtTpfuYEpZBEnXD0U
Xw05uYAZNDzpYNaTisannDWv84OQ7yJcli/Z2q/guY0pCCSxsTaICo5GHLJclAg57Px5RQguUzoW
hOOMUPpHoEB0HloBptx3wToWwJIUDG4jzG4Xy5Sw6pA1afVI8LZt2D+gIqe3mjgyRIfT+KT8y3IY
cdZwU7lM9Q/nYG/RZJLWD5jJeJ6ChBb5BpC2IiQaCnCdmsehv80PoZoZO+vjk+kDA+B/DxUQtV6S
1OTOJwAwnL7WZw9CwEuCyvC7LtY+3NSrccbOgxKKFt5LenOZ2P4ieSqw9V1DYa8Atn76ybmg9nCQ
5MOsM1NwzwcLdytbqxb7CXX8mYD3Ur2peydiSadd46qhHWUsKXj7wU+7iI/8OCqToX590uMdSqDq
e/Ir/GyRe4dQnF3M5Mz6sFvIRrPiTFInJ/f1SSWnl8PE2fMLRTCt2Z6C9Av4NWXC3ebDgCLLs8bm
n5vaLkHbGUEyBz+tl2AeNVxuN8+hWyrBYu/AxNj1ZRTjkBNQIKdQeMQvyMS+46qfkqatfG11Jjds
IXnXB4ElH97eBQmTJkrqFkgcrWGP2w6uWTpjLExoDbNOuIIlzZFAL+LYc4deEiLiyP5ZMp8ezpAf
vAruqe07i84A8q6ovSv+1+WinuWS5l8SHSjiAE6E//ZKs/MUoDt680EIYjmzGkLQt2Hx68e/fvzv
j+uDpvy4Pv7vx7/z1/WSLmzuG8yNTRf++v3DHcYkLq8Asrb+pJdTnTWcCNgxA/9T9cnIEjwI8RMc
7qRfUWuTgefNbu3BHqdABwJXKBqmMgygpe29y3s9V+KyZ0aVHZoxYnRu2Q4cNNCOigRvehGGGiDD
xbY3mRSPi2vtXPuA5RIJwZU2e5Iw/ly58Qrg5HkATNUVwxRqTAnhzsZxRwoWQx7BT3MN9ueNUaNf
jUyMJpvCJ30jCwldlR+kj2KZJOb1gYzLBEr4XKEA3VjGUv4f4XRX2AQNpwzS7k4qGWB39AJ0hkgA
87Zg5FY6eryJqPWjW/WSZMTi/mZqTWZ+BIpvYOG3a/kv1K/tnL6p4vHZqUzd40riK3QxHXbWkjft
vf3lNWvFIe5d43XTgodH9LBNbKJUIMAnFde5nlXrRZfCj10LVTNSl1+m6b/ZG9Alr5hIH/Xw2hHq
CSpGPN7hoxiqheDTtS3YcQUkgLDhcKKdAjng8PNhgEqkjI8ZPPsVZLtpfQbGOLn1wRnJT5gzuP18
rAS9LFKVwtEyOJp0C49apsgXY8uACxbaFAwxfqV6SXIP4t2pX5ayDB+yhFle4/Mh+XlYuQ8dssGV
kpY81UMVZ2kMfm3fSSyeunvPNNbJaCE0V6Dlrrrgni6XxI1QgZ2e80+r5X8Nr/gs3CRJ64zXk4uf
k6fUYBAUCBjvNB1hxux+xowo7Ryv8rAvLYBCKSkGnfAEQcvxrSw4KRgvT8p3YSo+TMLCbi+ao/68
cvyssn1UeYUxfrNciojHGLUzwX7XBGPNW22WKuDcU3TUN2TPYS+/cvaR6eFGtrm7MKmdUq1dsCcm
d7FRGrU+LGcFTalac1JoJ7sNNkIXr/2evsEnOEakAPm7rcHVSwb+1+gyJGjhjEtlaUpPUI5eC0ar
QtrqqQOqsLteR6geulh/IivJAHDQVSVlqC3ZpXLrj2lL4MoYU3buLO+o0MwpCWxNFG69TyBPtPv5
MitOjVHLL6YXtXYCkC4ecyIQrhZds5UCwM/Fvuev0B6KjAle10sORiSDUoD7al8xZdsGfL5ez/bt
pOuB1llgDljVh305knE+cHqNkdXNtUTkLpy7zX0w/OiNaouQxJgeYTBrOYvdD+uq+aHHGWDH222b
kWXiysyYhezkewYRWvZPlCemdYvzu+kaM6Ki7Jd3MN2RBxKXWEer7FScrBo+QWk74vp5VetFnoJn
O8pE6kjcaqxQbKVTWntlDezwI0g5i21b23Co8YSPO7cUo/u1rCEQ+fmK2nMeZZbf/eMvs+vux/pr
kW2/Y9qyAq+q36lo3Dp+/P1sQWt2DbZDTsCY/j4aSiQ0xlvLpkDZUrtPYjwF0m51p4m9WzIohTL9
D4l/Ms0rJdi2RWUExxkJi+ADsvUK0hfDvVxFlRS5/zsf+s592xGLsOvQXjpxXBE4qIJhaHhlvfrv
miaJlvonPz/FgiIwvl/P/lIXBaLWlQpYI2SVxpfarimBOHH456KjhtgmncfWJZoVA5LmrpPZEFHx
4eYZgbqnPONDs1ruwK43L4fTnWr6ue5IKzO8UwBrBA6oprsXEV6thbH51Der6/LFPBfxIZe/82GI
IRgrT1mOm2D6tCt5bTl9KI/398UKQjhe2q3OPAT1znISvW6oU8urZzh2affOddfOUqSpoK0USA+g
LeVOcngnjju9D6Cl57/bzvE9QunAu52UoMBuxgi322ZomAcrQAifRhc5KUHaivKmCXsRkxOheS2H
wLDY2LuTzVWsVE0Fg6QWTgnXXtm8TQjPXM1kn2oRjNo53GLECOsttPlucBnRQFC1YJHGLRWaaSnk
V7nQw2PtTvwLQsp766V75NcKiu00HOnkWQ9PJyiO1azfNsQTWmNmufrQGM5wmdjeyXvbwcEybZDK
Jj7cCcnpQYL2VIS+GF7Hu7zjzvHyZLUw3ufaCZo8ZyjDWjyRSYyipOWLEsgZlPthyGRgjOiUxDSc
5ryejBkKLAQnSFdIzux3PFFTsSttLNPunLa/XT1QVWeX4uy73Zw+BMSajPX4cShtmSRNiF0HEjFU
YKGGrjhl+SZmrukGoEOj/SWh3WHouZccij6x6hB/qog1PX7kkIsfTpvK1U6prjJJ4SHZ3WLysZfk
2kuY+2YuZ58WmilrHOGPD3NzJM/WiiYGHk6pUGxUIbVKp29J8UJPH+mNVlo0RXrcvfasWfV5fAg9
p5UtFCtAdipSVw9lu6IWNeTuYQtDQYGh4wTWKOa/zC4/5ggV7bO/fpwTPLdBvH5wEti6yo3oEbya
648b+XmGgWa2AEl+yyhdUZXnPG/Oq8tWL8vbzhxr9HHsHuEh+3UEhmtFKGTpnAeFRCiFuHLri93l
tjUB3zj3eh2x/p7SVViuJGGZ8X1ME7sU6WyvIwIWH7rK5byqEkS8yxOFy5jh0nX8OdGOwgeXz5Eu
2q9j6jI2X/h5WsirTcctsZ3KGpbh/fGX5b9+0KukSs8iEClPhQhklMqgAmYdHQ5bieGtU1OhlAaA
UomhyNeL21xVNHcgG2p4PXcY7j3irqtxJ/QKjGpOLO1WOxfPEE6DZQ1ovpQue62AmDf2k23fhUA0
EIXVznwHWVrNsZpU8oHuuglX04dOvfxk6XAWcQqCJteM8r7QatJ+UjM71Ioge7dxjtkP6SCSflBx
PHbwB0ztSKuflRFtRKq81v8zXQY5CMMwELz3FXwA1FK7cc6oRw68AYn/P4GdTZA4RZai1rHX693B
hN2ESVgiA731wPD1ZsGqlvaRSYdRNhsMffTahafahjzketht3q0ZZyaqqOQAz1KiJvd17H5GDEJd
f2RS03eokLV5e2fz9R2sIpGUQ1lnURMBRIOg+gPNDDOmcI3ISXwNgqiP8mkGms0fJjVQUqUIZNDG
1CnyzJiuBTpVjCNiYxTRDm+C3LJbW91yNUhl1kSl3Wkkv76FpnUK1iljtE/BRNoryGMhCJnvBper
AoJswm+HBVt4+zarAWR4IjH+ZuG9fJbXcj4fFx1fAQYAr6zcvA1lbmRzdHJlYW0NZW5kb2JqDTQz
MyAwIG9iag08PC9DUy9EZXZpY2VDTVlLL0kgZmFsc2UvSyBmYWxzZS9TL1RyYW5zcGFyZW5jeS9U
eXBlL0dyb3VwPj4NZW5kb2JqDTQzNCAwIG9iag08PC9CQm94WzczMy4xNDQgNzY4LjMwNyAxMDUy
LjY4IDQ1Mi4yN10vRmlsdGVyL0ZsYXRlRGVjb2RlL0dyb3VwIDQzMyAwIFIvTGVuZ3RoIDU5L01h
dHJpeFsxLjAgMC4wIDAuMCAxLjAgMC4wIDAuMF0vUmVzb3VyY2VzPDwvRXh0R1N0YXRlPDwvR1Mw
IDM5MiAwIFI+Pj4+L1N1YnR5cGUvRm9ybT4+c3RyZWFtDQpIiTJQMADDbC5992ADhfRiLnNjEz1D
ExMFE1NjPSNzBWNDcz1TYwsgbaJnYGyuUJTKlcYFEGAAJk8K5Q1lbmRzdHJlYW0NZW5kb2JqDTQz
NSAwIG9iag08PC9DUy9EZXZpY2VDTVlLL0kgZmFsc2UvSyBmYWxzZS9TL1RyYW5zcGFyZW5jeS9U
eXBlL0dyb3VwPj4NZW5kb2JqDTQzNiAwIG9iag08PC9CQm94WzEzNy44MjYgNzY4LjMwNyA0NTcu
MzY0IDQ1Mi4yN10vRmlsdGVyL0ZsYXRlRGVjb2RlL0dyb3VwIDQzNSAwIFIvTGVuZ3RoIDU5L01h
dHJpeFsxLjAgMC4wIDAuMCAxLjAgMC4wIDAuMF0vUmVzb3VyY2VzPDwvRXh0R1N0YXRlPDwvR1Mw
IDM5MiAwIFI+Pj4+L1N1YnR5cGUvRm9ybT4+c3RyZWFtDQpIiTJQMADDbC5992ADhfRiLkNjCz0L
IzMFE1NjPSNzBWNDcz1TYwsgbaJnYGyuUJTKlcYFEGAAJt0K6g1lbmRzdHJlYW0NZW5kb2JqDTQz
NyAwIG9iag08PC9DUy9EZXZpY2VDTVlLL0kgZmFsc2UvSyBmYWxzZS9TL1RyYW5zcGFyZW5jeS9U
eXBlL0dyb3VwPj4NZW5kb2JqDTQzOCAwIG9iag08PC9CQm94WzMwMy45MDIgNDI1LjI0NSA1NzMu
NDU1IDExNy4zODZdL0ZpbHRlci9GbGF0ZURlY29kZS9Hcm91cCA0MzcgMCBSL0xlbmd0aCA2Mi9N
YXRyaXhbMS4wIDAuMCAwLjAgMS4wIDAuMCAwLjBdL1Jlc291cmNlczw8L0V4dEdTdGF0ZTw8L0dT
MCAzOTIgMCBSPj4+Pi9TdWJ0eXBlL0Zvcm0+PnN0cmVhbQ0KSIkyUDAAw2wuffdgA4X0Yi5jAxM9
SwMjBUNDCz1jCzMFIzNzPVNTYwVjA1M9C1NLhaJUrjQugAADADFYCyMNZW5kc3RyZWFtDWVuZG9i
ag00MzkgMCBvYmoNPDwvQ1MvRGV2aWNlQ01ZSy9JIGZhbHNlL0sgZmFsc2UvUy9UcmFuc3BhcmVu
Y3kvVHlwZS9Hcm91cD4+DWVuZG9iag00NDAgMCBvYmoNPDwvQkJveFsyMS44MjAyIDQyNS4yNDUg
MjkxLjM3MyAxMTcuMzg2XS9GaWx0ZXIvRmxhdGVEZWNvZGUvR3JvdXAgNDM5IDAgUi9MZW5ndGgg
NjAvTWF0cml4WzEuMCAwLjAgMC4wIDEuMCAwLjAgMC4wXS9SZXNvdXJjZXM8PC9FeHRHU3RhdGU8
PC9HUzAgMzkyIDAgUj4+Pj4vU3VidHlwZS9Gb3JtPj5zdHJlYW0NCkiJMlAwAMNsLn33YAOF9GIu
IyM9CyMFQ0MLPWMLMwUjM3M9U1NjBWMDUz0LU0uFolSuNC6AAAMAG6oKvw1lbmRzdHJlYW0NZW5k
b2JqDTQ0MSAwIG9iag08PC9DUy9EZXZpY2VDTVlLL0kgZmFsc2UvSyBmYWxzZS9TL1RyYW5zcGFy
ZW5jeS9UeXBlL0dyb3VwPj4NZW5kb2JqDTQ0MiAwIG9iag08PC9CQm94Wzg5OS4xNzggNDI1LjI0
NSAxMTY4LjczIDExNy4zODZdL0ZpbHRlci9GbGF0ZURlY29kZS9Hcm91cCA0NDEgMCBSL0xlbmd0
aCA2Mi9NYXRyaXhbMS4wIDAuMCAwLjAgMS4wIDAuMCAwLjBdL1Jlc291cmNlczw8L0V4dEdTdGF0
ZTw8L0dTMCAzOTIgMCBSPj4+Pi9TdWJ0eXBlL0Zvcm0+PnN0cmVhbQ0KSIkyUDAAw2wuffdgA4X0
Yi5LAwM9Q3MLBUNDCz1jCzMFIzNzPVNTYwVjA1M9C1NLhaJUrjQugAADADI8CyoNZW5kc3RyZWFt
DWVuZG9iag00NDMgMCBvYmoNPDwvQ1MvRGV2aWNlQ01ZSy9JIGZhbHNlL0sgZmFsc2UvUy9UcmFu
c3BhcmVuY3kvVHlwZS9Hcm91cD4+DWVuZG9iag00NDQgMCBvYmoNPDwvQkJveFs2MTcuMDk2IDQy
NS4yNDUgODg2LjY0OSAxMTcuMzg2XS9GaWx0ZXIvRmxhdGVEZWNvZGUvR3JvdXAgNDQzIDAgUi9M
ZW5ndGggNjAvTWF0cml4WzEuMCAwLjAgMC4wIDEuMCAwLjAgMC4wXS9SZXNvdXJjZXM8PC9FeHRH
U3RhdGU8PC9HUzAgMzkyIDAgUj4+Pj4vU3VidHlwZS9Gb3JtPj5zdHJlYW0NCkiJMlAwAMNsLn33
YAOF9GIuM0MLPQNLMwVDIG1sYaZgZGauZ2pqrGBsYKpnYWqpUJTKlcYFEGAAMuoLLw1lbmRzdHJl
YW0NZW5kb2JqDTQ0NSAwIG9iag08PC9MZW5ndGggMTQ2MDcvU3VidHlwZS9YTUwvVHlwZS9NZXRh
ZGF0YT4+c3RyZWFtDQo8eDp4bXBtZXRhIHhtbG5zOng9ImFkb2JlOm5zOm1ldGEvIiB4OnhtcHRr
PSJBZG9iZSBYTVAgQ29yZSA1LjYtYzE0OCA3OS4xNjQwMzYsIDIwMTkvMDgvMTMtMDE6MDY6NTcg
ICAgICAgICI+CiA8cmRmOlJERiB4bWxuczpyZGY9Imh0dHA6Ly93d3cudzMub3JnLzE5OTkvMDIv
MjItcmRmLXN5bnRheC1ucyMiPgogIDxyZGY6RGVzY3JpcHRpb24gcmRmOmFib3V0PSIiCiAgICB4
bWxuczp4bXA9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC8iCiAgICB4bWxuczp4bXBUUGc9
Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC90L3BnLyIKICAgIHhtbG5zOnN0RGltPSJodHRw
Oi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvc1R5cGUvRGltZW5zaW9ucyMiCiAgICB4bWxuczp4bXBH
PSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvZy8iCiAgICB4bWxuczppbGx1c3RyYXRvcj0i
aHR0cDovL25zLmFkb2JlLmNvbS9pbGx1c3RyYXRvci8xLjAvIgogICAgeG1sbnM6ZGM9Imh0dHA6
Ly9wdXJsLm9yZy9kYy9lbGVtZW50cy8xLjEvIgogICAgeG1sbnM6eG1wTU09Imh0dHA6Ly9ucy5h
ZG9iZS5jb20veGFwLzEuMC9tbS8iCiAgICB4bWxuczpzdEV2dD0iaHR0cDovL25zLmFkb2JlLmNv
bS94YXAvMS4wL3NUeXBlL1Jlc291cmNlRXZlbnQjIgogICAgeG1sbnM6c3RSZWY9Imh0dHA6Ly9u
cy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiCiAgICB4bWxuczpwZGY9Imh0
dHA6Ly9ucy5hZG9iZS5jb20vcGRmLzEuMy8iCiAgICB4bWxuczpwaG90b3Nob3A9Imh0dHA6Ly9u
cy5hZG9iZS5jb20vcGhvdG9zaG9wLzEuMC8iCiAgICB4bWxuczp0aWZmPSJodHRwOi8vbnMuYWRv
YmUuY29tL3RpZmYvMS4wLyIKICAgIHhtbG5zOmV4aWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20vZXhp
Zi8xLjAvIgogICB4bXA6Q3JlYXRvclRvb2w9IkFkb2JlIFBob3Rvc2hvcCBDQyAoTWFjaW50b3No
KSIKICAgeG1wOkNyZWF0ZURhdGU9IjIwMTgtMDYtMjVUMTQ6MzM6MjArMDI6MDAiCiAgIHhtcDpN
b2RpZnlEYXRlPSIyMDE4LTA2LTI1VDE0OjM0OjExKzAyOjAwIgogICB4bXA6TWV0YWRhdGFEYXRl
PSIyMDE4LTA2LTI1VDE0OjM0OjExKzAyOjAwIgogICB4bXBUUGc6TlBhZ2VzPSIxIgogICB4bXBU
UGc6SGFzVmlzaWJsZVRyYW5zcGFyZW5jeT0iRmFsc2UiCiAgIHhtcFRQZzpIYXNWaXNpYmxlT3Zl
cnByaW50PSJGYWxzZSIKICAgaWxsdXN0cmF0b3I6VHlwZT0iRG9jdW1lbnQiCiAgIGRjOmZvcm1h
dD0iYXBwbGljYXRpb24vdm5kLmFkb2JlLnBob3Rvc2hvcCIKICAgeG1wTU06UmVuZGl0aW9uQ2xh
c3M9InByb29mOnBkZiIKICAgeG1wTU06RG9jdW1lbnRJRD0idXVpZDowZTgyM2EzMy00ZGMzLWE1
NGEtYTA1Zi1kYjQxNWRhOTNkMWMiCiAgIHhtcE1NOkluc3RhbmNlSUQ9InhtcC5paWQ6NjllZWVi
MzUtYjVkMi00MDEwLTg5MzEtMGZmZGFhNDAwN2Y1IgogICB4bXBNTTpPcmlnaW5hbERvY3VtZW50
SUQ9InV1aWQ6MGU4MjNhMzMtNGRjMy1hNTRhLWEwNWYtZGI0MTVkYTkzZDFjIgogICBwZGY6UHJv
ZHVjZXI9IkFkb2JlIFBERiBsaWJyYXJ5IDE1LjAwIgogICBwaG90b3Nob3A6Q29sb3JNb2RlPSI0
IgogICBwaG90b3Nob3A6SUNDUHJvZmlsZT0iQ29hdGVkIEZPR1JBMzkgKElTTyAxMjY0Ny0yOjIw
MDQpIgogICB0aWZmOk9yaWVudGF0aW9uPSIxIgogICB0aWZmOlhSZXNvbHV0aW9uPSIzMDAwMDAw
LzEwMDAwIgogICB0aWZmOllSZXNvbHV0aW9uPSIzMDAwMDAwLzEwMDAwIgogICB0aWZmOlJlc29s
dXRpb25Vbml0PSIyIgogICBleGlmOkNvbG9yU3BhY2U9IjY1NTM1IgogICBleGlmOlBpeGVsWERp
bWVuc2lvbj0iNTA3OSIKICAgZXhpZjpQaXhlbFlEaW1lbnNpb249IjM1OTEiPgogICA8eG1wVFBn
Ok1heFBhZ2VTaXplCiAgICBzdERpbTp3PSIyOTcuMDAwMDA1IgogICAgc3REaW06aD0iMjA5Ljk5
OTk5OCIKICAgIHN0RGltOnVuaXQ9Ik1pbGxpbWV0ZXJzIi8+CiAgIDx4bXBUUGc6UGxhdGVOYW1l
cz4KICAgIDxyZGY6U2VxPgogICAgIDxyZGY6bGk+Q3lhbjwvcmRmOmxpPgogICAgIDxyZGY6bGk+
TWFnZW50YTwvcmRmOmxpPgogICAgIDxyZGY6bGk+WWVsbG93PC9yZGY6bGk+CiAgICAgPHJkZjps
aT5CbGFjazwvcmRmOmxpPgogICAgPC9yZGY6U2VxPgogICA8L3htcFRQZzpQbGF0ZU5hbWVzPgog
ICA8eG1wVFBnOlN3YXRjaEdyb3Vwcz4KICAgIDxyZGY6U2VxPgogICAgIDxyZGY6bGk+CiAgICAg
IDxyZGY6RGVzY3JpcHRpb24KICAgICAgIHhtcEc6Z3JvdXBOYW1lPSJHcm91cGUgZGUgbnVhbmNl
cyBwYXIgZMOpZmF1dCIKICAgICAgIHhtcEc6Z3JvdXBUeXBlPSIwIj4KICAgICAgPHhtcEc6Q29s
b3JhbnRzPgogICAgICAgPHJkZjpTZXE+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3
YXRjaE5hbWU9IldoaXRlIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6
dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSIwLjAwMDAwMCIKICAgICAgICAgeG1w
RzptYWdlbnRhPSIwLjAwMDAwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9IjAuMDAwMDAwIgogICAg
ICAgICB4bXBHOmJsYWNrPSIwLjAwMDAwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1w
Rzpzd2F0Y2hOYW1lPSJCbGFjayIKICAgICAgICAgeG1wRzptb2RlPSJDTVlLIgogICAgICAgICB4
bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iNjkuNTMxMzAwIgogICAgICAg
ICB4bXBHOm1hZ2VudGE9IjY3LjE4NzUwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9IjYzLjY3MTkw
MCIKICAgICAgICAgeG1wRzpibGFjaz0iNzMuODI4MTAwIi8+CiAgICAgICAgPHJkZjpsaQogICAg
ICAgICB4bXBHOnN3YXRjaE5hbWU9IkNNWUsgUmVkIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsi
CiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSIwLjc4MTMw
MCIKICAgICAgICAgeG1wRzptYWdlbnRhPSI5OC44MjgxMDAiCiAgICAgICAgIHhtcEc6eWVsbG93
PSI5Ni44NzUwMDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjAuMDAwMDAwIi8+CiAgICAgICAgPHJk
ZjpsaQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9IkNNWUsgWWVsbG93IgogICAgICAgICB4bXBH
Om1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpj
eWFuPSIzLjkwNjMwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSIwLjAwMDAwMCIKICAgICAgICAg
eG1wRzp5ZWxsb3c9IjkzLjM1OTQwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4wMDAwMDAiLz4K
ICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQ01ZSyBHcmVlbiIKICAg
ICAgICAgeG1wRzptb2RlPSJDTVlLIgogICAgICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAg
ICAgIHhtcEc6Y3lhbj0iODIuODEyNTAwIgogICAgICAgICB4bXBHOm1hZ2VudGE9IjcuMDMxMzAw
IgogICAgICAgICB4bXBHOnllbGxvdz0iOTUuMzEyNTAwIgogICAgICAgICB4bXBHOmJsYWNrPSIw
LjM5MDYwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDTVlL
IEN5YW4iCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9D
RVNTIgogICAgICAgICB4bXBHOmN5YW49IjY5LjUzMTMwMCIKICAgICAgICAgeG1wRzptYWdlbnRh
PSIxNC40NTMxMDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSIwLjAwMDAwMCIKICAgICAgICAgeG1w
RzpibGFjaz0iMC4wMDAwMDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNo
TmFtZT0iQ01ZSyBCbHVlIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6
dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSI5OC44MjgxMDAiCiAgICAgICAgIHht
cEc6bWFnZW50YT0iOTYuMDkzODAwIgogICAgICAgICB4bXBHOnllbGxvdz0iMy45MDYzMDAiCiAg
ICAgICAgIHhtcEc6YmxhY2s9IjAuMzkwNjAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4
bXBHOnN3YXRjaE5hbWU9IkNNWUsgTWFnZW50YSIKICAgICAgICAgeG1wRzptb2RlPSJDTVlLIgog
ICAgICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iMS4xNzE5MDAi
CiAgICAgICAgIHhtcEc6bWFnZW50YT0iOTguODI4MTAwIgogICAgICAgICB4bXBHOnllbGxvdz0i
MS4xNzE5MDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjAuMDAwMDAwIi8+CiAgICAgICAgPHJkZjps
aQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9IkM9MTUgTT0xMDAgWT05MCBLPTEwIgogICAgICAg
ICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAg
eG1wRzpjeWFuPSIxNy41NzgxMDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0iMTAwLjAwMDAwMCIK
ICAgICAgICAgeG1wRzp5ZWxsb3c9IjkwLjYyNTAwMCIKICAgICAgICAgeG1wRzpibGFjaz0iNy44
MTI1MDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz0wIE09
OTAgWT04NSBLPTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBl
PSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjAuMDAwMDAwIgogICAgICAgICB4bXBHOm1h
Z2VudGE9Ijg5Ljg0MzgwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9Ijg0Ljc2NTYwMCIKICAgICAg
ICAgeG1wRzpibGFjaz0iMC4wMDAwMDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6
c3dhdGNoTmFtZT0iQz0wIE09ODAgWT05NSBLPTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIK
ICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjAuMDAwMDAw
IgogICAgICAgICB4bXBHOm1hZ2VudGE9Ijc5LjY4NzUwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9
Ijk0LjUzMTMwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4wMDAwMDAiLz4KICAgICAgICA8cmRm
OmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz0wIE09NTAgWT0xMDAgSz0wIgogICAgICAg
ICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAg
eG1wRzpjeWFuPSIwLjM5MDYwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSI1MC4zOTA2MDAiCiAg
ICAgICAgIHhtcEc6eWVsbG93PSI5OC40Mzc1MDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjAuMDAw
MDAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9IkM9MCBNPTM1
IFk9ODUgSz0wIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0i
UFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSIwLjM5MDYwMCIKICAgICAgICAgeG1wRzptYWdl
bnRhPSIzNS4xNTYzMDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSI4NC4zNzUwMDAiCiAgICAgICAg
IHhtcEc6YmxhY2s9IjAuMDAwMDAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3
YXRjaE5hbWU9IkM9NSBNPTAgWT05MCBLPTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAg
ICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjUuNDY4ODAwIgog
ICAgICAgICB4bXBHOm1hZ2VudGE9IjAuMzkwNjAwIgogICAgICAgICB4bXBHOnllbGxvdz0iOTAu
MjM0NDAwIgogICAgICAgICB4bXBHOmJsYWNrPSIwLjAwMDAwMCIvPgogICAgICAgIDxyZGY6bGkK
ICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTIwIE09MCBZPTEwMCBLPTAiCiAgICAgICAgIHht
cEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBH
OmN5YW49IjE5LjkyMTkwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSIwLjM5MDYwMCIKICAgICAg
ICAgeG1wRzp5ZWxsb3c9Ijk4LjQzNzUwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4wMDAwMDAi
Lz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz01MCBNPTAgWT0x
MDAgSz0wIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJP
Q0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSI1MC4zOTA2MDAiCiAgICAgICAgIHhtcEc6bWFnZW50
YT0iMC4zOTA2MDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSI5OC44MjgxMDAiCiAgICAgICAgIHht
cEc6YmxhY2s9IjAuMDAwMDAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3YXRj
aE5hbWU9IkM9NzUgTT0wIFk9MTAwIEs9MCIKICAgICAgICAgeG1wRzptb2RlPSJDTVlLIgogICAg
ICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iNzUuMDAwMDAwIgog
ICAgICAgICB4bXBHOm1hZ2VudGE9IjAuNzgxMzAwIgogICAgICAgICB4bXBHOnllbGxvdz0iMTAw
LjAwMDAwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4wMDAwMDAiLz4KICAgICAgICA8cmRmOmxp
CiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz04NSBNPTEwIFk9MTAwIEs9MTAiCiAgICAgICAg
IHhtcEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4
bXBHOmN5YW49Ijg1LjkzNzUwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSIxNy4xODc1MDAiCiAg
ICAgICAgIHhtcEc6eWVsbG93PSIxMDAuMDAwMDAwIgogICAgICAgICB4bXBHOmJsYWNrPSIzLjUx
NTYwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTkwIE09
MzAgWT05NSBLPTMwIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlw
ZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSI4OS44NDM4MDAiCiAgICAgICAgIHhtcEc6
bWFnZW50YT0iMzMuMjAzMTAwIgogICAgICAgICB4bXBHOnllbGxvdz0iOTcuMjY1NjAwIgogICAg
ICAgICB4bXBHOmJsYWNrPSIyNS43ODEzMDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHht
cEc6c3dhdGNoTmFtZT0iQz03NSBNPTAgWT03NSBLPTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01Z
SyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49Ijc1LjM5
MDYwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSIwLjM5MDYwMCIKICAgICAgICAgeG1wRzp5ZWxs
b3c9Ijc0LjYwOTQwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4wMDAwMDAiLz4KICAgICAgICA8
cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz04MCBNPTEwIFk9NDUgSz0wIgogICAg
ICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAg
ICAgeG1wRzpjeWFuPSI3OC45MDYzMDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0iMTAuOTM3NTAw
IgogICAgICAgICB4bXBHOnllbGxvdz0iNDUuMzEyNTAwIgogICAgICAgICB4bXBHOmJsYWNrPSIw
LjAwMDAwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTcw
IE09MTUgWT0wIEs9MCIKICAgICAgICAgeG1wRzptb2RlPSJDTVlLIgogICAgICAgICB4bXBHOnR5
cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iNzAuMzEyNTAwIgogICAgICAgICB4bXBH
Om1hZ2VudGE9IjE2LjAxNTYwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9IjAuMDAwMDAwIgogICAg
ICAgICB4bXBHOmJsYWNrPSIwLjAwMDAwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1w
Rzpzd2F0Y2hOYW1lPSJDPTg1IE09NTAgWT0wIEs9MCIKICAgICAgICAgeG1wRzptb2RlPSJDTVlL
IgogICAgICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iODQuNzY1
NjAwIgogICAgICAgICB4bXBHOm1hZ2VudGE9IjQ5LjYwOTQwMCIKICAgICAgICAgeG1wRzp5ZWxs
b3c9IjAuMzkwNjAwIgogICAgICAgICB4bXBHOmJsYWNrPSIwLjAwMDAwMCIvPgogICAgICAgIDxy
ZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTEwMCBNPTk1IFk9NSBLPTAiCiAgICAg
ICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAg
ICB4bXBHOmN5YW49Ijk5LjIxODgwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSI5Mi45Njg4MDAi
CiAgICAgICAgIHhtcEc6eWVsbG93PSI2LjY0MDYwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4z
OTA2MDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz0xMDAg
TT0xMDAgWT0yNSBLPTI1IgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6
dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSIxMDAuMDAwMDAwIgogICAgICAgICB4
bXBHOm1hZ2VudGE9IjEwMC4wMDAwMDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSIzMC40Njg4MDAi
CiAgICAgICAgIHhtcEc6YmxhY2s9IjIxLjg3NTAwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAg
ICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTc1IE09MTAwIFk9MCBLPTAiCiAgICAgICAgIHhtcEc6bW9k
ZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49
Ijc1LjAwMDAwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSI5OC40Mzc1MDAiCiAgICAgICAgIHht
cEc6eWVsbG93PSIxLjU2MjUwMCIKICAgICAgICAgeG1wRzpibGFjaz0iMC4zOTA2MDAiLz4KICAg
ICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz01MCBNPTEwMCBZPTAgSz0w
IgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIK
ICAgICAgICAgeG1wRzpjeWFuPSI1MS4xNzE5MDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0iOTku
MjE4ODAwIgogICAgICAgICB4bXBHOnllbGxvdz0iMS45NTMxMDAiCiAgICAgICAgIHhtcEc6Ymxh
Y2s9IjAuMDAwMDAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9
IkM9MzUgTT0xMDAgWT0zNSBLPTEwIgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAg
IHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpjeWFuPSIzNS45Mzc1MDAiCiAgICAg
ICAgIHhtcEc6bWFnZW50YT0iMTAwLjAwMDAwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9IjM1LjE1
NjMwMCIKICAgICAgICAgeG1wRzpibGFjaz0iOC45ODQ0MDAiLz4KICAgICAgICA8cmRmOmxpCiAg
ICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz0xMCBNPTEwMCBZPTUwIEs9MCIKICAgICAgICAgeG1w
Rzptb2RlPSJDTVlLIgogICAgICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6
Y3lhbj0iOS43NjU2MDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0iOTkuMjE4ODAwIgogICAgICAg
ICB4bXBHOnllbGxvdz0iNDguMDQ2OTAwIgogICAgICAgICB4bXBHOmJsYWNrPSIwLjM5MDYwMCIv
PgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTAgTT05NSBZPTIw
IEs9MCIKICAgICAgICAgeG1wRzptb2RlPSJDTVlLIgogICAgICAgICB4bXBHOnR5cGU9IlBST0NF
U1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iMC43ODEzMDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0i
OTQuNTMxMzAwIgogICAgICAgICB4bXBHOnllbGxvdz0iMTkuOTIxOTAwIgogICAgICAgICB4bXBH
OmJsYWNrPSIwLjAwMDAwMCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hO
YW1lPSJDPTI1IE09MjUgWT00MCBLPTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAg
ICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjI1LjM5MDYwMCIKICAg
ICAgICAgeG1wRzptYWdlbnRhPSIyNS4wMDAwMDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSI0MC4y
MzQ0MDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjAuMDAwMDAwIi8+CiAgICAgICAgPHJkZjpsaQog
ICAgICAgICB4bXBHOnN3YXRjaE5hbWU9IkM9NDAgTT00NSBZPTUwIEs9NSIKICAgICAgICAgeG1w
Rzptb2RlPSJDTVlLIgogICAgICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6
Y3lhbj0iMzkuNDUzMTAwIgogICAgICAgICB4bXBHOm1hZ2VudGE9IjQ0LjUzMTMwMCIKICAgICAg
ICAgeG1wRzp5ZWxsb3c9IjQ4LjQzNzUwMCIKICAgICAgICAgeG1wRzpibGFjaz0iNi4yNTAwMDAi
Lz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iQz01MCBNPTUwIFk9
NjAgSz0yNSIKICAgICAgICAgeG1wRzptb2RlPSJDTVlLIgogICAgICAgICB4bXBHOnR5cGU9IlBS
T0NFU1MiCiAgICAgICAgIHhtcEc6Y3lhbj0iNTEuNTYyNTAwIgogICAgICAgICB4bXBHOm1hZ2Vu
dGE9IjUxLjE3MTkwMCIKICAgICAgICAgeG1wRzp5ZWxsb3c9IjYwLjkzNzUwMCIKICAgICAgICAg
eG1wRzpibGFjaz0iMjMuMDQ2OTAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3
YXRjaE5hbWU9IkM9NTUgTT02MCBZPTY1IEs9NDAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIK
ICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjU0LjI5Njkw
MCIKICAgICAgICAgeG1wRzptYWdlbnRhPSI2MC4xNTYzMDAiCiAgICAgICAgIHhtcEc6eWVsbG93
PSI2NC40NTMxMDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjM5LjQ1MzEwMCIvPgogICAgICAgIDxy
ZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTI1IE09NDAgWT02NSBLPTAiCiAgICAg
ICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAg
ICB4bXBHOmN5YW49IjIzLjQzNzUwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSIzOS40NTMxMDAi
CiAgICAgICAgIHhtcEc6eWVsbG93PSI2NC4wNjI1MDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjEu
NTYyNTAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9IkM9MzAg
TT01MCBZPTc1IEs9MTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAgICAgeG1wRzp0
eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjMwLjQ2ODgwMCIKICAgICAgICAgeG1w
RzptYWdlbnRhPSI0OS4yMTg4MDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSI3NS4zOTA2MDAiCiAg
ICAgICAgIHhtcEc6YmxhY2s9IjkuNzY1NjAwIi8+CiAgICAgICAgPHJkZjpsaQogICAgICAgICB4
bXBHOnN3YXRjaE5hbWU9IkM9MzUgTT02MCBZPTgwIEs9MjUiCiAgICAgICAgIHhtcEc6bW9kZT0i
Q01ZSyIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjM1
LjkzNzUwMCIKICAgICAgICAgeG1wRzptYWdlbnRhPSI2MC4xNTYzMDAiCiAgICAgICAgIHhtcEc6
eWVsbG93PSI4MC40Njg4MDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjI0LjIxODgwMCIvPgogICAg
ICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTQwIE09NjUgWT05MCBLPTM1
IgogICAgICAgICB4bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIK
ICAgICAgICAgeG1wRzpjeWFuPSIzOS4wNjI1MDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0iNjQu
MDYyNTAwIgogICAgICAgICB4bXBHOnllbGxvdz0iODkuMDYyNTAwIgogICAgICAgICB4bXBHOmJs
YWNrPSIzNS41NDY5MDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFt
ZT0iQz00MCBNPTcwIFk9MTAwIEs9NTAiCiAgICAgICAgIHhtcEc6bW9kZT0iQ01ZSyIKICAgICAg
ICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmN5YW49IjQxLjQwNjMwMCIKICAg
ICAgICAgeG1wRzptYWdlbnRhPSI2OS41MzEzMDAiCiAgICAgICAgIHhtcEc6eWVsbG93PSI5Ni40
ODQ0MDAiCiAgICAgICAgIHhtcEc6YmxhY2s9IjQ4LjgyODEwMCIvPgogICAgICAgIDxyZGY6bGkK
ICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJDPTUwIE09NzAgWT04MCBLPTcwIgogICAgICAgICB4
bXBHOm1vZGU9IkNNWUsiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1w
RzpjeWFuPSI1MS41NjI1MDAiCiAgICAgICAgIHhtcEc6bWFnZW50YT0iNjkuOTIxOTAwIgogICAg
ICAgICB4bXBHOnllbGxvdz0iNzguOTA2MzAwIgogICAgICAgICB4bXBHOmJsYWNrPSI2OS41MzEz
MDAiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iSz0xMDAiCiAg
ICAgICAgIHhtcEc6bW9kZT0iR1JBWSIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAg
ICAgICB4bXBHOmdyYXk9IjI1NSIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0
Y2hOYW1lPSJLPTkwIgogICAgICAgICB4bXBHOm1vZGU9IkdSQVkiCiAgICAgICAgIHhtcEc6dHlw
ZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpncmF5PSIyMjkiLz4KICAgICAgICA8cmRmOmxpCiAg
ICAgICAgIHhtcEc6c3dhdGNoTmFtZT0iSz04MCIKICAgICAgICAgeG1wRzptb2RlPSJHUkFZIgog
ICAgICAgICB4bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Z3JheT0iMjAzIi8+CiAg
ICAgICAgPHJkZjpsaQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9Iks9NzAiCiAgICAgICAgIHht
cEc6bW9kZT0iR1JBWSIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBH
OmdyYXk9IjE3OCIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJL
PTYwIgogICAgICAgICB4bXBHOm1vZGU9IkdSQVkiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VT
UyIKICAgICAgICAgeG1wRzpncmF5PSIxNTIiLz4KICAgICAgICA8cmRmOmxpCiAgICAgICAgIHht
cEc6c3dhdGNoTmFtZT0iSz01MCIKICAgICAgICAgeG1wRzptb2RlPSJHUkFZIgogICAgICAgICB4
bXBHOnR5cGU9IlBST0NFU1MiCiAgICAgICAgIHhtcEc6Z3JheT0iMTI3Ii8+CiAgICAgICAgPHJk
ZjpsaQogICAgICAgICB4bXBHOnN3YXRjaE5hbWU9Iks9NDAiCiAgICAgICAgIHhtcEc6bW9kZT0i
R1JBWSIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmdyYXk9IjEw
MSIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJLPTMwIgogICAg
ICAgICB4bXBHOm1vZGU9IkdSQVkiCiAgICAgICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAg
ICAgeG1wRzpncmF5PSI3NiIvPgogICAgICAgIDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hO
YW1lPSJLPTIwIgogICAgICAgICB4bXBHOm1vZGU9IkdSQVkiCiAgICAgICAgIHhtcEc6dHlwZT0i
UFJPQ0VTUyIKICAgICAgICAgeG1wRzpncmF5PSI1MCIvPgogICAgICAgIDxyZGY6bGkKICAgICAg
ICAgeG1wRzpzd2F0Y2hOYW1lPSJLPTEwIgogICAgICAgICB4bXBHOm1vZGU9IkdSQVkiCiAgICAg
ICAgIHhtcEc6dHlwZT0iUFJPQ0VTUyIKICAgICAgICAgeG1wRzpncmF5PSIyNSIvPgogICAgICAg
IDxyZGY6bGkKICAgICAgICAgeG1wRzpzd2F0Y2hOYW1lPSJLPTUiCiAgICAgICAgIHhtcEc6bW9k
ZT0iR1JBWSIKICAgICAgICAgeG1wRzp0eXBlPSJQUk9DRVNTIgogICAgICAgICB4bXBHOmdyYXk9
IjEyIi8+CiAgICAgICA8L3JkZjpTZXE+CiAgICAgIDwveG1wRzpDb2xvcmFudHM+CiAgICAgIDwv
cmRmOkRlc2NyaXB0aW9uPgogICAgIDwvcmRmOmxpPgogICAgPC9yZGY6U2VxPgogICA8L3htcFRQ
ZzpTd2F0Y2hHcm91cHM+CiAgIDxkYzp0aXRsZT4KICAgIDxyZGY6QWx0PgogICAgIDxyZGY6bGkg
eG1sOmxhbmc9IngtZGVmYXVsdCI+Zm9uZCBncmlzIGFuZSBxdWkgcml0PC9yZGY6bGk+CiAgICA8
L3JkZjpBbHQ+CiAgIDwvZGM6dGl0bGU+CiAgIDx4bXBNTTpIaXN0b3J5PgogICAgPHJkZjpTZXE+
CiAgICAgPHJkZjpsaQogICAgICBzdEV2dDphY3Rpb249ImNvbnZlcnRlZCIKICAgICAgc3RFdnQ6
cGFyYW1ldGVycz0iZnJvbSBhcHBsaWNhdGlvbi9wZGYgdG8gYXBwbGljYXRpb24vdm5kLmFkb2Jl
LnBob3Rvc2hvcCIvPgogICAgIDxyZGY6bGkKICAgICAgc3RFdnQ6YWN0aW9uPSJzYXZlZCIKICAg
ICAgc3RFdnQ6aW5zdGFuY2VJRD0ieG1wLmlpZDo2OWVlZWIzNS1iNWQyLTQwMTAtODkzMS0wZmZk
YWE0MDA3ZjUiCiAgICAgIHN0RXZ0OndoZW49IjIwMTgtMDYtMjVUMTQ6MzQ6MTErMDI6MDAiCiAg
ICAgIHN0RXZ0OnNvZnR3YXJlQWdlbnQ9IkFkb2JlIFBob3Rvc2hvcCBDQyAoTWFjaW50b3NoKSIK
ICAgICAgc3RFdnQ6Y2hhbmdlZD0iLyIvPgogICAgPC9yZGY6U2VxPgogICA8L3htcE1NOkhpc3Rv
cnk+CiAgIDx4bXBNTTpEZXJpdmVkRnJvbQogICAgc3RSZWY6aW5zdGFuY2VJRD0idXVpZDoyOWU3
NjI4Yy02ZDA2LTE1NDItODQwYS1iYjYyNmNlNDZmNTEiCiAgICBzdFJlZjpkb2N1bWVudElEPSJ1
dWlkOjBlODIzYTMzLTRkYzMtYTU0YS1hMDVmLWRiNDE1ZGE5M2QxYyIKICAgIHN0UmVmOm9yaWdp
bmFsRG9jdW1lbnRJRD0idXVpZDowZTgyM2EzMy00ZGMzLWE1NGEtYTA1Zi1kYjQxNWRhOTNkMWMi
CiAgICBzdFJlZjpyZW5kaXRpb25DbGFzcz0icHJvb2Y6cGRmIi8+CiAgPC9yZGY6RGVzY3JpcHRp
b24+CiA8L3JkZjpSREY+CjwveDp4bXBtZXRhPgoNZW5kc3RyZWFtDWVuZG9iag00NDYgMCBvYmoN
PDwvQml0c1BlckNvbXBvbmVudCA4L0NvbG9yU3BhY2UvRGV2aWNlQ01ZSy9GaWx0ZXIvRENURGVj
b2RlL0hlaWdodCAzNDgzL0ludGVudC9SZWxhdGl2ZUNvbG9yaW1ldHJpYy9MZW5ndGggMTIxMjc0
Ni9NZXRhZGF0YSA0NDUgMCBSL05hbWUvWC9TdWJ0eXBlL0ltYWdlL1R5cGUvWE9iamVjdC9XaWR0
aCA0OTIzPj5zdHJlYW0NCv/Y/+4ADkFkb2JlAGQAAAAAAv/bAQYAAgICBQIFBwUFBwgHBgcICQkI
CAkJCwoKCgoKCwwLCwsLCwsMDAwMDA4ODAwMDAwMDwwMDAwMDAwPDAwMDAwMDAEDBAQKBQoPCgoP
Dw4ODAwMDw8ODgwMDA4TDg4MDAwRERQRDAwMERERFBEMERERERERERERERERERERERERERERAgME
BAoFCg8KCg8PDg4MDAwPDw4ODAwMDhMODgwMDBERFBEMDAwREREUEQwRERERERERERERERERERER
EREREREDAwQECgUKDwoKDw8ODgwMDA8PDg4MDAwOEw4ODAwMEREUEQwMDBERERQRDBERERERERER
EREREREREREREREREf/dAAQCaP/AABQIDZsTOwQAEQABEQECEQIDEQP/xAGiAAABBAMBAQEBAAAA
AAAAAAADAgQFBgABBwgJCgsBAQEBAQEBAQACAwAAAAAAAAABAgMEBQkGBwgKCxAAAgECAgYECQkE
BwIBAgBvAAECAxEEIQUSMUFRYQZxgZEHEyIyQqGxwdEUFSNSYnKC4fAkM5KiCCVDU7LC8RZz0jRj
gyZEk6Oz4hc1NlR0wydldbTjCQoYGRooKSo3ODk6RUZHSElKVVZXWFlaZGZnaGlqdnd4eXqEhYaH
iImKlJWWl5iZmqSlpqeoqaq1tre4ubrExcbHyMnK09TV1tfY2drk5ebn6Onq8vP09fb3+Pn6EQEB
AAIBAwEECAEEAQIKewAAAQIRMQMSIUEyUXGBBBMiYZGxwfChI0Lh8dEUMwUGBwgJChUWFxgZGiQl
JicoKSo0NTY3ODk6Q0RFRkdISUpSU1RVVldYWVpiY2RlZmdoaWpyc3R1dnd4eXqCg4SFhoeIiYqS
k5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY2dri4+Tl5ufo6ery8/T1
9vf4+fr/2gAOBAAAARECEQMRAD8A9QHtfCflYwAwA0QGAGWAMKDAg0AYAYAYAYAYQGAGAGAGEBgB
gBgBgBgBgBqxQZYAywBlgDLAGtUAzVAMsAJIDADADADADADADQBgBhQYEGAGAGAGAGAGAGAGAGAG
WANWAMsRRlgDLAGrAGWANAGAGAGAGAGAGWANWAMKDAgwAwAwAwAwAwAwAwAwAwAwA2FCkgDYQYAY
AYAbKDAowAwA3YgFBBgBgBhQYAYAbCjADADAJSkgI2EGAGAGAGAGAGwDYUYAYAbQQbANoA2FGAGA
GFBgApEBsAwAwA2AYUGwowgFBBsA2FGAGACkAKKDABaZFBEwBaYAROwUETAFpgBEyAImALTCgiYA
tMAWmRQRMAWmAETACJhQWLADRkAGiwA8ZEUFiwA0ZBQaMgAqkAGjIKCxkAGjIgDJhQVMAKmFBVIA
KpBQRSACKRFBVIAKpABFIKF3AFXAFXAN3AFJkBsKFXAN3ANgCrgG7gGwBSkAKvcgN3AMCjQQYAYA
YAYAYAJbCDQUaAMAMANFQYQGiAwA1cqjQBoqDADCAwgMAMANFQaANXANFUYAYQGAGgDAg0AYAbAM
CjYBgBu4QKuAbIowAwAwA2FG7lBu5EGwo2mALQBsAUmAKANphQsINhRtMAWAYFC0wg2FCosAUAbI
BSKDYBtEAsoNogNooFAGAG0QGBRgBgAoqhREGAGAGACLBRoINNFAkA0QCGrFBoA00AJANFQJaIBD
RQIaABNAA2ggG0ADaCAbQANoAG0UA2ggE0AIaCAbQANoAE0EA2igE0ADaCATRQDaABNBANoAG0UA
2ggE0ADaABtWKgG0AIaABNBANoAG0ACaCAbQANoAQ1cIBtAA2gATQQDaKAbQANoAG0ADaKgQ0AJa
uAIAENWAENXCBAAhoAS0BohoAQ0UCWgBDAENACGrhANoCwhoDQbQANoAQ0EA2igQ0BYG0BoNoAQ0
ADaCAbQBpoDRFgDQAhoA0EWEtBWiSoEtEAkoEtWA0SBSGgBLQAloDRNgg2goIALQASJFBIgB4sAP
EKDxZFSjxYEHiyKHEGAOYMKHMGBDmDIrJzFgDiLChzFkA5iwqHEGFZOYsAcxZFDmDAHEWFKcwZBk
5iwocRYUOIsAPFkUOIsDBxFgB4sKHEWRQeLAHEWFSjxYGTiLIoPFgDiLChxFgB4sglHiFQVMAKmF
BEyAKmAFQUEiAFiyALEKFACkEGwoVFhAoKNp2AFgGwDADQBorISRQkIMKAbQANgA2gATABsIBNAA
ZIAbyRUAJIABJBACSAASRUDeSAASQQAkigbyQQAmgBtJFQNpoIG8kVA2kgBvNFQNpIIG8kUDaSCB
tJFQN5IIASQACSAAyQACSCATQANlANoIBtAGgDQBpoASAaAMauAIANAGBAhoA0FGmECQDQAloASF
GgyNNBQkAwA0VB0nwR475v03hZbpSlB/ji4r1tGM+Hfo3WUFs/pA4D5NpWFVbKtCL7YuUX6kjPT4
dPpM8/IcKOjyDAD154EX886DxWEf16sLcqlNe9s8+fivo9DzjYPIjVsmd3zwmxQOsBinga1OqtsJ
xkvwtMiy6Hqb+kdhVWw2DrrZGpON/vxT/wApx6b3fSZ4g8mnd4BlgD0Z/RxxWpjMVS+tRjL+GVv8
xy6j2fRub8ByPwg4X5FpfGw/7qKjXVKTkvabx4efqTVvxFONuQwA9e6c/rToVCW1wo0bf8g6kYv1
JnnntPo5ecPlB5CO7541YgOk+CCt8m05hJcZTj/FCUfeZz4dujftQWv+kJh/FaXhL6+Hg+6U17jP
T4dPpHPyHCbHV5QWlU8Xk1eL2r9bHwftTaYHr7wFQ8fobFUU7p1qlnylTgux5PI4dTl9D6P7N+P6
DyJOKrLWjtXnL3rl7Oo7vnjISVZastq81+58vZ1AGUarwks1sea6n7QcD1p/SMjrYLCVFurOz643
9xw6b6H0nifEeTJpV1rLzl5y96963bVlku754TTkqi1JfhfB/D2PNb0wO9/0dW6WlK8Ht+TSfdUh
8Tl1OHq+jc/Ic88KeHdHTOMe51W++zt6/eax4cetPtUUeS+Uq/prbzXHrW/jt23ZpzCKU01qS817
+D4/Hj2IqbHr7DKUOhL4qjLmnas+9Pua5Hn/AJz6M/tv5fqPIFamra8fNfqfD4PeuadvQ+eH0f6z
hq/20Fl9uK3feitnGOW2MUy8i1eDDFuhpbCQavGdendc08pLmr9za3mcuHTpXzPiOnf0i6sqGkcL
OLalGjdNbU1OVmY6fDt9J5nwHBcbSjiY/KKaSTdqkV6Mnw+zLauDvHYk31eStC4N/OUFh5eer+Jf
N5un1N5x4Ty9NtSk8+B6c/o1rVo41P69P2SOPUe76L6pXmDT2C+SV52etCblKEuMW3607qS3NPas
ztK8WU0peK/ram66/ewt45fWWxVOvZGfO0s3KVnC3yB6MrxqxeGqu1ObvGT2QnsUvuvzZ8rSs3GK
LUnuHrbwtVqmiej2DlHyZwnh1Z55qnJNNbGtqaeTWTyPPh5r39bxjPl+SPI2lcLCOrXoq1Grey26
kl50G+V0098XFvO6Xd8+xTql/XNDxb/f0Itw4zprOUeuGco/Z1lfyYIcLz8h0nwAVZU9NRin5MqV
TWXGyuvX+szHU4d/o9+0Uz8Ok2tPV3stGlb/AJNxLhwnX9r8CKDpaK0pTWNj5zajXS3VHmp9U0m3
9tT2JxRqeHLLz5G9DyWk4PAz2yetQb9Gra2r1VElF/aUG2kndUnnwPVHgmm9GdFsTVcU3H5TJxks
nqw2NdlmcM+Xv6PjC/NK8l6b0fDCTU6N3QqrXpN5tJuzi/tRd4vjbW2NHeV4MppT2f8AXmE1ttfC
xSfGdG9k+bpt246jWyNNjhfanw/Ib6H4yNLFRoVVejiJRpzXBuS1ZrnGVnzWtHZJirhfPxHpD+kz
XdKngUnZ69WSa25KGfrOXSev6V6fNI829IILSUIaQgv3r1ayXo1krt8lNeWt19eKyidY8eXnz+9q
XoT+uqM8BL95d1MN/vLeVTX+8ilbjOMFvZL4MfPj8B2X+jRRvj8VPhQS75p+4x1Hp+jc34JXMvC3
g54XTWKlJpxqVJShJbGruLXXGUZQf2os3hw4daayqoev/X2BVTbXwaUZ8ZUG7Ql+CT1G/qyprZFl
4Z9qfD8g06M4+nQqSoYh2w+Ij4uo/q53hU64StLi460fSYsTG+nvHrLHYSp0Z6FTpT8mpTpuLs9k
pV7ZNc3k11nDmvfZ24fv3o8q9KIrSkaekoL9/eNZL0a8ba/UppqoucpJead57nhy8+ff+al9H/68
w1XRzzqZ1sN/vIry4L/eQWXGcILeL4MfM1+Ad+CxzWm8DqNp+Pjdrh6S6mrp8mTLhel7U+I6t/Sb
r62PwtP6tBy/im1/lMdN3+lXzPgkcerf8jBo1T218DaEuMsPOXkv/kHN6rf1ZwWyJ04rz+1Ph+Sm
PRHSNPCV3RxDthsTF0az+qpNOM+uElGfY1vFTC+/ij1D/Rx0JU0LLSUKytUhVp0pdcNe9uWd096s
zj1Lt7fo2OtpXnjp9qaalHStJJKvOdOslurU9r/HFxnzk58Drj48PJ1PPn3/AJqZ9FP67oV9Fyzl
UXjsN/vqad4r/eQ1o85KHAt8eTDz4/D4iqaI0pU0JiKeJou1SlNSjwunsfFPY1vWRbNucurtt7R8
Mtalgei1KnQj4ulUeHjCHCNtdLs1Tz4cvo9fxh+DEeWo/wDIxaIcdtfR7uuLw9WWf/Juo0+SqPgd
+L8Xh9qfD8mkV0M0vT0Ri14//iatGVGuv+NVMpPrjlNfaihZtMMtUro3gl6OVNGdKaWFq+dh5VtZ
rY9WnJRkuTumnvTRnO+HbpY6z17tpVm/pKYD5RjaeLg7qEVh6i+rNLxseyUZu33ZGem39Jnnfy/U
xcn6Cv53jiNEy/5K4Xo33YileVPq1lrU/wAa4HTLx5cOn58e/wDNaouExVTRlWFWm3GpTmpRe9Si
7p9jRpzl0q4+EHBw+VRxtBWoY6CxEEtkZSbVWH4aikrblYzi31J537/KQ50Z/wAjFoevhXnWwMvl
NLi6U7QrxXJPUqdkmS+Ks+1jr3ef7IrnQ7Tq6N46jiJrWpJ6tWP1qU1q1I9sW+2xqzbGGXbSgdLd
Avozjq2EvrRhPyJfWhLyoS/FFp9ol2Z49t0LPp3/AJGLQ+Fxqzq4R/JK3HUznQk+Vtenf7CRmeK3
l9qS+7x/YIF4NcRDEYmpo6q0qOkKToNvZGo/Koy7KiiupsuX5J0ude/w1VBr0Z4GpKEk41ISaa2N
Si7PtTNOfCuheEiK0rLDaWgvJx1FSqW2KvS8isu1pT/GYx9zt1PPn3/mkK6If1/o3HaLec4xWMw6
+3RVqsVxcqbbt9hC+LtMPMs+cKpHR7TVTo5i6OMpefRqRmlxs7tdTWT5M1Ztzxy7btVg8Iuhaehd
JVVQ/wCJ62rXoPc6VZa8bdV9XrRMbtrqY6v8UiZn/wAjH0eT21tGVrP/AJt8Q8uvVqK3JTJxfi17
WPwv8KerlxtxaJsAaCjADADQQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAbAMCjADdg
DYQbAMAMANhRgAqxEGWAP//Q9RWPa+E/KxlgDLAGWANWAMsAasQGAGAGAGgDADLAGWAMsAZYAwoM
CDADRAYAYAYAYAYQGAGAGAGAGAGAGACWgDVgDLAGgDADADADADADADADADADADADADADQBhQYEGA
GAGAGAGAGAGAGAGAGrAGWAMsRRqwBlgDQBgBgBgBgBgBlgDRQYEGAGAGAGAGyKNlAoIMAMAMANgG
FUYAbIDdgg2AYAYAYUGAGwDAowAwA2AbSIjLZQYAYAYAbAMCjADEAbAMAMAFBBgBsKNgGAGAGFBg
AsgMAMAMANgGFBsKMAFEQYAKQUYAYAbQAsAwoNoigiYAtMAImALiwoImALTACJkAtMKCJgC0wBad
gAiZFC0wAiYAtMAJFhQaLADRkAGjIKDRkQBVIALGQUGjIANGQAWMgoNGQAaMiKCpgBVIAKpBQRSA
CKQUFUgAqkQBFIKCqQAWMgoWmAbuAKTAFXAN3ANpkAq4Bu4UKuAbANpgCrgGyAUmUCr3IDADADAD
ADVwBNwDQBgBgBgBoqDCA0QGXKBIUYAaKgwAwgMIDADQBpsqDVyg0FGAGEBgBoAwINAGAGAGXANX
ANgGwDAo2AYAbTAFXANkBgBgBgUbAFJhBsKFJ2AFXANgC07gGwBSYUKANgCkwBQUbTsECwowAWnc
A2AKRAKKDaIBSKDZAKRQKAMANkUYAYAbRVC0RBgBgBsKMANMIE2ChIQaaAElBogEtWKBIBpoASAa
CBLQAhooBtXABtBAJoAG0ADaABtBANoAG0UA2ggG1YAG0EA2gATQANoqATQANoAE0EA2igE0ADaC
AbRQDaCATQANoAG0EA2igQ0ADaCAbQAJoAE0EA2gAbQANoAQ0EA2gAbQAJq5UA2gAbQANoAQ0VAN
oAQ0AIauAJAENWAENXAEBAhoCwloCkMAQ0UCGgBDQAhqwAhoIENAagbQFIaABtAA2ggQ0UA2gNQh
oChtAA2gAbQQJaAQmwGiWgBIAloASUajTRBSSgS0QCCosaaINEFAloATYCwhoCtABEALQAuJFBEA
FiwBxFhQeLIJR4sKg8WAHiyKHMGAOYMKHMWRWDmLAHEWFDmDIBzFhQ4iwMnMGFQ5gyKHMWAOIMKH
MWBk5gyKHEWAOIsKDxZAOIsKzTiLAg8WFDiLADxZFDiLADxYVk4iyCDxYUOIsAcRYUHiyAPFhWRk
AFTACRYUFTIAqYAVMKCJkAVMAIFG0ECgo2ALAMACLMIMCjYBoAwIEsASAaKgSwAbABNAA2ADYQDY
AGSAG8kVACSAASQQAkgAEkVA3kgAEkEAJIABJFQN5IAbzQQNpoqBvJFA2mggbyQQNpIqBvJADaaK
gbSQQNpIoASQQAkgAMkAAkggCwAbRQDaABhAhoA0AYAaaIBJQaANNXCBIUaAMaCBABoKNNBAgKNB
BpoASAaCDTQUaCjQQS2gcb82YuhX2eLq05/wyT9xK1jdUekP6R+BvHB11udSD7dVr2M5dN7PpU4H
lg7vAMAPT/8ARvxlpYyi96pTXZrJ+1HDqPd9FvI8/dKMH83Y/E0fqV6kexSaR1jyZzVvxECVgYAe
u/Cn/XHRfDYjbZYap/FDVf8AiPPj4r6PV84S/AeQ7HofPGrAHafAJifk+mVH+8o1I91pf5Tn1OHp
+j37XyET4acN8m05ieEvFyXbTjf1plw4Trz7VHKzbzjLAHrzo1/WHQqpDa4UcR/LOU16rHC+0+hj
5w+VHkI9D5wwAuHg+r/JtL4KX/dRSX8UkveYy4denfM+I67/AEjqGrjMLU+tRlH+GV/8xz6b0fSe
Z8B5yOzxjRAetf6N9W+GxcOFSD74te449R7/AKNxR5XxuHeAqyS9GTSfU7f6o7beG+ACpBTWtH8S
4fl7Hk9zdQbi/lCUX5y2PjyfufZstYD114cZKroTCTkrp1aV+KvSm7rn/ocMOX0Ov7M/foPIMovD
yTT5prev1t7Ud3zwurBVFrx2b1wfwe7hs4Ngdz/o9176Vmnt+TTSfLWg7P3d3C3LqcPV9H5+QqXh
Zl4nTmMi84uULrrhF3XNX9q2NmsOHPre1RzacHh5Jp84tepr9ZPLabcdBVWCqLXj+JcH8Hu4bOFy
D1zoKDxHQhrf4mvbsrTPPfafRx/tv5X8x5CpVPFOzV08mv1v4fDI7vnDc4vDSTi+cZLLqa5+xg4F
/wCgsVidLYKvBJP5TSVSK3NyXlJfVlyyUssk43zlw7dPzZ8R1j+kHTji8bh6Lspui3Tl9rWfkvlL
c90rbE5Mx03o+kebPgPNmDxTwM3dXi04zg8rx3p8HvT3SSe1HZ4pdLGY7CfJJLVetCS1oS4x9zWa
a3NNXe0FivXX9HrFLG4fFVH+8c6aqP6zSdpdb9Li05X8qy4dR9D6N5lSvLEK0cXOph6jSUpylTk9
kJt73ujLJS2WtGWyNn2eDnwqLw9apoqre1pwbUoyW3dKMlwaumuFwkugvSeDjh2qlK7o1FeDe1cY
v7UXk9l1aVrSRYtg9c+GfDTq9HcMoq+rOi3nnZUpXtxttfBJvYmefDl7+tPsz5fkkeS9FYqEdahW
dqNW13t1JLzZ9l2nvcXJLNpr0V4IppKNXQ9f6lWlK6a3NO6aexrensaz2DlOB3zwKYONbTMMVRVq
c6NW8VshNaqlDqzUofZaV24yOWfD1dCfa39yVF+GJrTel8XQ/tqKhKl9qCpQlOHWs5x/Gs24oYeI
nW85X9+hHHNEY9YCo/GJyozWpVitrg+H2k0pRexSS3ZHSvPjdKDpPAS0ZVdNtSSs4yWyUWrxkuTT
T4rY8yws0PY3RvHvGdD8RXkrTqUMVrtelK0ouXXK15fabZ57y+hjd4X4VHk7QrWk4SwMts3rUHwq
2tq9VRJRf2lBt2TO9eDHz4VEaOx09E1o1Ypa0XnF7GnlKMlvTTcZLem0LGZdC26L0TClpbBKjd0K
9ehKk3m9WVRLVf2ou8JcXFtZNE34dJPM++wd6/pI4P5bDDSi/KoRqTlDfqTcIuS5Rkop/eT2JnLp
vX9Jm9JHmfo9jIU5yw9d2oYhak39R7YVPwSzds3Byj6R2rxY/mqKxOHq6HryhK8KtKdnZ5qUXua5
7GusvLFmh7C8A2GhjamL0jTSSrxpKcVlq1U5uqktyfkzjuSmo+izz5vo/R5vdSvPmma3+0tbHYd5
1YYjEV6HNOTdWn2xWvFcYNLOZ1nh5Le7c++2Ko+g9KfM2IjVa14ZxqQ+vTktWce1Nq+52e1G7NuW
N0M09or5nxEqcXr03aVOf16clrQl2pq63O62oS7Mpoeuun854foXQjK7cqGDUn/BLPtVjhj7X4vo
dT2PlEeWeitWOLdTAVWlTxSUYt7IVo38VPkrtwk90Jye47V4cPPj3/mqt06lXRNZSV6dalO63OMo
v2povLHA7v4PdFwxnSPA4yjFKhiVVrKK2QnGnNVIfhn5q+pKD3nPK+Hq6c3lL70WPw7yh0gxdXDJ
Lx+DowrQ4ypv97Hm4rVqLhFVCdPw39I+1de6Eed+jOlo6FxMalROVGSdOtBelSmtWa67O8eEknuO
tm3jxvbVNdP6IloLE1MPJqSi/Jktk4Na0JrlKLUlyYl2ZTV0Pa/gd0wq2gquNlG1WClGpP6/iaaU
ZdeooxfFxb3nnznl9Lo37O/34SvI/Q2a0l43Rk3li0vFN+jiIXdJ/iu6b5TvuO9975+Hnx7/AM1V
LC4mpoutGrBuFWlNSi98ZRd12po1y5y6Fp6X6NjWxNPE4eKVHHRVWnFbIyk9WpT/AAzUkvs6r3mZ
XTOedz1aj1n/AEgdGfKdD06FN+VQkqyjvlCkvFyt93xik/spvccOnfL3/SJufv8AfqzHjnolpmOg
8ZCpVWtQlenXj9alUWrNddm2uEknuPRZt87C9taM+kWhpdH8XVws3fxcmlJbJR2xkuUotSXJiXaZ
TtuleqfAbh49I8VS0m86tDCzw1fi5QdNUZv71NuN+NN8Thn48Pf0PtXf3aYqjdKceukXSDSmjZvy
cW1Tp32LEUIpUn2tSp/8hGbniSuWd7srPf8AnFee8PiKmjqsakG4VKclKL3xlF3T600dXjnhpcfC
DhYTxMMdRSVHHU1XilsjOTaqw/DUUkluVjOLr1Od+/ykH0X/AMjDoevhXnWwMvlNLj4qdoV4rknq
T7JMnFWfamvd5/siA6HacXR3HUsRNa1JNxqx+tSmnGpHti322NZTbGGXbSmvSrQT6N42thG9ZU5t
Rl9aDzhL8UWpdol2Z49t0qz9If8AkYNE4THrOrhn8jr9UU50JP8ADrQv9hEnit5eZL7vH9hA/BvU
WOrVtF1GlTx9J0o32KsvLoS/jSj1SYy9/uOn58e/8/Qrn/l4KpvjUhLqakn6mmaceG3QPCVSjjq9
HSdNJQ0hSVZ22KsvIrR/jTl1SRnH3e526vnz7/z9UgvR3/kYND43APOphmsbR6o+RXX8LjO32Lkv
imPmWe7z/ZKqXRLT0ujGPoYyOfiqicl9aOyce2La7TVm2cMu27W+Trp1oGPRrSNfDQzpKWtSe50p
pTpv+FrtGN2nUx7bolWPSv8AyMWgcNidtXAVXhqnHxVS9Si3yUteC7DM8X4t37WO/d4Q38FuMh8v
eCrO1HH054Wb4Oovo5damotPcXJOlfOvf4KoGNwc9H1Z0ai1Z05ShJcJRdmu9GnKzSmwFYAJsAaC
jADADQQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAbAMCjADADaQBuwQbAMAMAMANhRuxEGyg2AYAf
/9H1Iex8N+VjADADAg1YAywBgBgQasAZYKMsAZYAywBqwBlgDLAGWAMsAZYAywBlgDLAGrAGWAMs
AZYA1YAywBqwBgQYQGAGAGioMAMAMAMANWAMsAZYKMsQGWANWAMsAZYA0AYAYAYAYAYAYAYAYAYA
YAYAaAMKgwAwAwAwAwAwAwAwAwA1YKMsQGrAGWANAGAGAGAGWAMAMAFIoNhBgBgBsKMKDADdiAUE
GAGAGAGFBsAwKMAMAMAN2IBQQrCjLADADADYBsKMAMAMAMAMANoA2EGwDYUYAYAYAYUG0AKIDADA
DADYBhQbCjABREGAG0FGwDADABaANlBgApMigiYAtMAImALTuFBEwBaZALTACJhQtMAImALTAFph
QRMgFpgBEwAkWFBoyACqQAVSCg0ZEAVSADRkFBoyACxkAGjIKCxkAGjIgCqQUETACqQUETACphQV
MAImQBUwoKmAEUgoImAbAN3AFJkAq5QbuFG0yIFXANhQpMINkUbTKBSdwDZAKTAFXAMAEtgCQDAD
ADADADRUGEBogNXKo0AYAaKgwAwgMIDADVyoE3ANFUYAYQGAGAGgg0AYAYAZcA1cqjRAauEGXAFX
AN3ANgGXANhRgBlwBWsAbuAbIDADAoUmAKAN3AFp3ANgCkwBQBtMKFpgGwBSYAoKFJhAoKNp2AFg
GEAtFBsgFJlAoA2RQsqDADZFGAGAC0UGyAwAwA2FGAGAGggS0VQkiDTQAkoNACWgBIBpq4AkA0EC
WigG0ADaABtBAJoAG0ADaCAbVwAbRQDaCAbQANoAG0EA2gATQANoqATQAJoAG0VANoAE0ADaCAbR
QDaCATQANoAQ0EA2igG0ADaCATQANoAE0EA2gAbVgBDVgAbQQDaABtAAmioBtAA2gBDQANoIENFA
hoAS1cAQAIasAIauECABDVgNQloAQAIaKBDQAgAQ1YAQ0EWBtAaIaABtACGgAbQQDaKBDQGg2gKG
0AIaCAbQAmwFjVgKS0AJAEtACSjTTVyCkNWAEtXCBLVgqwloI0QUCWiASUWENAUpABIgC4kUEQAS
IAaLChxEBR4sisjxYAaJFDiLAHMWFDmLIM05iwqHMGAOIMKHMWRQ5iwM05gwqHMGQDiLChzBgDmL
CpTmDIIcRYUOIsKHEWAHiyKlOIsDI8WFDiLADxZFDiLADxYVKcRYGTiLIoPFgDiLCg8WAOIsipRk
wIKmAETCgqZAFQAWIUETACogCrMKNgC0EGBQtBBsKFRAFAG0AaAMCDRUCCKNFQaYANq4ANoAGwAb
ABNBAKQACSAASRUAJIABJBACSAG8kVACSCAEkAAkigbyQQAkggbSRQNpIIG8kVA2mgBvJFQNpIIG
0kVA3kgBtNFQN5IIASQAGSAASQAFoIBNAA2igG0ECWAIANAGAGmiASUGgDTVwBIBoA00ECQDQAlo
ASFGggS0AaANBBhAasVRoKPXfhb/AK86N4bFbWnQqN/fg0/XJHnw8V7+t5xl+A8hnofPGAHdP6Pu
L8RpWdPdUoTXapRl7Ezn1OHq+j+L8hUvC5g/kWm8XHc5Rn/HCMvay4cOfWmsqOcG3EaKg9d1P636
E8dWiv8AlFV/5ZPPxk+jz0/l+o8iHd84YAdJ8EWJ+S6cwj4ynH+KEo+8xnw79G6ygtP9ILDeJ0tC
X18PB90px9yM9Ph0+kc/IcLsdXlGBR688EH9Y9G8VR+1iIfxU0/8×58+Xv6PnG/MeQj0PnjLAEx0
dq/J8bh5/VrU33STJWsfFnxHov8ApJ0f+IZ/75P/AJRte85dJ7PpXp8x5bO7wDCA9R/0bKueOh/u
H/ysv7jj1Hv+i+vy/UefNPpYfG4mnLzVXqrqak1dfDfs4NdY8eXN+IhmpYaXse5p+7/R5hkaq001
rR2b1wfD4P3gHrnwrU3jejOFks3+zy6/o38Thjy+h1vOE+Q8i0pq2pLzdz4Pj8fikeh88J8rCy9v
Bp+1P80Adt8A0VDTKcfNlRqdnmuz/Waz5Ln1OHp+j+18hC+Geipacxer5y8U2uK8VB3XVv5Z8S4c
M9f2r+/QcupTU1qS2bnwfwe/v3We3AIjJ4eWa5NPfxX660AevNAKL6FVFHNeJxFv+Tk2cL7T6GPs
fKjyPP8AaFrekvO5rj18e/PO3d8/kJpSU1qSyW58H8HsfDbuswLf4OZzw2mcGlk/lFOMly1ldNfq
zV9qM5cOnS8ZT4jq39JFP5bheHiZf4mc+m7/AErmfAcHxC+coOsv3kLeM+0tin17pc7Szcnbq8vI
RgairxeHqNKMneEnsjPnwjLJS4ZS9GzpPc09Uf0caMqGHxkZJqSrRTT2pqLumcOo9/0bipXlfTGG
VKo5wzpVG5QfbnF84vJ8cpLJo7x4Moolf+tKXjf7Wkkqn2obIz61lGXLVeb1mQvkD0ZWjUTw9VpQ
qPyZPZCe6XU/Nn9l3s3GIqT3D1p4c8TPRmiMG45ShXp5PNZUppprenezTyabRww5fQ691J8f0SPI
+lcJGk41aX7mrdw36rXnQb4xfa4uMrLWPRHgqnL/AK3w9/7ahHPjOktj5uGzf5DWxU2ThefkOx/0
cqkvnStBPyPk0pNbrqcEn1pSaXJs59Th6Po3PySqX4V8VPD9IMVUg3GcKkHFranGMbNdxrHhy63t
VYpmmcPGpq4qkkqdW94rZCovPh1ZqUfsySu2majnlPUHw6+eMM6P9tQUpU/tU85Th+HOpHl4zfqo
nCzzPgPVfR2VPAdCk6yfi3SqqdturOrJNrmk7q+V7HG+09+PjD9+9Hj3SOBloqtKlJpuLTUlskmr
xkuTTUlyaPRy+fZpUvptLSdOOOjtm9WuuFW19bqqLyvvKokrJEi5efIuHgpqQ0hpDC4Sq84YiFai
+EotOceqUY3+9CK3szm6dHzZPvHSvD9pd6L0rhJJKSjQetB7JQnKUZRfKSTXr2mMJ4dvpGWrPgke
c9N6NWjKzjBuVKSU6Un6UJZxb5rZJbpJrcdZXkymlSWkP66wkMSs6tDVpVuLha1KfYl4uXDVhvkJ
4avmbHpf+jPR1cLi57nVgu6LfvOPVez6LPFSvKU8bVwOLdeN4VoVXJcYyUr5rk9x308G9VT3pLg6
cKkcRQWrQxEfGQS2Qd7Tp/gldK+bhqy3ki5T194dUv67wDhtrYO8o8ZUJPyl+Cb1kuE5vZEcL7U+
H5D114VMdS0FofB4ev8AuKs6VCst6h4qSckuMGozivrRRww819Dq3txk+X8GXiXSmjqmh69TD1PP
pycXbY7bGnvT2p700z0cvmWaaWHpMvnenS0ks3V8ivyrwSvJ/wC8jqzvvk522GZ4by8+f3sdd/o4
4t1sfUw0leMKcq8H9WXk05JcpKSvzhEx1Ho+jXzr5pVX8KWn56N6UV8TC0vFTprVeySVOMZRfKS1
k+TZrGeGOrlrLf74WOa9J9FQ0TiZRpNuhNKpRk99Oa1o35peTLhJNbjcu3HOaolcd/XujadfbWwb
VGpxdGTbpS/C9am3uTponFW+Z8PyHqrwbYGNPog4SkqfyiGIjrvZF1JypRk+SyfUcMuXv6U+x8d/
2EeJqtKpo2q4SvCrTm01scZRftTR6XzeFWvprTWNnS0jTSUMZFzklsjWi7Vo/wAXlpboziZx9zfU
8+ff+fqLV4MsOulEqWj5+fRxVLEUb/Uc4xrwX4VGpb/jcuJnLw30vtePvl/sjs3h66S/MektGtrW
hTjWdWH16dXVhOL64qS7Tn05t6fpGWrPmR5U6TaG+YMXVw6etCLvTn9enJKVOX4otPtO8u3hyx1d
Np/Tf9e6Nw+NWdXDtYWvxsk5UJPripU/+Qa4knitZeZL7vH9hHfP6LeGaWPq+i3RiuteMb9q7zl1
Xr+iTn5M5PNHSTSVSelMTiYtxqPE1Kie9Pxjku46zh48r5397SU6f4eFbEQx9JJUsdTVdJbI1G3G
tDsqKVl9VxGK9SevvIPov+v9EV8K86uCl8ppcfFTtCtFdT8XPqUmL4pPtTXu8/2RA9DtNx6PY6lX
mtaldwrR+tSmnCpHti3bnYWbTDLVKa9J9CS6OY2thJO/iptRl9aO2MlylFqS5Msu0zx7bpVm6S/1
7ozB6QWdSj+x1/wLWoyfXBuF/wDjZmeK3l9qS/JCfB3JaSniNFS83HUnGF9ir0/LovtknDqmy5e8
6fnx7/zK59RrTwNSM4NxqQkmnvUou67UzTlPCr14SsPCri4Y+kkqWPpRxCS2KcrqrHsqKfY0Zxde
rPO/f5MTjRP/ACMGhMThXnVwM1iqXHxc7U6yXJPxc+xi+KT7WNnu8qr3QjTq6N6RoYmedJS1aq40
prUqLti32lym2MMu27Ww16W6BfRnH4jBvNUqkoxfGO2Eu2LT7RLsyx7boi19Jv6/0PgcftqYdywV
Z8oeXRf8DlG/2DM8V0y+1Jfd4/sJGvBhNaQr19FzfkaQoTpRvsVaP0lGX8UdX8Qy9/uTpefHvhXN
oynhJpq8Zwd1uaaftTNuPDTpHhSpRxmKpaSppKnpChCu7bFU8ytHrU4tvrMY+73O3V83fvm2Y5kb
cWmAGAGACbAGgowAwA0EGAGAGAGAGAGAGAGAGAGAGwDAowAwAwAwA3YA2EGwDADADADYUYAKsRBs
oMANhRgB/9L1LY9r4T8rGWANAGAGEUYAYAYAYEGAGAGrAGWAMsAZYAywBlgDADQBhEGAGAGAGAGA
GAGAGAGBRlgDVigzVIDWqAJCDADADADADADVgDLAGWKDLAGBBgBgBgBoAywBlgo1YgMsAZYAywBl
gDQBgBgBgBgBgBgBgBgBgBoAwoMCDADADADADADADLAGrEUZYA1YA0AYALKgwAwA2RRhQYUG0iAU
EGAGAGAGFBsKMAMAMANgG7EBsIMKJWARgBsAwKNgGAGAGAGAGAGACkEGAGwDYUYAYAYAYUCokBsA
wAwAwA2AYUGwowAURBgBtBRsAwAwAUgBQBhQbRFC0ALTAFpgC0FBEAETAFpkAtMAImFC0AEWYAtM
AWmFBEwBaZALTuAEiwoNFgBYsANFhQaLIAqYAaLCg0WAFTACqQUFjIAMpEARMKCqQAVMKCJgBUwo
KmAETIAqkFBFIAImALTChSYAoA2mAbuQCrlBu4ApMgN3ChVwDdwDYAq4Bu4BsgN3ANAGAGAGAGAG
ioMIDVwBIUYAYEGigwAwyDADRQJbuAaKDADADCAwA0EGAGgDLgGrlBoKMANXIg0AYAYAYAbuAbuF
G7gG7hBsA2FGAGAG7gCkwDZAYAbTChdwg2FCkwBQBtMAWAbTChaYBsAWmAbChaYQbCjadgBYBtMA
WAbIBSKDZALRQbANkUYAYAKiUCiAwAwA2FGAG2gDQBoIEtFUaIg1YARYoNACWgBIBjVwBABoAQ0V
ANoAG0ACasEA2gAbQANoIBtAA2ioBtAA2rgA2gAbQQDaABNFAJoIBNAA2ggG0UAmgAbQQDaABtFA
JoIBtACGgAbQQDaKAbQAJoIBtAApIAG0EA2gAbAENWCAbQANoAG0ACaKgG0AIaABtACGggQ0UCGg
BLVwBAANqwAlq4QIAENWA0S0AIAENFAhoAQQCGrFQDasBqENAUhoAG0ADaCAbQAhoosDaA0G1YAQ
0ADaAEhAloDRIAloATYA00BSGgNNACGrAGmrgCGrAaJauEUgoEtEAko00gBcQAkSKFoAIgAsWAOI
sig0WFZOIsANFgDiLIocwYA4iwqU5gyKycwYA4gwocwZAOYMKlOIsDJzFhQ5iyKHMWAOIsKU5iyD
JzFhQ4iwBxFhQeLIBxFhWB4sAcRYUHiyAcRYUHiwBxFhWDiLIA8WFDiLADxYUOIsglHiwqCxYAVM
KCIAKmQBUwoIgAqZAFiALCjaCBQUbQQLCjYAsAwA2AaAMKgQyA0AaKgQwAbQAJoAGwAbQQCaAAyQ
ACSKgBJAAJIIASQA3kioASQACSCAEkUDeSCAEkAN5IIG00VA3kigbSQQNpIIG00VA3kigbTQQNpI
qBvJAAJIIASQAGSAAyQQBaABtAA2ioEACWiASUGgDADTRAIKDADTQAkA0AaaCBIUaCBLQAkKNBAl
oA0AaCDADCKPXNP+vOhTW1wov/lDU+Ee44cZPoc4fL8qPIh6HzxoKOm+B3F/JNOYV7pOcX+KEkvX
Yxnw7dG6ygsPh+wnyfS6n/eUIS7nKP8AlJ0+G/pE8/IcROjzDAD134Of6z6KYmjt1YYmC63FyX+I
4Zcvf0/OF+Y8iHd88YAWvoJiPkulcHPhiKSfU5pP1MmXDfTurPjB2T+kdh9XFYSp9alOP8Mk/wDM
cum9P0meYPN52eIYQHrj+jvNVsBiqT2eOT/igl7jh1H0fo3FHkipTdNuL2p2O754RYoC4er4icZf
VafcwsHrH+kdS18LhJ8Ks13xv7jh03v+k8QeSLHd88aCD0n/AEb6lsTi48acH3SfxOPUe36NzRxb
pzT8VpXGr/uprf45HXHh5upzfjRXaVRNastm58H8OJWBpN4aTT7Vua+G9Pqa3AHrjwhPxvRHDSjf
KnhGuPmxXvPPjy+h1PYnyHkqa8etdecvOXvXvW557HZd3zxqm1WWo9vov3Plw4Pk20B17wDydPTU
Y7L0qia6kYz4ej6P7QYeGyLo6exElk2qTT/5BxXuGHCdf2vw/IcsqwU1rx2b1wfwe7u3XfRwCo/t
Kt6aWXNcOtbuWXBA5HrfopFS6FVFLJeJxN3+OZwvtPoYex8qPIflYWXNdz+KfrR3fPCq1NWUo+a/
U+Hw4rnewF28HX7RpbBfWjXp9sU1617OrPOXDr0uZ8R1z+kFWjPHYejUdoSoZS+rLXlaXG26S4Z2
bSOfTej6Rz8h5whKpoyrstKLaaeae5p8U1k+KZ2eLgLx2GjStOn+7ndx4prbF81601KyuQsI9d/0
e8T8owOInJeUqqi39ZRgrN87Zc0k9t2+HUfQ+jXwteSMBWjWToVXaE3eMnshPdLqeyXK0rNxSO7w
SqbUatTRVa9rTg2pRa7JRkuDV01vV0XlOAXSOEjSkp0rulUV4X2rjF84vJ7Lq0rWkhFsHrf+kPhp
S0bQUc9SrrNclFxv2OSXb1nn6fL3/SZ4SPJ2iq0aqlhqrShUtqyeyFRebLkn5svsu9m4o718+e5T
KjVqaJra1tWpTk001vWTjJb08009qumCXQ9I+ATR8aWk69ekvoamGbhv1b1I3g3xi1bi1aVrSRy6
l8Pb9Hnn5JXN/Ce1pjSGNnH97h60oy+1TvZS64vyX9lwsrRbN4+HHq+bfuqqHobEQlrYaq0qVay1
nshNeZPqTbUvsSlbOxquM9wYRlV0NXvnCrSn2qUXv7UXlOB7B6TVIUuhetTjqRnSotR+rr1YtxXJ
XaXFI885fQy9j8PzR5TS+eMJbbWwyy4yot59sJO/HUk9kYHfh4eZ8PyU20FjIUZyo1nahWWpN7dX
O8Z9cXZ5ZuOtH0mKY0XvwUaMnh+kWGoVFadOpU1lzhCb271lk9jM53w69KfahVs/pG0Zy0nSqeh4
iME/tRlKTXXacX1PkZ6fDf0mefkkcjwf9c4SWHedXDqVSlxdPbVh2fvFuSVTezfDzzzPgqP0FpGO
jq30ibo1E6daK2uEttuaylHhKMWWpjdD194INHS6MaFxzm03GrWkpLZKKpQcZLlJeUuTRwzu6+h0
Z2435/kleUOkC+daVPSC86f0df8A30V5z/3kbSvvmqnA7zw8GXnz+9q3oP8ArfD1cA/PzrYf/eRX
lwX34Lrc4QW8Ux8+PwDDotiZYTG0JRSleooOL2SjPyZRfKUW4vkxUwuqPT39JvE6mHwVL61SpL+G
MV/mOPTe76VxEjzfpL+usDTxW2rh9WhW4uFn4mb7E6b4KEN8jtPDxXzN+7wrXROaxrqaPm0o4pJQ
b2RrRu6UuV23Tb3RqSe4Uw8+Pf8AmO2/0acC1jcZUkmnClGDT2pyle38hz6j0/RZ5qVy3wvYNUtL
168Ja9KvOUoS5xk4TX4Zxkuqz3m8OHDrTz8VQtP+vNGOO2tgXrR4uhUlaS/BUaa5VJPcXis8z4fk
GXRLSNPA4nUru2HrxdGtyhPLW64S1ai5xQqYXV+I9Z9NMDPon0M+S1LKoqdKDs8taVSMpe84TzXv
znbhr4fmjyz0uXzrChpNZvER1K3KvSSU2/vxcKnNylwO88eHhz8+ff8AmrOjv9c4PE6Pec4p4mh9
+mvpIr71O75unFC+Fx8yz5if8CGHliOkGE1ctV1JN8lTn7dnaTPhroT7U/foVaP6SOKdfTMIbqeG
gu+U5X9fqM9Phv6TftfJcXONKf15ouhilnVwkvk1Xi6crzoyfV5dO/CMEbniuV+1N+7x/YUjoJVj
iq1TR9RpU8dTdJN7FVvrUZfxpRf2ZSGR0/Pj3lenvANRfR/QWMxNRaso1a0nfcqVOO3qakcep5r2
fR5242/FmvMPT6jHFV6ekKaSp46mq1lsVW7jWj2VFJr7MonbF4up7/f+61BNF/17oivhXnVwcvlN
Lj4udoVorqfi59SkycVZ9qa93n+yITodpqOgcdSrVFejdwrR+tSqJwqL+Fu3OxbNs4XVKZdJNCy6
O4ythJO7pTcVL60dsZLlJWkuTLLtnLHtulWfpP8A15o7B6QWc6aeEr/epK9KT+9Tajf/AI2zM8Om
XmS/JGdAP62WK0U/+Syi/Ff7+jepS/itKH4y5e86fnc9/wCZVBwWLno6rCtTerUpyjOL4Si7p96N
OculXHwkYOEMd8qoq1DGwjiaa4eNznH8M1ONuRnFvqTzv3+Uh1hf6/0DUpbaujqyqx4+Ir2hNLlG
ahLlrsnF+LU84/D8qInwfaYhobSNKVb/AInq61GutzpVU4Tv1J63WkXKbY6d1W6gdPaHn0fxdbCV
PPo1JQfPVdr9T2rkal2xlO26F16af13gMBpNZydN4Wu/+OULKDb4ypyh/CzM8eHXPzJfl+CRng9/
reljtEvN4qg6lFf8fw96kUvvR149pMvHlen53PfP4wrnujsfU0XWp4ik7VKU4zg+EotNetGnKXSr
t4UMBDDaSliKKtQxkIYql92stZrslrR7CY8N9Wefj5/FIe4f/kYOjtSG2po3EKcf9ziPJkl1VIxb
+8Ti/Ffax+F/hT1cvNuLTADADADADQBqwUaAMAMANBBgBsKMAMAMAMAMAMAMAMAN2AMsEG7AGwDA
DADADADADYUYAKsRBsoNhRgBuxEGWAP/0/VB7Hwn5WMAMANWAMsUGrAGWIDVgDLAGgDADADAowAw
AwAwAwAwAwAwIMAMsAasAZYgMANAGBBgBgBgBgBgAiQBoAwAwAwAwAwAwAwAwAwAwAwAwAwA1YAy
xQZYIMAMAMAMAMAMANWAMsAasRRlgDLAGrAGAGAGAGAGAGAGAGAGAGgDCoMAMAMAMAMAMAMAMAMI
o2UGFBtIgFBBgBgBgBsqjADADADADYBuxEGwDCgwCVsCMCjYBgBgBgBgBgBsoMsRBoKFBBgBtBRs
AwAwAwAwoFIgNgGAGAGAGwDCqNgGEAoIMANoKNgGAGAG0AKQBsoMIBaChSAFpgBEwBaYULTACIAW
mQBEwBaYUETsALTAFphQtMgFplARMgFpgBYsKCpgBosALFhQaLIAqYAaMgoLGQAVSACphQWMgAqk
QBUwoKmAFTCgiYAVSCgikAEUgAikRQRSACqQAtO4UKTAFJgGwDaYAq5AbuUCrkBtMA3cAVcKN3AN
kBtMoFXANkBgBgBgBoqDRAauFGgDADAg0UGAGEBhAJbKDRQaAMAMAMIDQBgQaAMuAJuVRgBgBq5E
GgDADADADADADADADYBgUbuAbuECrgGwowAwA2mAKuAbIDaYUKTCBQUbTAFgG0wBYBtMKFgGwBaA
NhQtO4QbChSYAoAWmAbIBSYUKKg2iKFlQbIowAwAVEoFEBgBgBsKNlAoiBLRVGiA0ECSqNEQasAI
sUGgDTQAkA01cAQAaauADaKgG0ADaABtBAJoAG0EA2rAA2rAA2ioBtAA2gAbQANoIBNAA2ioBNAA
mgAbQQDaKATQANoIBtAA2ioBNAA2gBDRUA2gAbQANoAE0EA2gATQANoIBtXAENACGggE0ADaABtF
AJoIENAA2gAbRQJaIgQygQ0AIaAEACGrACWgBARYQwKQ0AJaABtACWigQ0ADaCBDQGw2gBDQANoA
G0ECGgAbRRqBtAUhoAG0AIaCBIUJaCNEhRpoIENAGgLCWgNEhAloKEtXAENWCNktXAEFAlogQko0
VEgFoAIgoIgBcQA8QoPFkGR4sKDxADxZFDiLAHMGFDmLIMHEGFDmLChzBgDmLIocRYGDmLChzBkA
4iwocwYUOYsDJzBkUOIsAPFhQ4iwBxFkVmjxYEOIsKDxYA4iyKDxYA4iwrNHiwIcRZFDiLADxYUO
IsAPFkVkZMAKgAiCgsSALEAKgoIgAqIAgUbAFhBgUEQQYFC4gGwDYBoAwIEsoEkBoqDTAByABSAB
yABsIBSABSQAGSAG8kVACSCAEkAAkioG8kAAkggBJAAJIqBvJADeSCBvJFA2kggbzRUDaSAG0kVA
3kggbTRUDaSAG80VA3kggBJAAZIABJBAJoAE0ADaKAbQQJANNEAkoNAGACWgBIBgBpoAQAYAJaCB
IUYECGrAGgDQAkKNBBoqDCA9c+CP+t+jmKw22zr07cp00/8AMzz5+K+j0fONnxHkY7vnDQUWnoRi
fkWlMHU3LEUr9Tkk/UTLhvp3VnxHaP6RuF1cRhKv1qdSP8Mk/wDMc+m9X0nmDzdY7PENWAPXH9H2
SxejcVh3s8c/54RX+U4dTl9D6P5lHkiUXBtPasju8ASASOiK/wAlxNGp9WpCXdJMlWcj0z/SQoa1
PBVOEqse9QfuOPTe36TOPmPKp3eAYEHqT+jdWvHGw4Oi+/xifsRx6r3/AEX1+Q836eo/JsXXh9Wr
UXdJo6x4suRFBkYAeuvDv+0aFwlT/j1P+alN+44Ycvo/SPZnx/QeQ7HofPGWAPQv9HOpbH4iPGhf
unH4nLqPZ9G5+Q5d4SKfi9MY1f8AH5vvdzePDz9WfavxFJNOQc05KqtSWVvNfDl1P1PtCj1x0uVu
h1HXWyjhU1vycV3nCe0+hn7Hyg8iyTw0k0+afFfrJrsZ3fPG6sE1rx2PauD4dXD8gDsPgNmq2mqb
fnKnU7Vq+1etc1nzz4en6P7QD4a5J6crwlscaVnwfi4+rj37hhwnX9ocii3hpNNcpLjy/W/M284y
rT8U04vJ5xf63r9ZWCaHrro9Nz6F1JWtejiP8c0+84X2n0cfY+VHkemvlC1PSXm/8H4c8t+XofPA
6M1DKXmvb8VzX5bGDYuvg5ounprBr/j0Hdb1tuZy4del7U+I6Z/SOT+X4d7vEf55GOm7fSefkOF/
8xCn/wAdpx/igvfFfycFDPq8vIHga0WnRqO1Ods/qyWyXulxi3ldKwg9aeASjLA6MxmurSjXmn1x
px/XA8/U5e/6PNS/EeSdIYaNNqpT/dVM477PfFvjH1pqVlrHd8+xo4rL5yo+MX72kkp/ahsjLrWU
ZctV5+UwvINoGUcVOOFqO0ak46jfozvZPql5suyTvqpCrj58D1B/SHx8sBTwUo2f0lW6eyS1UnF8
mm0+TOPTe76TdaSPJ+k8JHDSUqd3Smtam3ts8rPnFpxfNXWTR3jwWKd4v+tKKrr95TSjV5x2Qn7I
S56jzcmQvkehP6NU5SqYxejGNNpcHJyvbr1VfjZcDl1Hs+i+qVxLpRpGWE0zi68Un+1V7xeyUXOS
cXyabT5M6Th5cstZX41Vc0tgo4Kp9G26U0p029ri9z5ppxlu1ovcajNmg9xv9a4eOIX7ylq06vOO
ynPuWpLmot3cyLfM2PWvS3BKfRTC4VvVlVo4WEP95qqSX4nHVvsV7vJHCcvfnPsSfBHjbR+Mnoqt
GrFeVB5xexrZKMlwavGS3ptHevnS6U401gI4Krend0akVOk3t1Jbnzi04S+1FiGU0O5eBKmtM6Sw
+Iv9Lh6c6dTjKOo405divTe5KNPfI558PX0PN37koHhVxS0lp3FYCb8mpGjGm3sjWVNSg+SlrOD3
JT1n5qGPCdW7ys+H4jhOCxdTRNaNWGVSnJOzW9PY1w3NParo68vLLpT3pBgYYSqp0f3FaKqUt9ot
tOLe9wkpQb3uN9jJFymh606JYqVDoVVqTebw+JSe+15wj3WSXJJHC8vfhfsfKo8p9Ga0as54Oq0q
WJShd7I1E70p8rS8mT3QlM714cb6e9UJCdXRFdSV6dalO/BxnB+1NF5Z4HRtD6Lhi9N4CtRjahiq
9KrGK2RamvGU/wAMlJLfqar3mbw64zeU++wdl/pGYeOkvFRi/pcNTdVx406klCT64yjDLhKT2ROX
Ten6T5+SR5p6MY6nha7pV3bD4iLpVXwjJq0/wSUZrjq23navHhff6qhsdgqmia06NRatSlNxlylF
2yfsZeWLND234DoU8dTxOko2vinS8avq1aakqn8TfjOSnbcefP3Pp9Dzu+9K8rQxX+1GHxVJ51ac
6mKo8XFv6aP8OrU5KnLeztw8G+6X8f7Kq30b0qtC4qFWa1qTvCrH61OacZrr1W7cHZ7i3yxjdUN9
O6JloTFVMO3rakrRktkovOMlylFqS5MsuzKauh688Puto3QGFw+d/G0oSf3ac/ekcOny+h9I8Yyf
D8kjzD0V/rajiNGvN1Y+Nof76im0l9+GvDnJx4Ha+94cPPj97iqxojSdTQmIpYml59KcZrg7O9ny
exresi3yxjdeR6X8DvR6nhOkdapRX7P8mdeg/sVnDVXXFOUX9qLOOd8Pb0cdZfLf4pVa8NtePSTE
YivBLxmBrqhO2+lKN4S7KiqJv7UUaw8Mdf7V+F0scv6C141sRLBVWlSxsHQbexTbTpS/DUUbv6t+
JvJ5+nfOvf4aqn1IVMDUcXeFSErPc4yi/amaY4V7t0rpWFLohWxkI6jxOHlOov8AjmIerNrk5Sdu
R5pPL6lv2N++fm5+ryPov+u9E4jDbamEksTS4+LlanWS6vo59UZM73xXz55mvd5/stofodpiOg8d
SrVFei24VlxpVE4VF/C3bnYZTbOGXbSo/pFoaXR7F1sJN3dKco3+sk/JkuTVmuTLLsynbdKtHSn+
ucBgtIrOai8LXf26KXi2/vU3Fc3BknhvPzJfl+CM6Df1tTxei3m8TRdSiv8Aj9C84Jc5R14c3JEy
8eTp+dz3/nCqPo3SFTRNeniKTtUpTjOL+1Fpr2G+XKXXlVo8Imj6eD0hOrRVqGJjHE0fuVlrW/C9
aHXEzi6dSavx8/ikPZf19oFPbU0dXt/yAxH/AAakezxhOL8V5x+F/hQy8G+OhhdIwo1nahi4zw1X
7tZaqf4ZasvwlyTpXz8fBVO0jgJ6LrVMPVVqlKcoSXCUW0/WisWabi++EH+tqeC0qtuKoKFV/wDH
sPanNv70VCf4jOPudOp51ffP4xI30P8A660dpDRrzkoLF0V9uhlUS5ypyl/CW+DDzLPn+BVO6OaZ
n0dxlDGQ86jUjO3HVd2u1ZPrLZtzxy7btalvCFoWGgdJ4ilS/cyl4yi1sdKqlOFvwyS60TG7b6mO
qROaS/r7o/h6+2pgK8sPPj4qtepTb5KSqRXWicVq+cfhdJ6heCrEQnpB4Kq7UsfSqYWTe51F9G+t
TULDJOlzr3+CudYnDywk5U5q04ScZLg07NG3GzTQIBgBgBgBgBgBqwAmwUYAYAYAYAYAYAYAYAYA
YAbsAbsEGwDADADADADADADYUYAYAKSCDYBsKMANpEQKsUGWAP/U9UHtfCflYwAwgMAMAMAMAMAM
AMANWAMsAZYAywBliA1YAywBlgDADADLAGrFBlgDLAGrAGAGBRhAaAMsEGWAMANAGNBBqwBqxQZY
A1YAywBliAywBqwBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBqwBligwIMAMAMAMANAGWANWIoywBlg
DVgDADADADADADADADQBhUGAGAGAGyKMKDaAFBBgBgBgBsKMKDADADADdiAUEGAGFBsAwKlbAjAD
ADADADADADdgg2AYAZYAwAwAUFGAGAGAGAGFAsgMAMAMAMANgGyqMANogNhBgBsA2FGAGAG0AKRA
bKDCg2iKFhApMKFoAIswBadwoImALTAFpkAtMKCJgC0wBadgBaYULTIAiZQLTIAiYAWLCgqYAaLA
CxkFBUyAKmAFjIKCxkAGTACphQWLACpkAVMKCpgBFIKCJgBEwoIpABVIAIpEUEUgAqkAETuFGwDa
YAq4Bu4Bu5AKuAbuAbuAKTAN3ChVwg3cA2RRtMAXcAwA0VAm5FGgDADADAg0UGAGEBq4BpsASUGA
GAGAGEBoIMANXANXKo0AYAYQGgg0AYAYAYAYAauAauUGrgCkyA2AYAbAMCjdwDdwgUAbCjADABSY
UbIg2FC0VAoihSYAoAUmAKChSYAoAUmALANp2AFhRgARZgG0QCyg2QCkUGyAWigURRgBgApFAogM
AMANhRtFAoiDYUJaKBJAaCBLRVGrEQaAE2KDQAloASAaauAIasAJaABtFQDaABtAA2ggG0ACaCAb
QANoAG0UA2ggQ0ACaCAbQAJoAG0VAJoAE0ADaKgFJAA2gAbQQDaKAbQQCaAENAA2ioBtAA2gAbQQ
CaABNAA2ggG0AIaABtXAENBAJoAG0ADaKgG0ADaABtACGigQ0RAhooENACGgBLVwBGwAQ0ECGrga
IAEtACGgBDQAlooBtXAENBFgbQGiGgAbQANoAG0ECGgKG0UaIaABtACGgBDQQJCrGmgikAGmgBLQ
AkDUJaApIAloAS1cCwhqwGiWrhAgoEtEGoxAC0UBCKCIAWgAsQoPEDNHiRQeIAeJFB4sAcxYUOYM
gzTmDCocRYA5iwocwZAOYMKzTiDCocwYA5iyKHMGAOIsKzTmJAOIsKHEWFDiLADxZFSnEWBkeLCh
xFgB4sihxFgB4sKlOIsDJxFkUHiwBxFhQ4iwA8WRUo0QIKmAFQUFRAEQAWIAWIUFiQBIgCgoUgg2
FCohAoKNoIFhRsAwA0AaKyEkUJCDCgGwAbQANoAEwAbQQCaAAyQACSCAEkUDeSCAEkAAkioG8kAA
kggBJFACSCBvJBA3kigbTQQN5IqBtNADaaKgbyQQNpoqBtNADeSCBvJFACSCAMkAAkgALQQCYANo
AG0VAgA0AaaIBJQaAMAEtACQDABLQAkAwAS0ECQo00ECQDQBoASFGgDAg9Vf0csVr0cZR+rOnL+J
SX+U4dR7/o15HmLSeF+Q16tL6k5R/hbR3jw2aDEMhxhK7wtSFRbYyUu53Gll0PVP9IqgquFwlVbF
UnG/3op/5Th03v8ApPEHk47vnjCA9Qf0cMR/xbT/ANzJfzp+449R7/ovr8h526RYb5JjcRT+pWqR
7pNHaPHl4t+IhrFZGbAo9c+H9fKtF4Wt/wAej/NTk/ccOny9/wBI8yfEeRTu8AwA9I/0catsTi48
acH3SfxOPUez6NzRxfpxS8TpXGx4Ymt/jkdceHm6k8340VYrmNBB668LX7T0aws+eHl302vecMOX
0et7M+X5DyKd3zhhAd6/o7ytpWsuOFn/AMrKZz6nD1/Rufl/YFE8KcNXTWM/3ntSNY8OXV9qjn1j
bkMsAevukNN4joXTSzficPbsnBW6+HHYeee0+hl7Hyg8j0pprUl5r2Pg+PVx/I9D541FvDSaa5Nc
V+s0+pgHXvAjS1NOUWs4uFWz/A9vNb/g0c8+Ho6HtBHhxp301Wkt0aSfLyFbs9/Zd0+Dr+0OTx/a
Vb01s5rh1rdyy4I6POE0Zp+RLzXv4Pj8eK5pAHrno+nh+hU7rNUcRluf0s+G58jz32n0MfY/H8x5
ErUlDOPmvZ8HzX57Gd3zwSr+0LX9L0v+F27+fWgC+eCpqtpjBxltVW8X2NtdW9c+szlw69H2oL7/
AEhKyjpWjGWcXhY3/wCTlTNc1a/q2NmOnw6/Sefl/ZHAlrYKacXaUWmmvU1yOzy8A+OoxaVWmrQn
fL6sltj1b4/ZazbTC0etfA1iJf7PYmctsZVs97UaUbX42WS5JLcefPl7+jfs35/kPJuj6saidCo0
oT2N7Iz3S6t0uTvZuKO9eCNG9GpPRdW7VpQbUovfulFrg1dNcAnAnNG6PSx+GVO7p1atJwb22c0r
PmneL42usmiWtSeYPQv9JOjKrTwbja0HVclvtLUSduF1Zvc2lvOXTez6V6fNI806N/boPCvbJ61J
8KmzV6ppKP3lDNJM7PFPPhTPR2M+QVFJrWi7xnHZrReUlyy2Pc7NZpFpLoerP6PWjfkEse09aEvE
OEvrRtUafrzW5prajh1Hu+jzW/klec+lurpKtUxkFtqzjVS3Tu3GX40r85xnsVjrHjz8+VR2j185
0ZYV+fG9SjzdvLh+JK8ftRUUrzYZnnwGOicasBVvNOVOScKkVvhLbbmvOi90knuLUxuh6z8O6+b9
BYWinsrUo9kaU/yOPT5fQ+keMZ8vySPLWml84QjjY7aj1a3Kqlm/xry+ctdLKJ2jw5efKlYD+tcN
PDP95S1qtHmkvpIdy11wcZJZzFJ5mh17+jjQc9KVp7o4aS7XOHwZz6nD0fRp5+SVQ/C7OU9O4xyT
T14rsUIpPus0aw4cut7VWK5p9fOMaeOW2reNblWjbWf401O++Tml5pqMZefP72N6N/rbC1MK86lL
WrUepL6WHbFKa4ajtnIcLPM0PV+HxFPQHQ2m60danKjBTitrhWqpStz1Ztp7nmcOa93s4fv1qPG+
ltHS0TXnQk09V5SWyUXnGS5STUlyaO8fOs0qZ6QL5zp0settReLrf72CV5P78dWd989fgSNZefI6
L4DqkNIaRo4Wrtp1JV6L4SUHGceSktWTfGmlvM58O3Q83XzSp/w2aeWj+kNKbWtTp4eFOpD60Jue
vHtjNrlk9xMJ4a6+WsvkRwPTmi3ofETo31oxacJbpQktaElylFqS6zrPLy5TVVMaeXzthqGOXnpK
hX+/TXkSf3oWXOUJszPDWXmb+Q9QeBOlLR/RrE1YpuUpYicUtrcacYpLtics+Xu6HjG/NK8haF0p
LQuJp4iCTdOSbi9klslF8pK8XybO9m3z8bq7U66S6KjojFTp023RladGT305rWg+uzSfCSa3Enky
mqLdo/Bf7VRwFRZ1KdelhK3OMpXoyfZrU+Spx4md6dJO7Xxk/sD0p4b8RHSMsNoqVr4qFZ0+VaGo
6P8AE1Kn1TOWHve3r+dT37/FI8T4HG1NF1oVqb1alKcZRfCUXdetHofNl0qe6Z4GnhsV42irUMTG
NekuEam2H4JKUPwkjWc1fj5HqL+jdilj8LV14/SYe1KM+NObdRR/DLXf4jj1Hu+jXc+CVwHB6Xhp
LTWLhVlajpCpWpTb2Lxk26cvwTUJdSZ114+Dyy7yv37VzXEUKmj6sqc041KcnFrepRdn2po24Wab
XDp1FY+pS0jFeTjaaqTturRepWXbJa/VNGcXTqefPv8Az9Uj1d4SdEzwnRCGGhtpUcNrR3tQ1XLu
trPkmcMb5e/qz7GvujM5eO+h+mI6Dx1KrUzotuFZcaVROFRfwt252PRZt8/C6rVMOkGh5aAxdbCz
zdKpKN+KTykuTVmuTEu2cse26VZulf8AXGCwekVnJweGrP8A45QSUG+cqbh1uLJPDefmS/L8EZ0M
/rbD4zRrzdWl46iv+PYdOdlzlT8ZHm2iX3rh5ln78FU/Q+lKmhMTSxVLKdGpGceuLv3ceRqzblL2
3apzp7ounovSFXxK+gq6tajw8XWSnFLqT1etMmNdOpNVIksZ/Xmg6VXbUwFZ0ZcfE1rzpt8lNVF+
JDirfOPwv8KA+DWvGpjXgqjtSx1KeGk3sUqi+jfZUUGMjp869/gqh1qM8JNwknGcJNNb007PuZpx
4VfvCTH5wrYfScfNx1CFSTWzx0Po6y/ii5fiMY+526nnz74uJWgf670LjcHtnhZwxlJb9XKlWXVa
UJP7ovirj5xs93n9BXuhOnF0b0lh8VLzIVEqi405eTUXbFtGrNueF7btab9LdBvo1j8Rg3spVJRi
+Mb3i+2Nn2iXaZ49t0Ra+lP9d6I0fj9s6Kngqr/3b16X8krfh7szxXTLzJfkkZ4NP60eM0W8/luG
mqa/49R+lpf4ZR/EMvevT87nvn8eSucYXEzwVSFWm7ThJSi+Di7p95tyl006B4VcLBaSeLpK1LHU
6eKh/wAho3muyeuuwxi69Wed+/yzHNjbg0wAwAwAwAwAwAwA1YASFGAG7AGWCDLAG7AGWANgGAGA
GAGAGAGAGAGAGAGwowAywApIiDZQbCjABSREGyg2FGAH/9X1XY9j4b8rGrFBlgDVgDLAGrEBgBgQ
YAYAYAYAYAYAYAYAYAYFGAGrEQZYAywBgBoAwAwIMAMCjLAGrAGWAMsAasAZYKEhkYAYAYAYAYAY
AZYAywBqwBlig1YAywBqwBliA1YAywBgBgBgBgBgBgBgBgBgBgBgBgBgBgBqxQYEGAGAGAGAGrAG
WIo1YA1YAwAwAwAwAwAwAwAwAwoFBBsAwAwKNgGFBgBgBsA2kRBsAwAwoNgGwowCVgEYAYAYAYAY
AKsEGAGAGwDAowIMANhRgBgBgBgBtFAogMAMAMAMANgGyqMANogNhBgBgAoKMAMANoAUQGygwoMI
BaChQQKTChadgBaYUETuALTAFpgBEyAWmFC0wAiYApOwARMKFpkARMAWmALTADJhQVSACpgBYsKC
pkAVMALFhQVMAKmAFTCg0WAFTIAiYUETACphQRMAImAETCgqYARMigqYARMAWpBQq9wDYBtMgFAG
yg3cgFAG7gCrgGwDYUKTCBQBhFG7gGAGgDADADAg0UGEBgBq4AkKNFQYAYAYQGAGgg1cA1cqjQBg
BgBq5EGgDADADADLgGrgGrlBoAwgNAGAG7gG7gCrgGAGwDAo3cAUmEG7hRsAwA3cAUmAKTIoUmAK
AFp3ANgC07gGwoWncAUAKTAFBRtMIFhRtOwAsAWmQGwBSChRUCkFCkRBsKMAFIoFEBgBgBsKNooF
EQbCjABLRQJIDQQaZVCbAGiIE2Ko0ECWgBIBraAIasAIaCAbRQDaABtBANoAE0ADaCAbVwAbQANo
qBDQAJoAG0EA2gATRQCaCAbQAJoAG0VAJoAG0EA2gAbRQCaCBDQANoAQ0VAJoAG0ACaCAbQAJoAG
0EA2gBDQAhoAG0EAmgAbQANoqAbQANoAQ0AIaKBDRECGigQ0AIaAEtXAEACGrAWENXCKQAIaAEtA
CGgBDRQIaABtXCNkNAA2gAbQAhoAG0ADaKjUIaAobVwBDQAgAS0ECQrRLQQJsFCbBAloCkgaaaAE
ACWgBLVwNENWApLVwgQUGrEGikUBCKCIAWgBcQocRIJRohUHiAHiAHiyKHMGAOIMKzTmLIqHMGAO
IsKHMGQDmLCs05iwIcxYUOIsihzBgDmLCpTiLIIcxYUOIsAPFhQ4iyAPFhWDiLADxYUOIsgHEWFB
4sCU4iwrI8WQDiLCg8WAOIsKDxZAo8WFZFQAVBQWIAREAVMAKgoKiAKgBYUbQQKCjaCBYUYAEQBg
BsA0AYECWAJANFQJYAOQAJoAGwAbQQCaABSQACSCBvJFACSCAEkAAkioG8kAAkggBJFACSCAEkAN
poIG80VA2kigbSQQN5IIG0kVA3kgBtJFQNpIIG8kUAJIIAyQACSAASQQCasADaABtFANoA0EGgBL
RAaKDQBhAIasUGgDABDVgDQBgQIANBRpoIEBRgQJaANBRoA9Ef0dcVqYzE0vrUVL+GSX+Y49R6/o
1834Dk/hBwvyTS2Mj/x+pL+KTl7zpjw8/UmrfiKfY05jLAHrjwvf1l0cwtb7VCd/vU2v8xww5fQ6
3nGfIeR7Hd88YAehv6OtfVxuJp/WoqX8Mkv8xy6j1/Rub8BynwhUPk+l8bH/ALqKj/ik5e83jw4d
T2r8RTiuQwKPW/hW/bOjOFqf820u+m17zhhy+h1vOE+Q8jWPQ+eMCj0D/R2qW0jXjxw7fdOHxOXU
4ev6Nz8hzbwlU/FaYxi/49J9+fvN48OHV9q/EUY05jAD110/+m6I4WX/ABrCP+WK95wx5e/qexPk
PIp3fPGBB3L+j7LV0vPnhpr+aDOfU4er6N7XyFT8LkdXTmL+/H1wiXDhjre1Rzg04DAD11p5f8iT
DlRw/wDytgcJ7T6OX9t/h+Y8nTXyhOS85ecuPNe/v427vAMgvlCUX5y818eT93dwsB1rwFScdNU4
7vF1Ox6pjPh3+j+0G/hrqunp2u9q1aSa4rxccv117S4cHX9ocnqw8U1KLyeae/8A1X57zbzhdVeN
WutvpLg+PU/U8slYA9a6KTXQlra/E1fXVkcL7T6E/tv5X8x5IozWcJea9/B7n8eXNI7vnjUW8LPN
ZrJrjxXaAdH8FGH/AK9wds4uUmn1Qk+9W9+xoxnw7dH2oLX/AEhF4zSsGvRw8E1wvKbXt/V0Z6fD
p9J5+Q4hT+njqekvN58V71zutrOjyheBrxhenU/dzylye6SXFd7TayuCD1v4NKctE9GMVJpa0ViZ
cU7QyfBp2y3Ncjhly+h0vGF+Y8j4/Dxg1Up/u55x36r3xb4rvacZZXPRHgqwev8A1hS8b/aU0oz5
x2Rl2ZQl+B5ttkOVWfwdTjitI4TD1NnymlOD4SUotrqklZ81F7EyZOnT5nxg7F/SC0h8kxuETWtH
xVTXj9aMpJNerJ7mk9qOXTj0fSL5iR5rx+E+Q1NVPWi7ShLZrReafxW53W1HZ4rNKeaUj8uisUts
nq1eVTbfqmvK+8ppKyQi3z5Hqv8Ao71XDRuInLOMazS5JRUmuq8m7cW3vOHU5e/6NxUryfozHRp1
JKt+6qpxqb7Ju+sucXaSW+1tjZ6K8EqmtalU0TWcb6tSnLKSe9ZqUXw2NPerMcpwJbHYKONq0qtJ
JQxMlktkZ3SnBcLNqUVuhKO8y1Zv5j1H/SKouvgaEYvOE5VHH7MUotrqc45cG3sTOPTe76TwkeU9
B1oylLD1WlSrpRbeyM15k+VnlJ7dSU0tp3rwY3096o+nOroeumrwq0p79qlF71yazReU4HqzwC6M
hDE4vFUlajVp0pU19XXlPWh+GUHHi0lLejh1K9/0eebUrh3TnEf7Q18ViFnUoYirGXOjKpLUl+GT
1G+Eqa3HSTTy9T7W/j/BVZ6OzWKc8FNpRxCSi3sjVjfxcuWbcG90Zye4tYx93vEPhMTU0RXjVh5N
SlNNJrfF7GvU09uwvLMuh7A8Mc4aO6M0KVOOpCTw8IxveyUHJK++2qcMOX0et4x/BI8s4v8ArfBQ
rf2uGapVOLpyu6cvwvWg3uXi0d3gvmfBWujMljXUwMtmJSUL7q0buk+1t0290aje4lMfPj3/AJjp
39HnBOtpmUmv3VCpLqbcY/5mY6nDv9Gn2vklQXhzjN6dryl5slT1HxUYKD7pRknzTNYcM9f2linY
v+t9H0622phWqU+LpTvKm/wvXg3uTprga4cr5nwGdE5LGTqYCT8nFR1I33Vo50n2y8hvdGchkYef
Hv8AzHqjROKqdEOharQbhVjTck96lUrZf4kcL5r3S9uH796PJvS3BQw+I8bRVqGIiq1JLYozveC+
5JSh+E7yvBnP4qdVv640ZCe2rgp+LlxdGq3KD6oz1k/95FDirzPh+Qt3gOrt6ao0GtanVvrLg6X0
0JdalBdja3mc+HToe1+/iVaf6RelJLTFCNOTToUINNbVJzlK/qiZ6fDf0m/a+SRyPprQjPERxdNJ
UsZBV4pbFKTaqRX3aimkvq24nTFwz9/v8qNT/rnRMo7amBqa6/3NZpS7I1NV/wDIVjinM+H5Ueo/
6POGWjtC18RJqOvWqS1nsUYQirvqeszj1OXu+jTWO/vSvF2OwlTR1adKonGpTnKMlvUouz9aO75t
8KtnTdfOEqOkVsxlJSn/AL6HkVe1tKp1TRMfc65+fPv/ADWJfobo/wD2uw0tG7alOvSrUlv1ako0
qyXfTn1QbJfHlcJ3TX3/ANFWvSfhw6TQ0FiNG06mdGc6vj48aUoqlJfwzlbmjjhNvZ18u2z5/wBh
mPGGn9ET0Biq2FnnKlOUb8Unk1yas1yZ6Jdvn5TV02s/Sz+tsJg9IrOUqfyes/8AjlBJRb5ypun1
tSJG8/Ml+X4Izon/AFthMbo55ylT+UUV/wAcoJuSXOVN1OtpC+DDzLPn+BVW0DpeegMXRxdPzqNS
M0uNndp8msnyZbNueOXbdqkem2iIaEx9alS/ctqpRfGlUSnT/lku0mN21njqpEtpdfPWhsLidtTC
VJYWpx1J3q0W+SfjI9iJxWr5xn3eP1GvBzJY6vW0dLzcdQnSjfYqq+kov+OKj+JjI6fnx74VQKdS
eEmpxbjODTT3pp5dqZtynhV48JdGNXGrG01anjqUMSkt0qi+kXZUU0ZxdOrzv3+Ug2E/rvQNam86
mArxqx/3Ve0JpclONN/iY4qzzj8L+ao7wc6ShozSdFVv3FZuhWW7xdZOnK/Vra3YMuE6d1f4fitV
fS+jJ6GxNXDVPPo1J05dcW0/YWXbFmvCrz09/rXDaP0kttbD+Jqvf43DPxbb5uHi2ZxdOp5kv3fk
kb6F/wBb6P0lo55vxKxVL7+Hd5W5unKfcW+DDzLPn+BVL6PaXl0fxlDFw86jVhNc9Vptduwtm3PH
Ltu1qb8Iuh46D0riaVP905+MpW2eLqpVIW/DJLsJjdxvqTVImdK/130ewlfbPBV6mGnx8XVXjabf
JPXiu7gSeK1fOM+66/VPVzA24tMAMANBBgBgBgBgBgBgBqwBsAwAwAwAwAwAwAwAwAwAwAwAwA2F
GAGAG7AGwg2AYAbChSIgUVRgBuwBliIP/9b1Wex8J+VjADADADADADAoywBqwBmqAZqgGWCDVgoy
wQZYA1YAwAwAwAwAwAwAwKMAMIDQBgQZYAywBgBoAwIMAMAEMA0AYAYAYAYAYAYAYAYAYAYAYAYA
YAZYAywBqwBlig1YAywBlgDViAywBoAwAwAwAwAwAwAwAwAwAwAwAwA1YoMCDADADADVgDLEUasA
aAMAMAMANooFBBgBsijCgwoMAMANkAoIMAMAMANlUbAMAMAlYBGAGAGAGWAFBBgBsAwA2FGAGAGg
g2FGAGAGAGFBtEAoAwAwAwAwA2UGwowAUiAwIMAMAFBRgBgBtACiA2UGFBgApEUKCDYUEQAtMAWg
oWgBYARMgFoAWgoIALQAtBQtAC0AETIBaYAuLCgyYAVMAKmAFTIoKmAFTCgqYAVMAKmAFTCgqYAV
MgCJhQRMAKmFBEwAiYAVMKCJgBEyKCKQARMAWAKUgo2AbuAKTIDYBu5QKuQGwBSYBu4AoA3cKN3C
BRAYFGAGAGioMAMIDVwDQUaANFQYAYAYQGACWwg1coNBRgBgBhAJCDADADADLgCSqMCDQBhAaAMA
MAMAMAMANgG7gG7gGwDYBgUbAFJhBu4UbAMTsALTuAbuRQtMAUAKTAFAC07gGwoWmAKAFJgCgoUm
ECgoWmAKIBZQYQC0UCkQCkUCiKMAFIoFEBgBsKMANooFEQbCjADABLRQaANEAlooNACSIEtFUaCB
LQAkA0AIaABtBANooBtAA2ggG0ACaABtBAhoAE0UCGggG0ACaABtBANoAE0UAmggG0ACaCAbRQCa
ABtBANoAG0UA2ggG0ADaAENFQCaABtAAmggE0AIauACaCBDAENWABtBAJoAG0ADaKAbQQDaABtAC
GgBDRQIaIgS0UCGgBDQAlq4AgBA2rAaJaCBAAloAQ0AIaAENFANoCwNoI0Q0ADaAENAA2gAbQQIa
KNhtACGgAbQAkAS0BYSBSWggS0AasAJsBqEgUloAQAJaAsJsBohqwBpq4QIasUIxAaEIoWgAiAFI
APEKlHiQQeLCg0QA8SKHEWAOIsKlOYsgycxYUOYsKHMGAOIsipTmLAycwYUOYMgHEWFDmLCpTiLI
IcwYUOIsAcRYUHiwBxFkVmjxYEOIsKDxYA4iyKHEWAHiwrJxFgQeLIocRYAeLCg8WAOIsisjJgBU
AEQUFRAFiAEQUFQAVMgCIA2ALAMCgiCDAoXEINhRtAGgDAg0ygQQGioNMAGwAbABsAEwAbCAckAN
5IABJFQAkgAEkEDeSKgBJAAJIIASQACSKAEkEDeSCBtNFA2mggbyRUDaSAG0kVA3kggbSRUDeSAG
8kVA3kgAEkEAZIABJAAWggGwAcgATKgSFGggwAS0RRoqDQBjRAIKDQBgAhqwBoA00ECQo0ECWgBI
UYECSAywB2bwD4jxGmFH69GpH2S/ymOpw9P0e/a+QiPDNh/k+nMTwl4uS7acb+u5cOE68+1Ry424
DAD1x0l/b+hlOe1wo4f+WcYHCe09+XnD5QeRzu8AwA7h4AK3i9LTX1sPNfzQfuOXU4en6Pz8hV/C
7R8RpzFrjKD/AIqcX7zWHDHWn2qOb2NuA1YA9cdMP2nobQl9WjhfU4xPPOX0M/Y+UHkc7vnDADuX
9H6eppaa44aa/ng/cc+pw9f0bn5CpeFunqabxa+3F98Is1hw59b2qOc2NuI1YA9c9LvpOhtF8KOF
9TgjhPafQz9j5QeRTu8AwA7d4AHbS7/3FT2xOfU4en6P7XyFc8MKtp3F9dP/AJVwLhw59b2qOaG3
AaKD11p7yehMf9zh/wDlbA889p9HL+2/lPzHkiE3Td1tR30+eC1YJrXj5r3cHw+HxTIDsngNfj9M
wn6SpVNbnlt6+PPPO7tzz4enoe0GfhnfyjTmIh6SVLV5/Rxer67rnlvyuHCdf2hyajNebLzX6nuf
x4rna23nGK+GlZrk1ua/Wx9qAPWzSw/QryX/AGN09+db25nD+c+h/lH+/ePJNaHjFrr8S4P4P23W
yx6Hzxn/ABRH7UV3xXw9nUgDp/gTetpvDReaXjWuT8VNf69nAxnw79D2p+/QSfh0xGrpuW9KjTTX
FO7991wdmTp8NfSPa+Q4xVh4iWTy2xfFcf1seW46PMF10qiVRb/OXB/ntXatwB646KzlT6GVZPNy
oYldl5x9SVupHnvL6GHsfKjyhgJqqnQm0oz81vZGa2Pqfmy5O+biju8EAMPVlo6rdxzTcZReV1sl
F8Lq64rrCS6aX3wd6O1NO4OMXrQdRTg+MUm12qzUuEk1uM5Xw7dKfagv39Iym546hNNOMaEYtb03
KbV+tJ2+6zPTdfpPPySOH4f+saLpP95STnT5x2zj2eet3n7XJHR5p5UDReJjSk6dR2pVFqz5cJdc
XZ5ZtXjsbFiSj1t4I6M9A9H8ZKWU4VMRLjnCnFdq8nJ7GcM/NfQ6M7cb80ryTpbDRjJVaStSqrWi
vqv0ofheze4uL3neV8+qPX/rLDKp/aUEoz503lCX4X5DfB00t4XmfAT3g9cMZjqGEqu0KlelKL+r
OMlb+JXg+tN+aiZNdPzdffB2/wDpB6WeAxeAslLUjWcovZKM9WMovlJJp8mcunNvV9IurPmkeZtL
YFYCq4wblTklKnJ74Szi3ztlJbpJrcdo8WU0p9pVfOVGGLWcsqVb76XkSf34rrcoTb2ki3z5HqD+
jfrQwOKk35Hjlbk1BX9xy6j3fRuL8Uryzo/SyoYp1aibp1HJVYra4TupW5q948JJPcdtPDL5Uw0l
gJaLrToyabg8pLZJbYyXJqzXJovKWaE5pig9MSo4qG3EvVqf76NlP+K8anXNpbDM8NZTfn3/AJj1
P/SBwqxGjqNCDtKEnVjHjGnHVlbmlPW+7GRx6b3fSOEjyP0exsMJX1aztQrRdKryhL0rb3BpTS4x
R3r5+NVHY3CVNFVp0p+TUpzcXZ7HF7n7H2lSzQ9ceA7BLHYrE6TivJr0qetbdVcn41cruKmlujOK
OGfue/oTdt96Vw7pli/9pauP31MNiq1SHF0Z1NWS/DLUklwlN7jpPDzZ3u391v4KpnRfFwoV/FVn
ahiIujVb2JStaf4JKM/wmq54X+IhcVhqmi60qc04VaU3FrepRdn3NFZs0PZfhlxssP0ZpRnZTrOg
pJKy1reMlZdcWefDl9DrX7P4JHlfD/1vo2dPbUwcvGR50qjUZr8M9SSX25s7cV4Z5nwU16I4uGHx
PiqztQxEXQqvcoz2S/BJRqdcS0wvn4+B1nwBaFnQ09UjVjaeGpVdZcJKUabXrZjqXw7/AEfH7XwS
ofw9UG9MTrp61OpFJfZlT8iUXzTWt1SRenwz9I9pYpGD/rjRdWjtqYOarQ4+KqNQqrsl4uS4Xm+J
eK5TzPh5DHodj4YDGQjWdqFZSo1uVOqtVv8ADdTXOKLUwuqPWeIwM+hPQurQqrVqqnUhP71Wq4v1
St1HDnJ77OzD9+9Hlnpn/WPyfSC/5KqS8Z/vqXkVO2Vo1H987z3PDn58+/8ANWaJ/rfRmJwu2eHk
sVS+7lTrJdjhPqpsXxTHzLPd5E/4D4Tn0gwmo7W8Y5fd8XK9/wBbbEz4b6HtT9+jVWz+klpD5Tpa
nRWylh43+9KUm/Vqmenw6fSbu/JMXNOlv9aYbB6QWbqUvEVX/wAcw9opvm6bpvm7m44Z+ZL8vwVn
RhfOuBxuAeclBYqkvt0L66XXTlN/gQvhcPMs+f4CudG9Mvo/jKGKSv4qpGTX1o38qPU1dPrLZtjG
9t2px0u0MtA4+vh4O9OM703xpy8qm+2LixLszx1UTXSD+t9FYLGbZ0HPCVXyj9JRf8MpRXKmZnit
5eZL8hnQL+sli9GvP5Vh5Omv+PUfpafa9WUPxly950/O575/GeSqNgMbPRlanXpu06c4zi+Eou69
aK5y6VbPCNgYYXSNSrRVqOJUcTS+7WSnb8Lbj+EmLfVmr8fP4pDquvnrQEJbamj8Q4P/AHOIWtHs
VSMl+MnFXnH4X8wLwZV4yx/yOo7U8bSqYWT4OqrQfZUUH2FyTpc69/gqhV6MsLOUJpxnFtNb007N
GnLht0Hwlr5fXw+klsx2Hp1ZPd42K8XVXXrQcn94xj7nbqefPvn9CQrQf9c6DxuF2zwtSni6a36r
+hq9mdOT6hfFXHzjZ7vP6CD6A6ZjoDSmGxE/3aqKNS+zxc/In/LJlym4x0722Vai+k2hpdHcbiMH
LbRqzhfiotpPtVn2ll2zlj23RFx6Zf1vo3RukFnJUp4SrylQfkX5unOP8JmeK6Z+ZL8vwSN+D3+t
cPpHRr24jDOrTW91cM/GRS5uOuu0Ze86fnc98/Irl9jbk00AYAYAYAaCDADADADADADADADADADA
DADADADADYUYAYAYAYAYAbsRBsoNgGAGwo2kRAooNhRtIAVYgNgH/9f1ae18R+VjAgyxAasAYAYA
YAaCDADADADADADAowAwgMCDADVgDLAGWKDVgDLAGgDADADAowAwgNAGAGAGAGBBpq4AiwQZYA0A
YAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAZYAywBooMsAasAZYA1YAyxAasAYAYAYAYAYAYAYA
YAYAYAYAasUGBBgBgBgBqwBqwUKCDADCKNgGFBhQbAN2IDYQYAYAbsFGygwAwAwAwDLADADCA3YI
NlBsAwA2FGAGAGAGAGAGAGAGAGAGFAtEBgBgBgBgBgBsoNhRtEBsIMAMAMAFBRgBgBtACiA2VRhU
GAG0RQsIMKBSZFBEwBYARO4ULTAFpgC0AETIoWmALTsALTAFphQtMAWmALTIBaYARMKDJgBUwAsW
FBYsgCpgBUwoKmAFTACJgBUwoKmQBUwAiYUETACphQRMAImAEUgoImAETIAiYUETAFgG07BQpO4B
sA2mAKTIDZQKTAN3IDYApMA3cAUAbuFG0wgUQGigwAwgE3CjADQBoqDADADCAwAS2ECSqMAMAMAN
XIg0AYAYAauAaKowA0EGEBoAwAwAwAwA1cINXKDdyA2FGAGwDdwDdwDYBsA2FGACkwBQBgAtMA2R
QtMAUAKTAFACk7gCgoWmAKQAtAGwoWncIFJ2ChYApMAUAbIoWECkVQsgNlBiAFkBgBsA2VRtAGyI
NhRsAwA0AaaAElBogEtFBoASRAloqjQQJaAEgGmrgA2gAbRUA2gAbQANoIBtAA2gATVggQ0ADaKA
bQQDauACaABtBAJoAG0VAJoAG0ACaKgG0ACaABtBANqxQDaCAbQANoAG0UCGggE0ADkggE0ADaAB
tEANoqBDQANoAG0EAmgAbQANooBtBANoAQ1YAQ0AIaKBDRECWigQwBDQAhq4AgDUIasAJaCBAAho
AS0AIaABtFANqwGoQ0EUNoAQ0ADaABtACGgiwNoo0Q0ADaAENACQDTQGiGrAGrBAhoA0AJaA0S0B
SWgBAAloDUJApDVgDTVwgRawFhYVREALQAtABYhUo8SCDxCg8QA8WRQeLAHEWFQ5gwMnEGRQ5iwB
zBhQ5iyAcRYVg5iwocwZAOYsKHEWAOIsKycxZAOIsKHEWAOIsKDxZBmnEWFQeLAHEWFDiLIA8WFB
4sKzTiLAhxFkAeLCg8WAOIsKDxZBKPFhUFTACoKCJgBUyAKgAiCgsWQBYgCgoUgg2FCohAoKNrII
FhRgBtgGgDRUCWQCQDCoEMAG0ACaABtAA2ggG0AAkgAEkVACSAG8kEAJIABJFQAkgBvJBAGSKBvJ
BACSAG8kVA2mggbSRQNpoIG80VA2kggbyRQNpIIG8kEDeSKAEkEAZIABJAAWEAmgAbQAJooENEBo
qDQBhAJCjRUGgDTRAJKDQBjAEAGgBLQQJCjAgS0AJCjQQYQHSfBDiPk2m8K+LnH+KnJe8xnw7dG/
agsfh9w3idLxl9ehCXdKUfcTp8On0j2vkOJWOjyjVig9b6O/buhUlwo1P5Ksn7jh/OfQnnD5fqPJ
Fju+eMCjrngPq+L03SX1oVV/I37jnnw9HQ9oa8N9Lxem6z+tCk/5EvcMOE6/tDkZ0cBgB630h+09
CVyo0/5asfgcP5z33zh+/ePJB3fPGWAO0eAaWrphLjRqL2P3HPqcPT9H9r5CG8MsNXTuK5+Kf/KK
BcOGev7V/foOX2NuAwgPW/SDyuhUP9zh/wDlZA4T2n0Mv7b+UHkc7vnjLFB2vwBZaYf+4qe2Jy6n
D1fR/a+QgPDIradxfXT/AOVUDWHDHW9q/v0HMjbiNAHrrpH5PQqH+5w//KyBwntPfl7H4DyKd3zw
WlU8W8808muK/WwA7V4CaGpplNZrxFRp8VeK/wBTn1OHp+j+18hB+GeN9OYqW1XpLqapQy9/+jLh
wz1/av79BzWr+0LX9Jed/wALt3889+W3AZH9ojq+lHZzXDs2rtXBEB600nFUehUU3a9Gjn96rH1Z
58jh/OfQv9t/KfmPJFOTw8mpLlJe38uZ3fPGpxeHkmnwcX7H+tjyAOx+BHDqrpqnUjs8XVbXB6tm
urPLlldtM558PT0J9oNvDc1iNM4i22nGkn1OEXf12fZzLhwnX9r8ByekvHrxe/bHr3rt3c7cWbec
CoVFB2l5ryfx7Nvq2MpB6+w8paH6F3Vrqk2t6etW9ad+po8/OT6PGH7948kY6hGDU4fu5q8eXGL5
p5cWrS3nofPoPiv26mq3pxtGpz+rPt82XNJt3kQvlY6f4EpRxWl8PTntp+NnB9dOScep3UuTjl5z
MZ8O/Q85LUn4asfFacnTqfu3Qp058k/KTXOLakuNrbGyYcNde/a+SRxKcamia2TtOnJNNZq6zTXF
Pansa5HXl5eFG0pQjGSq01anVWtFfVfpQ/C9m9xcXvEWj1l0bxEsP0LqVJPypYfEK++15U49ySS5
JHnvtPoY+x8qjypov9uhLCvbLyqX+8S81ffXk23yUNyO1eCefCmejMYsDVUpLWg04zj9aEspLrts
e52e1FZngX7wdaIdHpBhaN9ZRq68ZbpRUXOMlyas+0zlfDt0p9qC7/0joylpChL0FQ1fxa0m0+xx
txz4Mz03X6Tz8kji9H+s8I4f2mHvKPF05Py4/hk1NLhKo9x0ebmfBQ9BV468qFRpUq8dSTeyLveE
/wAMrN79XWW8WGP5j1d4KKc+jXRzF1pLVqQliZtPapU4KPqcDhl5r39H7ON+aPJ2nsJCjVVSkrUa
0VUprgm2nH8MlKF9+rfed4+flFOMWvnPBwrbamHapVOLg7unLs8qDexJU1vC3zPgLF4MVDSGPo4K
q/Iq1qU4vhOlLWX8UdeHXJN7CZN9LzdfeOyf0gdOPRuPwGqlLxUKk3F7JRm1GUXykouL5NnLpzb0
/SMtWJHmrTmj1ozEShBt03aVOT305pSg3z1Wrrc7rcdo8OU0p/plfOWGo4xeckqFX70F9HJ/ehZc
3TkyRq+Zv5D09/R0i8JozFVpN6njnl92EW3613HLqcvd9G4vxSvK2iNMfI8YsRUWtCUpKrH60Kl4
1F2xbS4PM7WPBLq7Uy0xo16IxFSg3rakmlJbJR2xkuUlaS5MTymU1RZtI4N9Ip4PER87EuNCp/vY
OMG/xRcJt75OXAk8N2d2r7/HzHp7+kDRjjMBSw0cqkdevCPGNFKM12RqOfVBnHpvd9I8zXz/AA/r
SPInRnSUNF4qEqv7mV6dVcadROE+1Jtrmk9x6K+fjdVTDS2jZ6HxFTD1POpzlFtbHZ2uuT2p70OW
bNeB7F8B2EWk51tKrzq1GlTqf72Dkql+clGnUfObPPn7n0ehN+fuiV5705j/APar5yjtlTxNTF0f
uOWpVivw+Ln1U2dZ408mV7t/Haqb0T0lDReMpyq/uZ3p1l/xuonCfak21zSZuueF1RGaX0ZPQ+Iq
4ap59KcoPg3F2uuT2rkJ5ZymroewvDliJ6K6O4fDTbdSc6MJN7XqQcpN9sV2s4Yea+j1/GOvgkeX
9Df1to3FYT06DWKpdStCsl1xcZvlTO15eLHzLPmqM6JaVjobG0qtTOk24VVxpVE4VF/DJ9pbNs4X
VHdvAT0ZnozT+KhUzeFp1IX4tzUU1ycbtcjlnfD0/R8dZX7i1VPDvThjdIvG0neMpVKFTlVw7UWv
4XB9dzWDHX83fy/BYpHRz+tdH43BPOUIxxVL71LKol105OT+4jVc8fMs+aoLovpj5gxtDEtXjTmn
NfWg8px7YtrtLZtjG9t2pHSjQ3zBja+FveNOpJRf1obYS7YtPtEuzKdt0J/pN/Wuj8DjlnKMZYWq
/tUbOm3105xS+4yRvLzJfl+CN9DV854fHaPe2rQ8dSX/AB3D3nlzdPxi7RkYedz7vyKqGhNKT0Hi
qOKp+fRqQmuuLTt27C2bYxurtUx080VDRGkq9Ol+5lLxlL/d1UqkP5ZJExu4vUmqkSel/wCt9C4T
E7Z4WrUws3v1JfS0uzOql1EnitXzjL7vH6jPBz/WFXEaOezG4apTit3jYfS0u3Wgor7xcvedPz49
8/pK59h68sJONSDtOElKL4NO6ZpyVevCbh4/OMsTTVqWMhTxUP8AkNFSkuyeuuwzi6dWed+/yuI6
/rno81tngMVfqpYmNvVOmv4ieq84/C/mepv4L8TCnpOnh6rtSxcZ4Wp1V4uC7pOL7BlwdK+fj4/E
qiYvCzwNSdKorThJxkuDi7NG3OzTTofhK/rGWD0ks/lmEpub41aX0NT1wT7TGPudOr51ffP6GY30
c/rjQmkMHtlh5UsZTXJPxVX+WcX2C+KY+cbPd5/QqvdBNNLo7pTC4qXmQqx1/uSerP8AlbNZTcY6
eXbZVpr0u0K+jmkMThN1GtOK5xTeq+1WYl2mePbbCK5YrKtWCjQBgBgBgBqwQYAYAYAYAYAYAYAZ
YAywBlgDYUYAYAYAYAYAbsAbSCDYBgBgBsKMAFhBsKNpACkQGygwA//Q9YHsfDflYwA1YAywBqxQ
ZYgNWCjADQQZYAwAwA0EGAGAGAGAGBRgBhAYAYAYAYEGAGrAGWAMsUGrAGWAMsAasQGWAMCjQBoM
jADADLAGrAGaoBrVAM1QDVgDLAGgDADADADADADADADADADADADADADADADADADLAGrAGFBlgg1Y
AywUasQGWANAGAGAGAGAGAGAGAGAGrFBgQYAYAYAbIowoMKDYBuxEGwDADZFGygwoMAMAMAMAlYB
GEBuwBsINlBgBsKMAMAMAMAMAMAMKDCAwAwAwA2ggUFGAGAGAGAGwDZVGACiIMAMAMANkUbKDADA
DaAFEBsqjCoMAMIBaCjZUGyKFoAWmALTsFBABYAtMgFphQRAC0wBaYApMKFoAImQC0ygWiAWmAFT
CgqYAWLACphQVMgCJgBUwoKmAFTACphQRMAMmQBEwoImAFTAFqQUETACJgBEwoImAETIAiYUFTAF
p3AMAFJhQq4BsA3cA2mQGwBSZQbuQGwBSYAq4BsA2mFCrhBq5AaCjQBhUGgDADADCA1sAEt3ANFB
gBgBgBq5EGgDADVwDRVGAGggwA0QGAGAGAGAGrhAm5QYAYFGEBlyoFJgGyKMANgG0wDdwDYBsKNg
GJ2AFp3ANgCkwBRAKTChQAtMAUALTuAKTChaAFJ2AFgG1kALChUWAKIBaKDZALRQKIoWioNhRtAC
yAwAwAUVQpIiDADYUbANpXKDRAaANNACSg0QCWgDRQJaIgS0VRoIEtACQBLQANoAG0VANoAG0ADa
CAbQAJoAQ0EA2gAbRQDaCAbQAJoIBtAAmigE0EA2gATQANoqAbQANoAE0EA2igG0EA2gAbQAhoqA
bQAJoAE0EA2gAbViAG0ADaKgQ0ADaABtBAJoAG0AIaKATQQIaABtWAEtACGioENEAhooEtACGrAC
GgEIA0Q1YAS0ECABDQAlooBtAA2gLCGgNBtBAhoAG0ADaAENAA2gjRDRRQ2gAbVgDTQAhqwBoDRL
QAkAS0ECQK00BohoAS0AIAEtAbJAEtBAkAwKbEAbLQAtANiIKDRYAeLIoPEAPFkAeLCg8GAOYMKw
cwZFDmLAHEWFDmDIBzFhWDmLAHEWFDmLIocRYA5iwrNOIsgHMWFDiLADxYUOIsglHiwrJxFgB4sK
HEWQDiLCg8WBKcRYVkeLIA8WFB4sAcRYUHiyBR4MKyNEAKgAsQoIiAKgAqCgiIAqYAQKNoIFBRsI
FgGBQtBBsKNgGgDGECWAJANFQJkADkADYAOQAOQQCkACkgAEkVA3kgAEkEAJIABJFQN5IABJBACS
AASRUAJIAbzQQNpIqBvJADaaKgbTQQN5ooG0kEDeaKgbTQA3kioASCAEkABkgAEkACaCAcgATAEB
AkqjQQaAMIBJVGgg0AJaIDRQaANNEAkoNACWggSFGBAhoA0FGWCC3+D+v8m0tg5f91FNfxSUfeZy
4dOn4ynxHVv6RNDVxmGqfWouP8Mm/wDMc+m9H0nmfAeeTq8YwA9bdAf2voliYcKeKS/hk17Thly+
h0/OF+Y8knd88YAdK8D9TxWnMK+dRd9OaMZ8O3R9qfv0Fg8PlLU0un9ahTfrkvcTp8On0j2vkOJ2
OryjQUet8F9P0Jf+5n/LVfwOH85757Hy/UeSDu8AwA6/4DZaumqfOnUX8tznnw9HQ9oA8NsdXTlf
nGl/yriMOE6/tDk50cBgB63035XQmP8AuaH/ACtgeee09+X9t/KfmPI9j0PnjCA7Z4AlfS7/ANxU
9sTn1OHp+j+18hXvDC76dxfXT/5VwLhwx1vav79BzQ24DQUeuOln0fQyiuNHDf4oM4Tl9DP2PlB5
Hseh88asAd2/o+3lpWa3LDzfV5UF+uw5dTh6vo/PyFV8K1dfPmLvnFygmuqEVdc1u7tjZrDhjre1
Rzlp4WWWfDg0/c127tptw4GVYeLalHzXmnw5da+D3gHrXppLxfQ6j9qjhfW4yOGPtPoZ+x8oPJj/
AGiN/Siu+P5ezqZ3fPGUfp14vf6PXw7d3O2y7IDtf9HyDnpapwWHm/5oL3nPqcPV9G5+Qq3hZxL+
fcXLhKKz3pU4q3U0XDhz61+1RzqtT8W7x815p/rethtxCq68avGLflLr49u3rvusCj1n0oi8L0Lp
QW2VDDeuUJv1eo4T2n0M/GHyg8p4F/KE6EvSd4PhPd2S817F5rfmnd4J7gDB4j5HPyleLvGceMXt
XWtq4SSe4qS6HavAZo50tONXuoUJyUuMXqpPtUk+Wzacs+Hq+jz7XyWoLw1xc9M16id4vUj1ShCC
cXz2Pqkt9y4cMdf2ljnlT9voKf8AaUUoy5027Rf4X5L5OCWxmnLkb0avlsZYV7ZeVS/3i3fjXk85
al8kVJ58D1fiKsdC9DaeurxlRpKS3uNWpHWtztJtPc7M4c5PoXxh8keQcZhpaNquKecWnGSyunnG
S61ZrrPQ+fZpT3TEFX1cTFWjWu5JbFUVtdetSS2KMktxFvvHYfAbTjpTSVGUv3mFhVtzpyi1/LKT
5tTS2ROeb0dDzfgla8LGLWk9OYnBSeU4UYQ5VVBSh3uTg9yU29wx4Ot5ys+A4jo/Fy0ZWjUSvqvy
ovZJPKUXyabi+TZ05eWXSlaXwK0fWcYu9N2lTk98JK8W+dnmtzutxYtmh69eNlQ6Fyqzspzw7Unx
156l3zaabe9ts8/859Df2Pkjylgv6ywtSh6dG9anzjZKrHuSnyUJcTtXgnmKb6AxcMPW1KrtRrRd
Oo+EZbJfgkozS4xQpjRf/BJoicOkVCjUVpUZ1ddcHCEvfYznfDr0cftFT39ImUpaWp381YeCX8U2
1159zXEdPhv6Tz8kjlVT+tMBGX9phXqvnSqNuL/DNyTf/HILcbcOZ8FZ0afyyVTBPZiY6sOVWOdJ
9rvTvujOTJUx8+PePVHg6xD6MdEqmLSWvq4iok16SbhG664rsOOXmvd0/s4b+KPJXSLR8NH4iSpf
uZpVKX+7mtaKfNX1ZfaTO8rwZTVU90p/WeCoYr06X7PV6ktajJ9cdaC5UhGr5m/kLj4HdTSGkaWD
qbJVadenyqUHrdzhrp8Xq8DObfR83Xz/AAK6L4dukL0ZpnBu2tGjS1pR3SjUlKM4v70VZ8mYwnh2
+kZayiR5z0/ov5nxVSgnrRjK8JfWhJa0Jfii0+07S7eTKaqpbpB/WWGw2NWcnHxFX79FJRb66bh1
uMiRcvMl+X4D094DZPQfR7FYt/XrVV1Qpx98Wcc/Ne7oeMbfileT+jWlI6IxlKtUV6es41V9anNO
NRdsXJHavBjdVTLTei5aExNXDSd3TnKN9zSeUlyas1yZZdplNXQ6BT0f/tPitF17X+UypUK3+8oy
jCTfXTdOT4tszxt113Wff4/Aegv6QM4aUwywa/fU4SxUecYNQkv4ZSn1QOPTev6R5mvmkeSOimlI
6GxtKrUzpXcKq40ppwqLtjJne+XgwuqphpvRctCYmrhp5ypTlBvjZ2uuT2rkyy7TKauh7Y8CCp43
Cz0m2terSo0qz4Sw6lC764eLk+LZ58/c+l0PM38P4JXluhjn0pw2kqcs5+M+W0+tSaqrthPWf+7O
3Dw77pfxbVbolpaOg8dQrzzpxnaouNOa1ai7YuSNWbYwy1Q06QaIloHF1sLLN0qkoX4pPJ9TVmuT
Eu0ynbdKsfS3+s8Lgces3Ok8PVf/ABzD2ir83TdP1kjefmS/L8EZ0YXzpgMdgXnJQjiqX3qDanbr
pzm/wol8GHmWfP8AAV7ovpn/AGfx1DFbVSqRlJcY38pdsbrtNWbYxy7btW+luhv9n8fiMMs406kl
B8YPOD7YtPtEuzOdt0ie6S/1tozAY3bKnGeEqvnSetT74TSX3DM8VvLzJfkM6E/1lQx+j3trYd1a
a/45hvpFbm4eMXaXI6fnc+78iqZobSc9C4mjiqfn0akKi64tP3Fvlzl1dqnfCDouGidKYiFL91OX
jaX+7qpVIW7JJdhMb4b6k1UiT0v/AFvoLCYj08JWqYWfHUn9NS7Luol1EnitXzjPu8fqsb8Gv7fX
xGjnmsbhqtOK3eMgvG0n160El1lyTp+fHvn9K1zyhXlhpxnB2lFqUXwad0zTjw0vvhSoRekpYqmr
U8ZTp4qP/IaKlLunrLsMYu3V537/ACzBo/1x0da2zwGLT6qWJjZ/z01/EOKvOPwv5nqD4KsTGnpW
nh6jtSxcamFqdVeLgv5nF9hcuE6XPx8fiVQMVhpYKpKlNWnCTjJcGnZmnGzTTo/hN/rGWD0is/lm
DpSm+NWlejU9cE+0xi7dXzq++f0MxzE24tMANWANWCjQBgBgBgBoIMAMANhRgBgBgBgBgBgBgBgB
gBuwBiQQKAMAMANhRgBgAoiBRVGAC0QGygwA3YgP/9H1iex8R+VjVggwAwAwAwAwAwA1YAywBqwB
liAywBqxQZYA1YAwAwAwA0EGAGBRgBhAYAYAYAYAYAYEGAGAGAGgDABDCDQBgBgBgBgBgBgBgBgB
gBgBgBqwBrVAM1QDVgDLAGgDADADADADADADADADADADADADADADADLAGrAGFQZYA1YAywUasQGr
AGAGAGAGAGAGAGAGAGAGFBtIAUEGAGAGyKMKDZQYAYAYAYAYQZbsAbCDADZVGwDADADADADADADA
DCgwAwAwgMAMAFhBgUYAYAYAYAbANlUbRAbCDADADADaIo2UGAGAG0AKIDYUYaQYAYAKRFCggwoF
JkULQARZgC0woWmALQAtMgFphQtMAWmALTuALTChaYAtMgFplAtMAInYigqYAVMAImAFTCgqZAFT
ACJhQVMAKmAFTACphQVMgCJhQtMAKmAETCgiYARMAWmFBUwAiZAETCgiYAq4AoA2AbTAFXIowoFJ
kAoAwAUmUCiAwAUmAKANgGEUYAYVBoAwAwAwgNNgCNpQYAYAYAYAaIg0AYAJuFGFBgBoIMIDQBgB
gBgBq4Am5UGAGBRhAaAMAMANgGJ2KBSZAbAMANgGwoVcINgGBRsAUmAKAFJgCiKFplAogFp3AFJ2
AFgCkwoUALTAFBQqLCBQUEWYBtMAWAbRFCwgUigWRQpFQKIowAwAUVQoiDADYUbAFRANtXAEFBog
NNACSg0QCWgDRQJaCBNgo0EGmgBAAhoAG0ADaKgG0ADaABtBANoAG0EA2gAbQANooBtBANoAE0EA
2gATRQDaCATQAJoIBtFANoAE0EA2gAbRQDaCAbQAhoAG0VANoAE0ACaCAbRADaABtBAhoAG0UA2g
AbQQCaAENAA2ioBtAA2gBDVgBLQAhoqBDQAhogENFAhqwAlq4GoQAIasAJaCBDQAhoAQ0AIaKAbQ
GoG0EUNoAQ0ADaAENAA2gLCGgjQbRQDaAENWANACWrAWEgUloASAaaCBNgrUJaCKQ0AJaAEAWNNA
aIAEtACSoCIihaAFoAWFBogB4kAaIUHiAHiyKDxAHEWFZpzFkEOYsKHMWAOIMKHMWRWacxYEOYMK
HEGQDiLChzBgSnEWRUOYMKHEWAOIsKDxYA4iyKwPFgDiLCg8WAOIsihxFgQeLCsjxYA4iyKDxYAe
LCg8WAOIsisjpgBEwAqACoigkQAsQAiCgqIAqANhQsIMChaCDYUKQQKCjYBgBoA0VkJI0ElZGPMA
GwAbABMAGwAbCATQACSAASRUAJIABJBA3kgAEkVACSAASQQAkigBJBA3kggbSRQN5oIG0kVA3mgB
tJFQN5IIG8kUDaSCBvJBA3kigBJBACSAAyQAFoIBtAAmgAbKg0QCSqNBBoAwgEtFAkAwAS0QGig0
AJaIBJQYAJaCBIUYwgQ0AaCiZ6O1vk+Nw8/q1qb7pJkrWPPzHoT+kbR/4in/AL5P/lG17zl03r+k
zj5jzFY7PCMsAetfA1+1dH8VT/45Xj30o/E8+fL6HQ9m/P8AIeSbHofPGWIC++C+fitM4N/8ct3p
ozlw7dL2oL3/AEhadtJ0ZccNH1TqGOnw6/SefkODnV5BoA9bdHl43oXNcKOI9VSbOF9p9DH2PlR5
Iseh88ZYA634EHbTdH7lX/Aznnw9HQ9oZ4b1/XdX7lL/AAIYcHX9ockOjgNAHrjS/k9CY/7mj/yt
geee09+XsfKfmPI56HgGAHb/AAAK+l5f828/8UDl1OHp+j8/IVjwuvW05i/vQ/5VxNYcOfW9qjm1
jbiMAPXHTv6Pohhlxo4T/DFnnx5fQ6nsT4QeRzu+cMAO/f0d6d9JV5cMM13zh8Dl1OHs+jc/IUTw
mSWL0vjPrRqy7Utvard3Ubx4cur5yootL6daj2+j18O3dz4XbNOQTRkleEtj9T4/HlzsDY9beE6X
zf0ZwtNq6thoNdVP8suZwx5fQ6vjGfIeR5ReFldPmnxX62rrR6HzhqvTStKPmy2cuK7PZZ7wUeh/
6PdPx+OxFbeqGrLrc4u/bq580+KOXUez6Nz8hy/wi1fl2lca/ShXmutRdn3W7uSN48OHV82/EUqh
9KvFvfnHr4duzrtuRpyCKE1Tdpea8pfritvq2AHrjwrzeiujeEpranh4cvJpt93knnx5fQ63jGfI
eR69NRacfNlmvh2bOe3ed3z6HeNXyuKrra3q1PvbpfiSvzkpbrCLfI9Af0dvp8TXlJeVSo6sX9mc
1K3Y43X3nyOXUev6Nz8hzLppilpDTGPoyeVSvOMW904Nxi+p5xe5KV9yN48OOd3lfi0oeDxDwFVO
SuleM4vK8XlKPLK64p57UbscpdDMbhngKjjF3WThLZeLzi+V1Z22p5bUQs0PW3herPCdGsPTlbWm
8PB2Vs1ByeX4Thhy9/W8Y/gkeVZL5ww1/ToZPnTk8n+GTtxtOK2RO7w8z4K1on9rU8K/7Szp/wC8
jfVX4k3DheUW/NFJ58DtX9HLC6+kcRV+rh3HtlOL/wArOfU4en6NPPySudeFScpabxjlk/G5dSSS
fdY1jw49X2qqt6bXyvUxa/tk9flVjbX77qfBa9txYxl58ja/rHB/8cwz76U3/lm+t+Me5A5nwHrX
phg44boxhsDJ6sq1PD0o/wC81VOKfJyik3uTb3HGcvoZzWEnwR420fjZaLrQqpXcJXcXsa3xfJq6
a4No9HL5sulH01gY4CvKMG3Tdp029rhNa0b87Oz4STW4kXKaHonwHYRaWx8cd6UMNKlU/wB5FwjG
X4qbWe+UZs5Z+Hs6E3d/clUzwm4z/aDSOkaO2VCoqlLqpwjTrRXZFTfBU3xNY+HLq3ut+4cu6PYu
GFrqNV2o1U6VV8Izy1vwu01zijdcMaqNxWHqaLrSpy8mpSm4u26UXbb1oqWaHsjp7jfkfRFOyhPE
U6LaWSUqso1JpLhnLLcefGeX0epdYfHX9lHlOp/Wej4y21MJPVf+6qttdkZ61+dVHZ4OZ8Fa6Lft
kqmCezEw1Yf72PlUrc3JeL6psUw8+PeOif0f8B8r03Gdv3NGpPvtD/OZ6nDt9Hm8kph4dq8q2na6
eyMKUY81qJv1trrRcOE+ke0sUrSv9Z4HD4nbOlfD1ey8qTfXFyguVIvDlfM38hnR1fONDE4J5ucP
HUv95RTk1203UXOWqWrj53P34Hq3Q2Nj0K6H0q04qS1IylF+mq1VNrtjK3UcL5r3Y3sw/frUeOuk
Gi/mXFVaCetGEvIl9aDzhL8UWn2nonl87KaqpjpH/WWGwuN9KUHQqv7dBJRfbTdPrakZnhrLzJfl
+A6Z4AYw0ljvk1XZSksVT5ShF02u1TTf3EZ6jv8AR/N180qT8LvSWOC6T0pTzpUKdOlVjxp1FJ1F
2wqNdxMJ4a62WsvgRwDTmi5aExVbDTzdKpKF+NnZNcms1yZ1nl5Mpq6VPdLV84UsJjt9Wj4uo/8A
jlC0H2uHi5PnJkjWfnV+78h6e6B0n0e6GVq8VadSliana9aEX3RT6jjl5r3dP7OH4o8o9DtJw0Rj
6NWp+6ctSrzp1E4VF/DJnazbwYXVbRWmtFz0Lia2GqedSqSg+uLav27SzyzlNXSrL0y/rClg8fvr
UFTqP/jmH+jd+bgqcn94mLpn51fu/LwkK0F/Wmi8bhdsqLp4qmvuvxdVfwzjJ8oC8mPmWfMRXQvS
sdDaRw9ap+7U1GpzpzWpUX8MmMpuM4XVKitPaKloLF1sLPzqNScHz1W1ft2ll2mU1dKtPTL+scNg
Mfvq0PE1H/xzDvxefN0/FvtJG8/Ml+78kjXRr+tNG6Qwe2UI08XTXOk9Spb8FRt/dJeTDzLPmIDo
hphdH9IYbFPzadWLmuMG7TXbFtGrNs4Xtsqm/SrQz6PY/EYTdSqzjF8Yp+S+1WfaJdmc7boWPpcv
nPR2jscs2qU8LU+9QleF+fi5wX4TMaz8yX5fgjOhX9ZYPSWA3zw6xFP7+Glru3NwdQUw8yz7t/gK
h0f0tLQOMoYuO2jVhU69WSdu3Yas2xjdXbaY8IGiY6E0piqMP3fjHKnb+7qeXD+WSJjdxepjq0iY
09/W2g8BitssNUrYSb32v46l6pTS6iTlrLzjL7tz9UZ4Nv6wljNHPP5XhKqguNWlatT9cGu0ZL0/
O575/SVzzCYqWBqQqwdpwkpRfBxd0bcpdKvnhUwsKWlq1amrUsUoYmnzVeKqP+ZyXYYx4dOrPPx8
/ikOa39b9G6cts8DjJQ6qWIjrL+em+8epfOPwv5nq5ibcWmAGAGAGrAGrAGgowAwAwAwAwAwAwAw
AwAwAwAwA3YINgGwDADADADYUYAYAbSIgUUGwoUkQCigwAUlYgFAH//S9ZHtfEflY0AYQGAGAGAG
AGrBBgBgBgBgBgBgBogMAMAMsAasAZYA1qgGWKDLAGrAGAGggwKMIDADADADADADADABEkECQDAg
wAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAywBqwBmqAa1QDNUA1YAywBoAwAwAwAwAwAwAwAwAwAwA
wAwAwA1YAwoMCDVgDLBRqxAaAMAMAMAMANpFAoIMANkUYAYUGwDCgwAwAwgN2AlbCIwA3YKNlBgB
gBgBgBgBgBgBgBhQYAbsRAqwBpoKEgG0ECgowAwAwAwAwA2VRsAUiIMAMAMAMAFEUYUGAGACkAbI
g2GhhpBgBgBtEULCDCg2RQpMAImAKCggAtMAWmALQAtEULTAFoAWALQULQAtABEyAWmALTCgqYAR
MAKmAFTCgqZAFTACJhQVMAKmAFTCgiYAVMgCJ3CgiYARMAImFBEwAiYARMKCJ2ACJkARMKFp3AFA
CkwDYBsAUmRRsoN3sAKTIDYBu5QKuQGwDdwBVwDYBgBgBgBgBlyAS2FCSoMAMAMAMANEQaANNgGi
qMAMCDQBhAaAMAMANXAE3uUGBBgUYQGgDADADAg0EG7hRgBsKMuUCrkBsA2AYFCrhBu4BsKNgG0w
BYAtMAUmRQpMAUnYAIAKTAFBQtMAUALTANhQQA2mALIBaKDaIBaKBQULRECkVQsgMAMAFFUKIgwA
2FGwBSANgGNXAENWKDCAS1cASUGiAS0AaKDTQQIsFGgg00AIYANoAG0EA2igG0ADaCAbQANoAG0E
A2gAbRQDaCAbQANoAE0EA2gATRQCaCAbQAJoqAbQANoAE0EA2igG0EA2gBDQANoAG0VAJoAE0ADa
IgG1cAG0AIaCAbQANooBtAA2ggE0AIaKAbQQDaAENXAENACGgBLRUCGgBDRAIKBDVgBLQGiABDVg
BDQQJauAIaAENAA2iihtXA0G0ECGgBDQANoAG0AIaA1A2gihtFAgAS0AJAEtAaJANNACQBLQQJaA
0S0BSGgBLQAmwGiWrgUkAQ0AKQAtAC0ALCgqADRZAHiwoPFgBokUHiwBxFhWacQZBDmDChzFgDmD
ChzFkGacRYVDiLChzFgDiLIocxYCnEWFZOYsgHEWFDiLAHEWFB4sgzTiLCocRYAeLChxFkAeLCg8
WBk4iwqDxZAHiwoPFgDiLCg8WQSjxYVBYgBUFBUAFRAEQAVBQSJAFiALChSCDYUKQQKCjYAsIMCj
YBoAwqBLIBIBoqBDABsAGwAbABsIBMADJAAJIqAEkAN5IIASQACSKgBJAAJIIASRQAkggbyQA3mg
gbTRUDeSKBtJBA3kggbSRUDeSAG0kVA3kggbyRQAkggBJAAZIADJAApIIBSABtACCoMaIBJVGgg0
AYyAQUGgDCAS0AJKDABDVgDQBgAhqwQaCjTQQJACUKviZxl9Vp9wUeq/6RFPXwuFnwqyXfG/uOHT
e/6TxB5PO7wDAD1r/R/+n0biqf8Ax5/zQivccOpy9/0fi/EeSju8AwAuXg8nqaXwb/4/TXe7GcuH
Tp8z4jqP9IeFsdh3xoW7pv4mOm7/AEnmfAefDq8gyxEHrXoj5fQ6suFHFe2TOF5fQw9j5UeSbHd8
8ZYA6v4E8tN0Pu1f+VcjGfD0dD2gfw4/8xqp/u6f+EYcH0j2hyE2841YA9badWr0Kiv+M0P+VsDh
PafQy/tv5T8x5Iseh88YFHdf6PcdbStV8MNP/HTOXU4er6Pz8hS/CrLX01i/94l3RijWHDl1vao5
6bchgB648KH7P0XwsOWGj3U7+44Ycvf1fYnyHkex3fPGrAHov+jpSvi8VLhSiu+X5HHqPZ9G5o5F
07ruWl8ZJbViatn1Ta9x0x4efqe1fjRWa0VNa8ck9q4P4Pau7dcrmFVfp1r+kvO/4XufPrAPWXhz
pulobDUltVWnlyjSmn7b9hww5fQ+kezP36DybS+nWpv9H4du7n1s7vnhNCSd4S82W/g9z+PLnYEH
pT+jlhnCpjpNWcVSj3ud/Yceo930b1+Q4N0pqt6SxNTfKvVknxvNv9dx1nDyZ3zfiIKvSStKPmy2
cuK7PZZ7zW2KCzpPF6sl50moy+89j7fanusF5Hq3+kH9Fo/DUY7FVvblCDj6tY4dN7/pPEHk2h9M
nT3vOPXw7dnXY7PngmBrxpScZ/u5rVlyW59adnztbY2Fg9Of0dsBLCvHOazTpQ7tdu3LNWOPUe36
NNb+Q87dK7VcbWqp3jVqTqRfKUnfud4vmuB1jx58tGWkF8rjHELbLyan31v/ABLO72yU9yLEvnyD
YOg9L040l+8pySjzhKVmvwyd+qUnsiOFnkerPDw4VMLhcHbOrOXi+U4RSj362pnkta+44YPf9I4k
SPIejsX8hqqUleOcZx4xkrSXam7Pc89x3r58ulax2Fej6rgnfVacZLK6ecZLrTTXWCzQ9Z+AXCxr
fK8bG303ik0vRmtfxi5XbUkt0ZRRwze/6POalebekWL+f3WxG2dOtPW506k3KL/DJuLfCUFuO08P
Hle7yqL0R+2wqYV7ZrWp/wC8gnZfiTlFLfJx4FrOPnwBdH63isTTTV4zfi5x4xn5Mkudnk9zs9wp
jyPUP9IrErCYLCYeOSdVyX/IONl/iOHTe76TdSJHmPT8VipQxS2V1rS5VFlUXa/LS3RnE7R4cvPn
3q3NfOOCT2zw0rP/AHU3ddkZtp86iW4pzPgPRP8ARpwzUcbV3N0YrrWu37Ucuq9n0Wc/JK8+4/Tj
hpSrjUtbWxFSbi9koyk9aL5STcXyZ014eS5ed/eqI01o9aMxE6UXrQunCX1oSSlCXbFp9pYzlNCV
0vQel44fEwznVSoz/wB7TtH+aDhJvfJy4Enhb51R6n8PGFUdEUsNTdnTlGoo/WhSWo0urxkZdSb3
HHp8vf8ASJ40keT+i+IjDEeJqO1LERdGbexKfmyf3ZKM/wAJ3rwYc/FULOFTRtVp3hUpy7Yyi/am
gzwPX3gT0VGeMxmkIJKniKVGcLbE6jk6kVyjODiuSRwzr6HQnm336SuCdO8f/tN47FrOVDF1ab/3
VWcp0u5qom+cUdcfDy9S93n76qt9F/21V8E/7ek3D/e0vLhbm0pU1981XPHz494hNDY+eisTSr01
eVOcZJcbPY+T2PkxYzjdUeuvD5OGhNCYfBUsoupTgl9inB+9ROHT819D6R4xkSPL+nf6xweExa86
MXh6n3qVnBvrpyjFfcZ3jw5eZL8lb0D/AFjg8XhH5yisTT+9RuppddOU5P7iFMfMs+f4Dsv9GjRv
jcZisTb93SjDtqSv/kOfUen6LPNqVyLwo4qeM01jZzVn4+UV92PkxfU0k1yN48PP1bvK/FTbpZ/W
FLCY5ba1FU6j/wCOULU32uHi5PnIsTPzq/d+Q3on+s9GYrDbZUJQxNPqv4qqu1ShJ8oC8k8yz3ef
0Hr/AKR4yn0J0FgcJWsqdXxGFrfcnBqq+676zzzzX0cr2YyfCMvCuk9Hz0TXqYeplOlOUJdcW0/Y
emeXy7NeG4tXTX9v+S49f8lOHhrv/jtL6Kfa9VTf3yYumfnV98/oWN6NXzpojFUPSwtSGJh9ydqV
X1uk+wl8UnmX7vP6Bl0DxsMFpGiqv7ms3Qq/crJ05PsUr9aLlwnTur/D8Sq1pDBT0bWqUKitOnOU
JLnFtP1o0xZpVx6eL5e8Lj1/yVYaDm/+OUr0ana3BSf3jOLp1POr75/Qka0V/WmhcXQ9LC1aeJh9
2f0NT1uk+wXknnG/d5/QMvB9joYDSeH8Z+6qydGrw1KydOV+pSv2DLhOndX9+pVW0lgJ6Lr1MPU8
+lOUJdcW0/YWMWaVc+n/APWEcFj1n8pwsFN8alC9GV+doRfaZxdOp51ffPy8JGtBf1pobH4bbLDz
o4qC32v4mp2WnBv7ovJPONnu1f0EV4P9Jx0PpXC1Z/u/GqFT7lTyJ/yyZcp4Z6d1YVBad0XLQmKr
YWXnUas6b/DJr3Fl2mU1dNRcunP9YYXRuO31cL4mf38NJ08/weLZnF0z8yX7vyI30T/rPRek8Htl
GnSxVNcHRnqzt+Co+4t5THzLPn+BVa6HaY/2f0jhcVeypVoSl93WWsu1XRbNsYZdtlWtdM9D/wCz
+ksVhUrKlWnGP3bvVfarMku1znbbCLN0t/rPROi8ZtlCFXCzfDxU9eC/gqLuJOa3n5kvySN+D7+s
MPpPAP8AtsG6sVxnh5KqkvwqYyOn53Pu/IrmRtxaaCDADADADADQBqwUaAMAMAMAMAMAMAN2AMsA
bsEGwDADADADADYUYAYAYAbSAFBBsKNoAUQGygUkQCgDCg//0/Wlj2PhvysZYA1YAywBlig1YgMs
AZYKNAGAGAGAGrBBlgDADADADADRAYAYAYAYAYAYAZYAywBqwBmqAa1Sg1YAwINEUYAYAaauEGrA
GWANWAMsAasAZYAywBgBgBoAwIMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMsAasAa1QDVgDLAGWANA
GAGAGAGAGAGAGAGAGAGAGWANFBgQasAasFGWIDRQLCDADZFGAGAGygwoMAMIDdgDYQYBlsijZQYU
GAGAGAGAGAGAGAGAGFBuxAKsAYAYAYAJaANhBsKMAMAMAMANgGyqNogNhBgBgBgBsijZVGBBgBgA
pAGyINhoYaQYAYAYRQREBhUGwo2FC07gC07hAuLChaACAC0yAUgoIALQAtMAUmFC0wBaZALTKBZA
LTACJhQVMAKmAFTACphQVMgCJhQRMAKmAETACphQRMAKncgCJhQRMAImAETCgqYAtMAImFBEwAiZ
ALTCgidwBQBtMAVcAwAUmAKuRRhQKTAN3IDYBtMAVcA2AbTAFJgGwDADTZAJuFGioMAMAMAMANEQ
auAJKowAwAwINAGEBoAwA1cASUGBBgBgUaIDADADAg0EGrlUaAMAN3AFXIDAo2AZcoFJkBsA2AbC
jdwg3cA2FCkwBYAtO4ApMihSYApOwAQAUmAKChaYAoAWgBaYAoKFp3AFIgFlApBQtEQKRQKIoWgD
YBgAoqhREGAGwo2UCkQGwDADABLRQaIDTVwBBQaANNEAkoNNBAhoKNBBpq4ANoAG0ADaCAbRQDaA
BtBANoAG0ADaCAbQANooBtBANoAE0ADaCAUkUA2ggE0ADaABNFQDaABtAAmggG1YoBtBANoAQ0AD
aKgG0QAmgAUkEA2gAbQANq4AhoIBtAA2igG0EA2gAbQANooBtBANoAS1cAQ0AIaAENBAlooENEAh
ooENWAsJaApDVwBDVgBDQQJaABtACGgAbRRqBtAUhoIENAA2gAbQAhoAG0BoNoqKQ0AIAEtACQLG
miCklAlogE2KBLQRSWgNEtACGgBLQAloDZLVwBIBoAWgBaAFhQRABYsgDxYUHiAHiyANEKDxAlOY
MKycxZAOIsKHMWFDmLIJTiLCsnEWAOYsKHMWQDiLChxFhWTmLIBxFhQ5iwA8WFDiLIM04iwqDxYA
4iwoPFkAeLCg8WBKcRYVkeLADxZFDiLADxYUOIsgUaLCsjoAKgAkQoKiAImAFTCgqYAREAQKFIIF
BRsAWggwKFxCDYUbANAGBBplAggNFQaYAOQANgA2ACYAOQQCkgAEkAN5IqAEkEAJIABJFQAkgAEk
EAJIABJFQN5IAbyQQN5IoG0kEDaSKgbyQA3kioG0kEDeSKgbTQA3kioASQACSCAMkAAkgATQQDaA
BNAA2UGgg00QGiqNBBoA00QCSg0AYQCWigSAY0QCCg0AY0ECAo0AaaCDQB608On7RobC1P8Aj1P+
alN+48/T5fQ+kezP36DyVY9D540FHq7+jrO+GxceFSD74v4HDqPf9G4o8sYqHi6ko8JNes7vBQAA
tXQWWrpXBf8ANzR/xozlw30+Z8YOw/0iY/tWFf8AxqX+I59N6fpPMHnQ7PGMAPWvQtX6H4j/AHOK
9kjz5c/g9+HsfKjyUeh4BgB1jwJq+m6P3av+CRzz4d+h7QL4cHfTVX7lP/ChhwvX9ociNvOMAPWv
Sb6PoZTXGjhv8cGcJy9+fsfgPJJ3fPGAHff6PML6Rry4YdrvnD4HLqPX9G5+Q514S5+M0xjH/wAe
ku7I3jw49X2r8RRrGnIZYoPW3hs+g0DhIf8AHaK7qUzz4cvodf2Z8vyHkg9D54wKPTn9HCleWNnw
VFd/jPgceo9v0b1+Q8+9Jqvj8diZ/Wr1X3zZ1jyZ834iKo1PFvPOLya/W/eish3g6DVeENqlKK5N
SdvWn1rrISD1B/SJxLo0MHFOzdScl+FJe849N7vpN4HlWvBK045Rl6nvXw5Nbzs8AVX+lXjFvyl1
8e3b133WAPVv9HmP7Jiar/vIRb5QjddylbqscOo+h9G4o8s1q3y9zb868pLqbu17128Tu8HIb4d+
M+je/Zylu79j7HuCCY6K0/HY/D0mrqpWpwa65pep5krWHM+I9Af0i8Y6c8DBblWk1xvqLPltRy6b
2fSbx8x5ir0vFPyfNecer4rY+aO+3hCsQvGWqL0tv3t/ft4Z23Ao9c+A2v8AJ9D4jEyWcZyV+Mad
OLV+q+r1JHnz5fR+j37Ox5Rwz+W0pUn50b1Id3lrtS1vw2Wcjs+fPJCNG1IuTpTdoVFqtvZF+jLs
e17dVyW8UjSe6D4afzvhKVmpfKIRkuWtaafZdMmXDfTnmfEdj/pH4vWxGDpL0IVJ/wATiv8AKY6b
0/SbwkcA0svlGriV/a31uVSNtfvup8FrW3HWPHferdT9uwyl6dDyXzpyfkv8Mm039qC3BeZ8B6o8
CEXo3QOJrq93UrTX4acUvWmcM+Xu6HjG34pXlDROKjhaq8Z+6mnCpv8AJlk3be150ftJHavBLpQa
1Gpomu431alKe1PfF5NP1p9pTgXno3oyOP01gpQSVOvWp1VFbElK84rlGUZRX2UnvM2+HXGbyn3j
q39JButUwqTuqUZay4eNfkvt8XLu5mOm7/SfT9/vhI4Bo39uw9XDPzorx1PrgvpEuuHlPi6cUdK8
k8+FN9BYqGGrqNV2pVE6dTlGeWtbe4u01zihTGj1j4IsLPoroPGVqi1ZwqV5P/kFBL1OLOOfmvf0
Z2435pXlHpHSTrKvBJU8RFVYpbE5NqcVyjNSiuST3nePBl+ai4z+sMFSrenQl4mf3ZXnTf8Aysjy
UYoF8z4C0+C2jHS2OpYKeydalVh96jLWkup0/GLm9XgYy8OnS83X3z+BXXvDrp6OA0ngac86cKc3
Uit9Os/FzXW4xaXMxhPD0fSMtWfvlI8waV0fLRVepQk7unJxutjs8muT2rkzvLt4bNeFTHSf9slS
xi/5KKalP/ex8ipfnJrxnVNEjeXnz7x6l8CmIlojo9XxU3lCVacb7owgnbq1lJ9bZwz5e7oeMd/F
K8t9E5fK608JLZi6cqS/3l1Kl/ykjFN8GztXgw93vVXsDjJ6MrQrU3apTnGUXwlF3XrRrlmXQ6Bo
/QMMTp/D0aS+grV6NWC4Up2qW/DFuL5pmd+HWY/a+cHYf6TGtUWDs/Jg6msuDnq6l+vUnbqZy6b0
fSvRI8/9Hv6ww2Lwb2ypqvT+/Qu5f8o3U7UjrXlx8yz5/gqJ6OaTWhsZRryV4RmtdcYPKce2La7T
V8s43V2PYPgd0P8A7F4DSFWpn4uvV8r60KMcpdTu2uR587t9Do49kvx/JK8rdL5vSkMLj3nKvS1K
j/45Reo+1w8XJ85HaeHhz86v78KHov8ArHReKw/pYecMTD7rfiqvfrU2+US+qTzL93n9AbwazvpX
D0mtaFeTozjxhVThLuTv2DLhelzB3T+k3pO7weFT3VKkl12jH/McunHq+lXiJHBenK+WVaGNWzF4
enUk/wDjkfoqna5wcvxI6YvL1PPn3z+hWYb+s9DVYelg8RGov93XWpPsUoU/4i+pPOPwv5qR4P6s
Xj44ebtDFQnhpf8AIaLjF9k3GXYMk6fOvf4WqbVpSw8nGSalFtNb00VzVc/CEvlOLhjFsxlGlX/H
JatT/lJGZMXXqc7982kKh/Wmg5LbPBYlPqp4iNn2KdNds+Y9TnH4X8/6gnwdSVXHrCydoYylUwz6
6sWod09R9gyOnzr3+CqLKMqMrO6lF9qaNOSrx4SYrEY2OMXm4yjSxH4pxtU/5SRmYxdepzv3yVI3
D+tdASW2eCxSl1U8RGz7Nemu2Q9TnH4X8/6gPwZVFPSMcLN2hjKdXDS/5DQcYd09V9hcjpc69/gq
g1KcqEnGStKLaa4NGnFV/wDCavleLpY1bMbhqNd/fcdSp/PCVzGLt1fN375KYt4T+tOj1eHpYLF0
6q+5Xi6crfihDv5j1WecfhfzX1B8F2JjS0rRpVH9HiVPDT5qvF0/bJPsLlwnS5+Pj8SqJi8NLBVJ
0pq0oScZLg07M042aV0Lwmft1TCY9Z/K8HRnN8alNeJn66d+0xi7dTzq++T+wkZoX+tOj+Oob8LX
oYmPVO9Gftg31cheVx8437rL+gjfBlpKOitMYSc/MlVVOfDVq3pyvytJly4TpXVhVY01o2WhsVWw
0vOo1Z031wk4+4s8ueU1dKjCorADQQYAYAYAYAasAasFGgDdgDLBBuwBsAwAwAwAwAwAwA2FGAGA
GAGAGIAURAoqjABSIBRQbSAFkBhQbsAf/9T1qex8R+VjADADADADVggywBgBoAywBqwBliAywUas
UGAGAGAGAGBBqwBgBgBhAaAMAMAMAMAMAMAMAMAMsAasAa1QDNUIEBBgBgBgBgBgBlgoywBqwBlg
DLAGrAGWANWAMANAGBBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBlgDVgDWqAasAZYA0AYAYAYAYAYA
YAYAYAYAZYA0VBgBgBsijADADZQYUGAG7EBsIMCjZArAMtlBhQYAYAYAYAYAYAYAYAbsAKsAYAYA
YAYAYAYAYAYAYAYAYAYAbANlUKRAYEGAGAGAG0RRsqjAgwAwAUEGyA2GhhUGFBgBhFC0QGyoMKDZ
FCkALTAFhQRAC0wBaAFoAWmQC07BQsAWncAUmFC0ALTIBaZQLTAFpkAVMKCpgBEwAqYUETACpkAR
MKCpgBEwAqdwAiYUFTACJkARMKCJgBEwoImAETACJgC0woImAETIAiYUETANgGwBSYBsA2AbuQCr
hRhQKTAFEBgApMAUAYAbTAN3Io0VBoAwAwAwAwA1ciBNwDRVGAGAGBBoA0QGAGmwDRVGggwIMCjC
A0AYAYEGrgGrlBoAwAwAwijQQbKDdwBVyAwKNgG0ygUQGwDADYUKTCDYUKTAFgC0wBSZFCkwBSdg
Am0AUmAKQUETAFJgCwoWncIFJ2ChYApMAWQCkygUFC0QCk7FAsgMAFFUKIgwA2FGygUiA2AYAbAN
ACWgDQBq1wBDVig0AaaIBJQaaCBLQUJCBLQANoAQ1cAE0VANoAG0ADaCAbQANoAG0EA2gAbRQDaC
AbQAJoIBtAAmigE0EA2gATQANoqAbQANoAE0EA2igG0ECGgAbQANoqATRADaABNBANoAG0AIaABt
BANooBtAA2ggG0ADaABtFANoIENACGrgCQBDQAloIENFAhogENFAhqwGiGgBLVwBAAhoIEtAA2gA
bQANoo2Q0ADaCBDQAhq4ANoAG0BYG0BohoqAbQAkA00QCSjRLVyATaxQasQCGig00EahDQFJaAEt
ACWgLCGgNEtXAEgCkALQAtBQRAC4gB4kAeLCg8QA8SKDRAlOIsKycxZAOYsKHEWAOYMKHMWRWDiL
AHEGFDmDIBxFhQ5gwM04iwocwZAOIMKHEWFB4sCHEWRWTiLADxYUHiwBxFkUHiwA8WFYHiwBxFkA
eLCg8WAOIsKDxZBkdMKCpgBUAETIoKgAsQAiCgsWQBEAKChYQYFC0EGwo2ggWFGwDADQBorISyKE
gGFQDYANgA2gAbABsIBNAAZIAbyRUAJIABJBACSAASRUAJIABJBA3kigBJBACSAG0kVA2kggbyRU
DeSAG0kVA3kggbSRQN5IIG0kEAJIoASQQAkgAMkABaCAckACkgAbQAkoNBBpogNFUaCDQBpkUJKg
0AYQCGig0AY1cgEFBoA00RAkqjQBoiD1n4WPp+jeFlzw776b+Jww5fQ63sz5fkPJh3fOGAHqP+jn
L6PGr7VH2TOPUe/6L6/Iea9LQ1MRVXCpP/EztHiy5EfYILL0Ly0pgv8Am5of8rIky4b6fM+MHaf6
RS+nwn+7qe1HPpvV9J5g84HZ4hoKPWvQryeiGI/3OK9kjz5c/g9+HsfKjyUeh4BgB1vwIRvpqlyh
U/ws558PR0PaGvDbK+m63KFL/AhhwnX9oclOjgMAPWvTX6Pohh1xo4X2RZwx5/F78/Y+UHko7vAM
ID0T/R2p3xeKlwpRXfL8jl1Hs+jc0ci6ez8ZpbGv/upqrum0bx4ebqc340VKxpzCoxc2ktrAPWX9
ISSo4DC01s8d/hg17zh030PpPE+I8lnd88YAerf6OlHVw+LnxqQX8MW/eceo9/0bijyzjKvyipOf
1pN97udnhtDaxUFp6IUljcdhaT2vEUtV9c1de9c+u5mumHmz4ju39Ieqq1TB0Xt1arT5twS7Ha3r
3HLpvV9J9B5ooySvCWSe3k1sfZv5X3nd4hqm/k8nGSy2SX64bVzQB618ENP5o0Biqr+vXnfio042
fVlc8+fmvodHxjfn+Q8k1I/J5JxeW2L5bu1bHzR6HzhmIgspx82W7g96+HJogL54OcL846YwUt/j
ouXXBOV+3Vv1pmcvEdulN5T4joP9IWqq2OowW2nQUn1TnJeqy71wMdN1+k8/IcEpfTRcN6zj7127
eyy2nV5AnDtSvB7Jb+D3P3Pk2CD1t0GitD9Eq1SomlKniW1seblDfvyOGXmvo9Pxh+I8lVIT0ZVy
flQacZLY98ZLk1Zrkejl8/gL0jRjCSnBWhUWtFcL7Y/haa5pJ7yFWOqeCrCfO2mcHX26rn4z70Kc
tWT+9lm83JTZjLxHfozeU/fotTfh5qx0hpCUV5+HpU784ybb/hco82pN7EZwb+keb8Eji+jP2uM8
M9s84f7yN7L8Sbilvk48Do809ym2jMRHC1Fr/u5JxmvsyybS4rzo/aSZUlHrnR8Z9D+iE3fVqKnU
8pcalRxTT6mrPecL5r6E+xh+/ejyTpijGFRVKatTqxVSKWxXunFfdkpRXFK+87×8/JRsf+20Kdf0
o2pVOuK+jfbFaq/3be8i3yOreAunHSOkqdOW3D+MrQ6pQ8XJd7g1w1XxMZu/0fzfglPfCxj1j9P1
cLJ+TKjToZ7FJpVIPlabV39XWW8YcNda7y18iOF4LEz0VWjUS8unJOz5PNNcHsa4ZHXl5Z4UbTOC
jga8owv4t2lTb2uE0pRvzs1fg7okMpoeudIY2WjuhmvPKdTDQj1+Mko3fFtO7e/NnD1fQt1h8keV
KP8AWGBnD08PLxi/3c2oT7pajS+1JnZ4OZ8Fa6N/tFSWFezEwdNffupU+ry1FN7ouRaY+73joPgH
0f8AK9Nwk1+5p1Jvu1P85jqcO30ebyKF4dsY8VpyrF7KcKUF1aql7ZMYTwfSLvIih6b/AG6hh8Vv
cPE1Pv0UlHvpumubUjUccvPn9+BmBXzhgK1H0qElXh912p1Uuv6OXVBsE8z4eR610VhqehuiVKhU
eqsRSjC73PFTspPq19Z8kcb5r6EmsPj+qPFNp4CpvjUpy7VKL9qZ6HzeFTvS6lH5U60FaniIxrxS
2LxivKK+7PWh+EzGs+fj5Ha/Ano35/xWExO2WBVaE/uzTdJ986q6ors553T09Cd1l920oPhR0l8/
aW0hgb3UcPB0/wDeUI+NfbqyrR62XHxDq3utn3fl5I4R0f0n8zYujiGrxhNOUfrR2Sj2q6fWdbNv
JjdVSdP6L+ZsVWw97qnOUYy+tG/ky6mrNdZJTKauh7E0xpKeiuhiqTyqVcJShzl4xRhd89V3Zwnn
J9HK6w+SPKejf6y0XiaHpYecMRD7srUqvrdJ9UWd7y8E8y/d5/RQehOIjSx1OnUdqVdSoVHuUa0X
Tu/utqXWhkdO+fj4/EX3wH6BnV6QQjUWeGVWc1wcVqeqUkYzvh16GP2vglPP6RU51NMR1vN+TwUO
pSnf+bWQ6fC/Sfa+RHPP+YnobjLB4j/lHiI+xTp98+Zv1cucfhfz/qVroF+04qeDezGUalD8UlrU
/wDlJGBMjp86980KXRqyw01OLtKLTT4NZo25Nrf4QKMVpCdeCtTxMYYiNtn00VNrsk5R7DOLp1Of
j5/FILjl85aFoVPSwuIqUX9yqvGQ/mjV7ycVb5x+F/pGugX7ZUxOCf8AyVYWrGK/45TXjqfbrU0l
1lyOn53PfP6SqZg8XLAVYVoO06coyi+cXdGnOXSrR4RMJHC6Urypq1OtJV6fDUrRVWNurWt2GceG
+pPP79fKQ60r/WWhMJW9LDVq2Hl92dq1P1up3E9VvnGfdbP1GvB/+2vGYF5/KcJVUVxqUrVodv0b
S6xkdPzue+f0lUbA4yWjq1OvDz6c4zj1xaa9htzl0q1+EnBRwelsT4v93Vmq0Pu1kqsbdkrGceHT
qTVv758pDzS39ZaCwVbfhq9fDy+7O1aHrdQTky84z7rZ+ozwcr5bPGYHb8qwdaMVxqUkq0O29O3a
TI6fnc98v9lquf4PFSwNSFWGUoSUovnF3Rtzl0q7+FHCxoaXxE6a+jruNeH3a8VVy/ia7DOPDp1Z
5/j+KQ60h/WXR3C1N+Exdai/u1oqrH+aMx6l84z7rf4+T1Z4LV8rxdfBf81mExFFfe1PGQ/mgrEy
Ol5uvfKVzWnUdGSlF2aaafBo25NOj+Fmmp6VniYK0MXTo4mP/IWnGT/m1jGPDt1ed+/VZjmptxaY
AYAYAYEGgDADADADVgDEAbAMAMAMAMAMANgGBRgBgBgBgBgBuwBsiDZQbCjABaIDZQLRAbKDaVwB
ZAf/1fW1j2viPysZYA0AYQGAGAGAGAGAGggywBgBgBgBogMAMAMsAasAZYAywBlgo1YoMAMANWCD
LAGWIDQBgBgBgBgBgBgBgANhBoIMAMAMAMAMAMAMAMAMAMAMAMAMsFGrAGWANWAMsAZYA1YAywBg
BoAwIMAMAMAMAMAMAMAMAMAMAMAMAMANWAMsAasAasAaAMAMAMAMAMAMAMAMAMAMAMKDZQYQCrBB
gBsijADAJWyiMKDADADADADADADCA2kAKsUGAGAGAGAGAGAGAGAGAGAGAGAGAGAG0FGwBQQYAYAY
AYAbIo2VRgQYAbQBsINkBsNDCoMKDADCAIRRhUGFBsijYAtAC0wBadgoWALTAFpkAtFULTIBaYAp
OwAsAWmFC0wBaAFpkAtMoFp2IAqYUETACpgBEwoKmAETIAiYUFTACpgBEwAqYUETACpkAtMKCJgB
EwoImALTACJgBEwoImAETuQC0woWmAKuAbAN3AFJgGwDYBtMgFBRsoNpkAoAwAUmAKAMAMAMAMAM
AMAEtkQJKowAwAwAwINAGiAwA1cKNFQaAMCDAo0QGAGBBq4Bq5QaAMAMAMIo0EGgDAg2FGAGyg2m
AKIDAo2AKuAbANgGwo3cIFJhQpOwAsAUmALTIoWmAKTsALAFp3AFphQoAWmAK2BQQAUmAKIBaKBa
ZFC0ECkUCiKFoA2AbKoWiIMANhRsoFIgNgGACgo0AaCDTQUJKg0QCGrFBgAlogElBqwQJsFCQgQ0
AIaABtAAmioBtAA2gAbQQDaABtAA2ggQ0ADaKATQQDaABNBANoAE0UAmggG0ACaKgG0ADaABtBAJ
oAG0UCGggG0ADaABtBAJoAE0ADaCAbQAhqwANoIBtAA2igG0ADaCAbQANoAQ0VANoAQ0AIaAEgCG
gBDQQIaKBLRAIaKLCAKQ0AJauADAEtWCBDQANoAQ0BqBtAUNooENBANoAQ0ADaABtAahDQFDaKgS
0QCSg01cgENWKNNEAhqxQaAEtACWgjZDQAloAS0AJaA1CGgK01cA0gBaAFoAIgBaCg0SAPEKDRAD
xZFB4gQeIGTiDIocwYUOYsAcQYUOIsDJzFkVDiLAHMGFDiLIocxYEpxFhUOIMgHMGFDiLAHEWFDi
LIMDxYUHiwBxFhQeLIA8WFB4sDJxFhUHiyAPEKHEWAHiwoPFgSnEWRUFiAFQAVMKCIgCpgBEFBUw
AqZALChSCDYUbQQLCjYAtBBgUbANAGBAlgCQDRUCWADYANgApAA2EA5AAZIABJBACSKAEkEAJIAB
JFQN5IABJBACSAASRUAJIAbTRUDeSCBtJADeSKgbyQQNpIoG8kEDaSKgbyQA2kggBJFAGSCAMkAB
aCATQAJoAG0AIANFQaANNEBoqjQQaIBLQUaKg0AYyAQUGgDTVyASUGgDTRECSqNAHrLwg/S9FMNL
/jeFf8i+J58eXv6nsT5DybY7vnjAD05/RyeWOX+4/wCchx6j3fRvX5fqPPGno6uLrr/jtT/EzrHj
y5ETYrIsnQ3/AJieDt/zU0f+VkTN4dMOZ8YO2f0iv32E+5U9sTn03p+k+g83nZ4hqwB606IeT0Pr
/wC5xXtkcLy+hh7Hyo8l2O754yxQdh8BcL6Zi+FKp7Ec8+Hp+j+0I/w0PW05ieSpL/lFBjDhnr+1
fl+Q5bY6OAywB608Jn7P0XwsPs4aPdC/uOGPL6HV9ifIeSju8AwA9L/0cqV542fCNFd7n8Dj1Ht+
jevyHB+lVXx+kMVP62IqvvmzrOHkz5vxogCsiR0RR+UYmjD61SC75JEq48j0p/SNq2p4KHGVV9yg
vecem9v0n0+Y8tHZ4RqwQetvAh+xaExVb/jtV9kacfzOGfL6HQ8Y39+g8knd88YAXrwZYf5TpnBx
4VVL+FOXuM5cOvSn2oOjf0hqjnj6Ed0aCvycpz9tvUY6bt9J5+Q4TV+njr71lL3S7d/PPedXlGpL
x8b+lFJPnHYn2bOq3BgHq/o0no/obUlvnQxH80pxOF5e/Dxh8qPKFFeOjqb9seveu3dzSS2s7vAE
4fy7weyWzk9z9z677gDqvgQw7npun9iFRtfhcfazGfDv0J9oL8NeO1tOVN/i4U4tcnDWa7dYYcHX
v2hyOpF4afkvZZxfrT/W82843iIK6lHzZZrlxXZ7LPeCj1p0gm9F9DYJ5SqUaPb4ycZPtabb5nCc
voZeMPlB5Vn+10VL0qWT5wbyfY8m+Eorcd3g5GYVfKqUqPpRvUh2Ly12xWt+Cy2hZ5HZv6PVB1NJ
1ZejGhJ/icopdtnLvfE59Th6Po08/JVU8JeltbT+Kq21oxmqclxioKElyurq+69zWM8MdXL7VWOd
4qjLR1ZxjLOLTjJZXW2MlwurNGnG+A40tTUpqtFJQqrXSWxO9pR5JSTsvq6r3khR6o8Jzeh+i2Hw
72yjhqT64x1n/gOOPL39XxhJ8EeWaC+WYadP0qT8ZH7rtGa5+jJcEps7vDzFZoT9olLDPZXWrHlU
WdN9r8lvdGUhTH3DuP8ARywHjMbia9v3dFQ/jlf/ACHLqPV9GnmpXLPCXXliNMYyUsn412+6rKL6
nGzXJm8eHDq+1VQenv2mUMSv7eOtL/eLKp2uS17blJFjGXv943Wj84YOE1nOhLxb+5O8od0tdN84
oq8z4D1n4WcHHBaBpYBO1RRgoLc/EQ1pL+GLtxdkcMOXv601jr9+EjyFoHFwweIi6n7qd6dT7k04
yfWk7rmkztY+fjdVTLFYepoutKnLyalKbi7bpRdsn1oqWaHrDwJaMVbG4vSEVaNalSlHheo5Ooly
jOEorkkcM69/Qnm1K4Z4Qsd/tDVq4tZunia1F/ccpTot839IuqCOuPh5epe7z99VWNDft2HxOF36
qrU/vUruXZ4tzb4uKNVjHzLAHoviFQxlJT8yo/FT+5VThLttJtc7EqY8j1D4faq0PojC4KDtepBL
7tKDXtcTl0+Xu+keJIkeY+li+UVo4pbMVTjWf33eNX/lJGfZY7R4s/Pn3qVX/rDRtOfpYWq6b/3d
W84dilGpf7y7XqXzPgO//wBGjBSXy2s/N+igub8pvuy7zj1Hq+izn5JXCdJ9JH89VNILyl8qlUS4
x1/N6nHLqOsnh5bn9rf3qgekOjFofF1qEXeMJtQfGG2Eu2LT7TUrOU1RN6bw8tMxwVeGc61ONCX+
8otU0v4PFN9ZmNZTevw/Aeo/DrhFh9C08LSdvFOE9XjTp6tN9zqQZxw5e7rzWOv37v1SPKPQirGO
OhRm7U8QpYed9iVaLgm/utqXYd8ngw5+PhVXq05YWbjK8ZxbTW9NM058D2v4INEqvjcZpS3k4qlQ
nF/aqJyrLsqJrsPNn7n0+jPNvv0ledem2lP9rMPVxid3Rx1aP/IKvedNdScJ951x8fg8md7pv77/
ABVXehP7XPEYN/8AJThqkYr7dO1aHa5U9VfeNZOeHnx75/SKto7Gz0ZWp14efSnGceuLTXsLfLEu
hO9OcDDAaRxCp/u5z8ZT/wB3VSqQ/lkiY1vqTVah5pv+sdF4HE7ZUnVw03yjLxsL9lSSX3eQnK5e
ZL8Z+v6jfRH9uw2Pwe+eH8dD7+Hkp/4HUFMPMs+78hXujmlXoLG4fFL+yqwm+ajJNrtV0LGMbq7U
TpbolaDx+Jwy82nVmo843vF9sbMsu1zmroTfSpfOGA0di9/ip4ef3qE7x/knBdhmNZ+ZL8vwRnRb
+sNH6Rwm9U6eJh10Z2l/JUk+wtMPMs+f4CC6H6VWgtI4XEvzadaDn929pLti2hZtnC6spTTpPol6
Cx2Iwr/sa04LqjJpPtWZZdplNXSrJ0z/AG/B6Mxm+WGlQl97DzcV/JKmZjefmS/dr8EjOi39Y6L0
nhNrjClioLnSnqT/AJar7heVx8yz4X9/iIToPpX5j0nhMQ/NhWg5fdbSl/K2aym4xhe2y/e0j+lG
ifmLHYnC/wBzWqQXVGTS9Ql2mU1dLFr6a/t+B0XjN8sNLDy68PUcV/JKHZYzj6umfmS/dr8EjfRD
+sNGaVwm9UaWJj10aiUv5akv0heYYeZZ8/wKrXQzSvzHpLC4m9lTr05P7qktb1XRqzcc8Lqy/etZ
0z0V8x6SxeGSsqVepGP3VJ6vqsJdwzmrZ95Fm6ZL5w0VonF7ZKlWw0v+QNRuK/hqIzOa6Z+ZL8Z+
CRzE24tMAMAMAMAMANBBgBgBgBgBgBlgDYUYAYAYAYAYAYAYAYAYAbsAbCDYBsKMANogFlBtACyA
2lcoFEBsA//W9cnsfEflYwAwA1YAywQasAZYA1YKNAGAGAGAGAGAGAGAGrBBlgDLEBlgDQBgBgBg
BgBlgDVgDLAGWCjVig1YgMsEGAGgDADABMgBIBgQYAYAYAYAYAaAMCDADADADADADADADADADADA
DADLBRqwBlgDVgDLAGrAGAGgDAgwAwAwAwAwAwAwAwAwAwAwAywBqwBqwBqwBlgDQBgBgBgBgBgB
soMQAoINkUYAYAYAbKMsKDADADADADADADaRAKsAYUGAGAGAGAGAGAGAGAGAGygwgNAGAGAGACgo
2gDYQYAYAYAbIDYaGFQYAYAKCDADZFGwowqDCgwAwgCEUYEGGgbIowKFoIFJgCwoWncAWgBYAtMg
FoKFgC0ALQApBQtBAtEULRQLIBaYASLACJhQVMAImAETCgqZAFTACJhQVMAImAFTACJhQRMgCJgB
EwoWmAETACJhQRMAImALTCgiYARMgFphQoAUmAKANgG7gCrkBhQbTAFXIDYUbTsUCr3IDYBtOwAq
4BsAwAwAwAQ2RBoqjADADADAg0AaIDVwDRVGBBoAwIMIo0AYAabCDVyg0AYAYAYRRoIMANBBgBgB
q5VGyA2AbAMuUCkyA2FGwDaZQKuQGwDAo2ALTuAKTAFgC0AKTIoWAETAFJ2AFgC0woUgBaAFJgCw
oWncAWmALIBSKBRFC0wgWmFCgDaKoUgg2QGwo2UCkQGwDABSCjbQAkA0EGmgoSVBogEtWKDQAlog
ElBqwAloASwBDQQDasADaABNFQDaABtAA2ggG0ADaCAbVwBDQANooBNBAJoAG0EAmigG0EAmgAbQ
AJoqAbQANoAG0EAmigQ1cIBtXABtAA2gAbQQCaABNBANoAQ0ADaAENBAJoAG0UA2gAbQQDaAENFA
NoIBgCWgBDVwBAAloAQ0ECGigQ0AJaA0QAIaAENXAEACGrBAhoAQ0ADaA0Q0BQ2igG1YIENAA2gB
DQANoDQbQRSGigTYgEtFBogsJasUUkgEtFAkAS0BYTYI0S0AIaAEtACWgNkNAGgBSAFoAIgBaCgk
QA8WRQeLADRIA8QqDxAycQYUOIsihzFgDiLChzFkGacRYVDiLAHMWFDmLIBxFhQ4iwrJzFkA4iwo
cxYA4iwoPFkGaPFhUOIsAPFhQeLIA8WFDiLAlHiwrI8WAOIsig8WAHiwBxFhSjxZFZHiwAiACphQ
VEASIAVMAImFBUyAIgBSAFAGBQRBBgUKiECgo2gDADQBorIQRRoqDTAENXABNAA2gAbABsIBSQAC
SAASRUAJIABJBA3kgAEkVACSAASQQAkigBJBA3kggbSRQN5oIG8kVA2mgBvJFQNpIIG8kUDaSCBv
JBACSKAEkEAZIABJAAmggHJAApIAG0AJKDAg0QGmgo0UGgg0QCWFGioNAGmiASUGgDTVyASUGgBL
RECSqPWfTP6TohQfCjhf8qOGPL35+x8oPJh3eAYAemv6Obzx3/ID/nIceo9v0b1+X6jz90i/4txH
++qf4mdY8mXN+IhisizdC1fSmC/5uaH/ACsiZy4bw5nxg7P/AEif+KMJ/u6ntRz6b0/SfQecjq8Y
wA9Z9G/o+hlR8aOI/wAc0cLy9+PsfKjyYd3gGAHavALDX0u3woTfrivec8+Hp+j8/IV3wu1PGacx
T5013U4IuHDHW9q/v0HNzbiMAPWfhn/Z9A4WH/HKK7qU/gcMOXv6/sz5fkPJdju+eNWAPU/9HSjq
0cZPjOku5S+Jx6j3/RvUeZNJVPH16k/rTk+9s7R4bQysVBZuhVD5RpPBw44ijfq11czlw6dPmfGD
tH9IuvrV8JDhTqP+Jpf5Tn03p+k+g84HZ4xgB626B/1f0SxFX61PFSXXaUV60efLl7+n4w/EeSTu
8AwA6r4FcN4/TdB/UjVl/JJe8xnw79CfaEj4bMZr6anF5xjSpwa5Na3vuuZMOF69+0OQq+FnZ5rf
zT/LNcDo8/Ax/ss7rNbuafxWT4bAnA9ZdI5/M/Q+nGGTlSoat/tzjPPsvc4TzX0MvGH4DyZWjqNS
jknmuXLs9lnvO7543iFrWmtktvJravY+224LR33wAYb5Tj62I3xoOMvvSlGz7VF9bucuo9f0ebu/
uHO/CbiVpHSuMmtsKzg+qNop9jVn+E3jw49W7t+Io0V46Ft8c11b12berWZpyGqC8cnT37Y9fDtW
Vt71Sg9aeGW2jNCYXCOyvOlT6tSnLPquo35XPPhy+h1/GMg8l4St8kqeWnq5xmt9nk+3hwaT3Hd8
+eBklPRlbJrWhJNPc7Zprink1xQOB6i8AOjI0p4zERXkTVLxfJPXclfk/JfFo49Svd9HnN+A89dM
a8dJ4qri4ebWq1G1wkpZ96cZdcmtx1xeTO7u2kTW/bMPGfpUnqS5xd3F9j1ot7lqIrPMEh0fwT06
44Nec6kZQ7WozS61aXJQ5kvhcZvwPTnh1xcXTwuBytXdS3KUVHxb5eU0m/quRxwe76ReJ70jyVo/
FfN9aM2rpNqUdl4vKUe1NrtO758ulax+Fej60oJ31X5MlldPOMl1qzXWC+B7A8C9CGGweK0i7KNe
SnLk4R8vLctZz1V9Wxwz9z6PQ4t96V5R0tXlpejHFSzqRk6dR9d5wb61rRXBQR21p4L58qDgv23C
1aPpU346HVlGol1rVk+VNhJ5gnPBzCOK0lRw1RN068owmlykpxfZKMW+V0TJrp+br3jtv9IHTksB
i8BGHnUtarZ7HeUUk+XktdTZz6cer6RlqxI816bwMcBiJwhnTupU29rhNKUG+bi1fmdpXjymqp5p
39rjRxX95DVn/vKVovtcdSb5zJFy949S+BmtLQnR6vi57IyrVI33RhHZ1ayk+ts45+a93Q8Y7+KV
5d6Pv5a62Fefj6ctX/eQ+kh2uzgvvs7V4cfPj3qitD4/5pxFOva6hJOUfrR9KPU1dPky8s43VF16
IdHb9IKGD86MMQnf60IPXT6pRV+pmcr4dcMfta+8dL/pJYyVTFYWjbyIUpyT3a0pJNdaUY96MdN2
+k3zEjiSXy/Rr+thq1/+QdZeyMoLtqHT1eXmfC/mrXRb9qlWwj/5KKM4x+/D6SFublBQ/Ey1cPPj
3z+keovBJNdE+jNbHyWb8dWXPUWpFdrhl1nDPzXu6P2cd/FK8m9I9HR0Vi61GGdNTbpvjCXlQfbF
pnePn5TVVIdI18toYTF750vEzf26D1V/yjdIkXLzq/vwL/4HNHLpHiKeFe3D4mnio/djdVF2tUu4
zndO3Rnd4912ldI8LWl1i9PYbAN/Rzw86MuClibxTfU1Tl2IxhPDt1st5Sfd+Y8mtSw098Zxfamj
u8HCrP05gp42WIirRxMYYhW41YqUl2Tco9hMW+pzv3+R6r6AY6fR7ofLEzdnGliJU+2U1BdsnddZ
wy817+ne3DfxR5Y6JftlPGYP++w8pxX26Fqqtz1Yzj+I75PDh53Pu/Lyqv6D0m9CYujio7aVSE+v
Vadu3YW+WMbq7DnpXoxaGx+Iw8fMhVkoPjBu8H2xaYl2uc1RLdJ/23B4DFb3RlQn96hJpf8AKOVN
dhI1n5kv3a/AZoJfL9GY/D7XT8TiYL7kvFzt+Grd8o8iXkx8yz4X9P1aMugmOjo/SeGnP926ihU+
5U+jn/LJly4Tp3VhVf0lgZaMr1KE/OpTlCXXFtP2F5Ys0q2dO18reExm35RhKTk+M6V6Eu36NN9Z
nF06nnV98n9j9EjNH/t+g8TT34bEUay+7UUqU/WqZfUnnG/dZ/YAvBvVjHSlGlN2hiFPDy4WrwlT
z7ZJ9gy4Olz8fH4lUetRlQk4SVpRbTXBrJmnJV58JH7TiqOL/wCavC0Kz+9qKE/54SMYuvU5375E
jVH+sej9SO2WExkJ9UK9Nxf81KPePVecfhfz/qCfBfJVdJxw0vNxVOth5f8AIWnKMf5tVjLhOlzr
37hXP5RcG08mtptyajoXhRXynHQxe7F4bD1+2VNKf88ZdpjF16vO/fJSMpf1j0cmtssJjYy6oYim
1/ipLvHr8l5x+F/P+o9WvBTJVdKQw0vMxVKth5f8hacor+bVGXB0ude/cK5zODg2nk1k0bcWnSfC
r+1Y6ljP+azC4av2umoy/mjK/Mxi69XnfvkrMbwv9Y9G60NssJjadTqhXpuD/mhEevyJ5x+F/M9X
Mzbi0TYA0FGAGAGAGAGAGggwAwA2FGAGAGAGAGAGAGAGAGAGACkiINlBgBsKMAMAFogNlApEAooF
IgFAZ22VUf/X9cnsfEflYwAwAwAwAwAwAwA1YINWAMsAasQGWCjVigwAwAwAwAwAwAwAwA1YgMsE
GAGgDADADADADADADVgDLAGrAGWAEtACbBBlgDLAGWANWAMsAZYA0FGAGBBgBgBgBgBoAwIMAMAM
AMAMAMAMAMAMAMAMAMANWCjLAGrAGrAGAGgDAgwAwAwAwAwAwAwAwAwAwAywBqwBqwBqwBoAwAwA
2kUCgg2RRgBgBgBsolYURgBgBgBgBliA3YAVYAwAwoMAMAMAMAMAMAMAMANgGFBgBsKNEQaAMANh
RsAUEGAGAGAGAGyKNlUYEGAG0AbCDADZFGwowqDCgwA2iAWQGAGGgYAbI0FIINgBEALTChYAtAC0
QCyqFogFIAWgBYAtBQtAC0ALTIBSKBaIAiYUFTACJgBUwAiYUFTIAiYARMKCpgBEwAiYUETACJkA
RMKCJgBEwAiYUETAFpgBEwoWmAETACJ3IBaYUKANpgCkwDYBsAUmQGyg2AKTIDYUYAKuAKAMANpg
Cr3AMbAEAGAGAGAGAGBBoA0QGrhRooMCDQQYAYRRoAy4AlsqDQBgBgBgBoijAg0EGAGXKo1cA0AY
AauAKuAbIDYBsAy5QLTuQGBRu4ApMA2AbANphQtMAWmALTsALTIBSYULTAFp3AFpgCkFBEwBSYAs
KFphApZBQsgFplAtEUKQQKRQLIoIgDaKBSCjZEGwo2UCkQGwDABSKoURBpoKEgGgg00FCSoNEAlq
xQaAEtEAkoNACWgBLQQDaABtAAmggG0UA2gAbVggG0ADaABtBAhoAG1coBNBANoAE0ADkggE0UAm
ggG0ACaABtFQDasADaABNBAhooBtBANoAG0ADaCAUkADkgATQQDaAENXAENAA2ggE0UA2rAA2ggG
0AIaABtFAhq4QIsAIasAIauAIAEtACGggQ0UCGiAS0UaIAENACGrgCABDQQIaABtAUhoo0G0ADaA
ENBANoAG0AIaAsDaA0G0AJsVBogEtFAkg1CWigSAJaIBJQJaA1CQKS0ECQBDQFhIGiGgDaAFoAIg
BaChaADRIoPEANFgB4kUHiBgeDChzFkA4gwocRYA5iwqU4iyDJzFhQ4iwocwZAOIsKHEGBk5iwoc
QZAOYMKHEWFB4sCU4iyKyPFgB4sAPFkUOIsAPFhQeLCsHEWAHiyAPFhQ4iwA8WFB4sgyPEKDJgBE
wAqZFBEwAqACRACxZFBYgCgoWggwKFIIFBRtBAsKMANsA0AYVAlkAkA0VAhgA2ADYAJgA2EA2gAE
kABkioG8kAAkggBJAAJIqAEkAAkggBJFACSCBvJADeSKgbzQQNpIAbyRUDaSCBvNFQN5IAbTRUDa
aCAEkAAkUAJIIAyQAFoAG0EAmgAbQAiwBooMCDRAaaChJQYEGiASFGioNACWiA0UGgDTRAIKDABL
QQeseliv0Oo/7nDe2J557T6GfsfgPJh6HgGAHpv+jmv+Lv8AkB/zkOPUe36N6/L9R586Qu+MxH++
qf4mdY8mXPzEOVkWroNHW0rgv+bmj6pozlw30+Z8YOv/ANIeV8VhV/xqX+I59N6fpPMHnY7PGMAP
WejfoOhb/wBzV/mqy+J577T3z2Pl+o8mHoeAYAd3/o+076TrS4YaXrnT+By6nD1fRufkKJ4T5+M0
zi3/AMct3JI1jw5dX2qKGacgqMXNpLawD1h/SCl4nA4amtnjf8MGvecOm9/0niDyad3gGAHrPwC/
sui8VW4Vpfy04v3nDPl7/o/iUeTHmd3gGrBBffBfh/lGmcJHhU1v4U5e4zlw7dKfagvP9IKv4zSd
KH1cPHvc5/kZ6fDp9Jvn5DhFjo8oyxQetP8AmGdCuuj/AMrKv/LR5/5z6HHT+X6jyVY9D540FHdf
6P2G8bpSrPdDDy73KC9lzl1OHq+jzz8hS/CriflemsXLhNR/gjGPuNYcOXVu8qKRH6eGr6Ubtc1t
a7NvfyNOYyn9PHV9KN3Hq3r3rt3sIPWPhkpfINB4bCrKWvSilx1Kcrr1K3PI4YcvodfxjIPJtBeN
Tp8fN+9+ezrtwO7541h3rXg9kvU9z9z5Ngg9Of0dMG4QxlVrbKlDuUm/ajj1Ht+jTkeddL4x18bX
qyz16tRyX3pNv8ueZ1jx5XyIx3wk+Nu5r4NeplZ4EzoDAfK9IYajG9qlakovlKSXetj4NMlbxm7P
iO+f0jcXf5HRX/HZv+VL3nLpvX9JvA804heNSqccpda39qs773c7PFQet+00Yz9Kn5Eup5xfZnHk
lFAo9V+Bqb0P0fxGKlulWqJ/ZhBe9SfacM/Ne/oeMbfiPK2j/wBpjOg9s1rQ+/G7S7U5RS3ya4HZ
4IsI0XVjCpqTdoVE4SfBPY/wtKXO1ikVc/Bho6dTTmFpO6lCq3JcPFpya9VjOV8OvSn2oLt/SGx3
jtJUaSeVOgn2ylL3JGenPDr9Jvn5JHGdMrx0o4hbK0dZ/f2T/mTklujKJuPNl71bxf7Zh6db0qf0
U+rN02+ta0VwUEC+YPU3RmL0B0OqVNkqlGtLtqNwi+6zON817sPs4fKo8t6EXyiU8N/fRcY/7xeV
C3NtanVJnavDj7lMtE4xaPrwqSV4p2muMJLVmu2La7S0l0Or+CDQTh0hjTl5Sw6qybWxpJxjJcm5
JrsOed8O/Rx+18Epfh9qyq6Yz82NGCj1Xk362xhwfSPa+RHMsb+24SjW9Kk3Rn1Zzpt9ac4rlBG3
C+YreAXy3CV6PpU9WtDs8iaXWpRk+VMLPMHrXDYWGiOidHDT8l4ijGnHdaeJldN8k53fJHDmvfJr
DXv/AFZeMcJiZ6MrQqw8mpTmpLlKLuvWj0PnS6aP+kWEhg8VUVNWpyanTX2KiU4fyySfMkXKao79
4GNGfO+kKGP/ALvCzpyf/HKbjTS/5NSh6znnfD1dCbu/u/f8EqseFrSX+0GLx0Fn8jq03DlBxjSq
/wA6p97NYTTHWvdb939RHMeif7RWnhXsxNKdJLjN2lT/AOUkYGq44e73qg9H42ejK1OvT8+nOM49
cWmvYViXQ9keFV0ui/RlYagtWFR06cFvs34x+qLucMPNfR6v2cdJHlPT/wC2YfCYre6bozf26Dsv
+UcqSO8eHLzJf34VmA/btG4il6VCdOvHlGX0VTvcqXcS8pPMv3ef0HX/AOjdo11tIYjEejToavbO
Sa9UGY6len6NPPySubeFDTEtI6cxdaLs4VtSL4eKtBW7Y3N4zw49W7yqoXptSisdUqwVoYhRrxts
SrRVRpdTk49hYx1Ofj5/EE0mvnDRmErLOVGdXDy42uqtPvc6iX3ScVb5k/D9R618IOi1ojoutHp2
qKhTSXHxKjUqeqEmzjjfL39Saw1935I8a9FdJLQ+Ow9eXmQqx11xg3aa7Yto9Fm3zsLqqZ6c0Y9D
YqthpbaVScH+GTV/UJ5TKauhP9Mf2uODxf8AfYWCk/t0W6LvztCL7SYt5+dX7vy8DMF+36GxFP0s
NiKdZfdqp05/zKkPUnnH4UZ4PpKppCGHl5uKhUw7660HCPdJxfYMjp869/j8VUmUXSds00+1NFc2
l18IiVbHvErzcVTpYhddWClPunrLsJi6dTnfv8pCsV/WGg6M/SwuKnTf3K8FOP8ANTn3k9TnH4X8
wnoB+1VcTg/+anCV4JfbhHx0P5qaXaMjp+dz3y/2SqVg8VLA1YVYZSpyjKPXF3RquculWrwjYWOF
0tidTzKk/HQ+7WSqx9UiY8N9Sat/fPlIcab/AG/QuBrb6FXEYeXU3GtD/HPuJOVy84z5z9RnQX9s
paRwj2VcHOcV9uhKNZeqMl2jI6fnc+78vJVM0LpF6HxVHEx20asKi64SUvcavljG6u1T/hD0ctF6
WxlKPmePnKH3ZvXj6miY8NdSat+KRJ9JP2/Q+jMRtdP5RhpP7k1Ugu6q7dRJyuXmT5z9/i1GdBv2
3C6Uwj2Twbqr72HnGp/h1uwZeh0+LPu/IqndH9JPQ+Mw+JX9jWp1P4ZJ+41fLGN1drUz4Q9G/NOl
8bRWUY4io4/dlJyj6miY8NdSat+JEz0o/btDaLxG2UFiMPJ/cqKpBd1TLqJOa1l5xnziRvoB+2YX
SuEeypgnVX3sPOFRerWGXp8Tp+ZZ935FczNuDTADABNgDQUYAYAYAYAYAaCDYUYAYAYAYAYAYAYA
YAbsRBsoNgGwowAwAwAUkQCigwAWiAUlcoFkGWyiFEB//9D15Y9j4j8rGrAGrAGWAMsAaAMAMAMA
MAMAMAMANWIgywBlgDVgDLAGrAGWAMsFGigwAwAwAwgMANWAMsEGAGgDADADADADADAAQZGAGAGA
GAGAGAGAGBRqwBlgDVgDLAGgowAwAwIMAMAMANAGBBgBgBgBgBgBgBgBgBgBgBgBlgo1YAzVANWA
NWANAGBBgBgBgBgBgBgBgBgBgBlgBNgDLFBsINkUYAYAYAbKDCjLADADCA3YA3YA2QGFBgBhQYAY
AYAYAYAYAYAYAbAMKo2AYQG7AGNBAgAwAUFCkAYEGAGAGAGyA2GhhQYEGwDYQYAbIo2FGAGFQYUG
AG0QCyAwAw0DADZFCkAbKgUmRQsKCLMAUgBaACIAUiKFgCwBaAFoKFoAUmQC0UC0QCkygWnYigqY
ARMAKmAETCgqYARMgCJhQRMAImAETACphQRMAInYgCJ2CgiYAtMAImFBEwBaYARMKFpgBEwAidyA
WmAbCjYApMAVcA2AbuAbuQGyg3cAUmQGwowAUmECgowAwAwAwAwAwA0EGAGrkAkqjADAg0AYEGEU
aANNgCSoMAMAMAMIo0EGggwA1cqjQBgBgBq4BoiDADYUbKDdwDdyA2AbKBSZAbCjYBtMoFJkBsA2
mFC0ALTuALTAFkAtMKFJ2ACACkwBaYULQAtMAUFC1mEC4sKFoAWiAWigURQtAC0wBZQbQUKIg2go
2UCkQGwDADaKoWRBgBpoKNAGggS0FCSoMIBDRQaAEtEAkoMAENACGggG0ADauADaKgG0ACaABtBA
NoAG0ADasECGgAckUAmggG0ACaCATQANooBNBANoAE0UA2ggG0ADaCAbQANooBtBAhoAE0ADaCAT
QAJoAG0EA2gBLVwAbQANoIBNFANoAG0ECGgAbRQDaCBDVwBAAhqwAloAQAIaKBDRECWUCGgLCGgK
QAIasAJaAEbQBDQQDaABtAahDRRQ2gAbQQIaABtACGgAbQGoG0BSQgS0VQkiBLRQJA000AIANNEA
gorTRBogoEtBAlgCGgNQkCtbABSACIAVEigiKAsSANFhQaIA4iyKDRAwPEAcRZFDiLChxFgDmDCh
xFkGDmLChxFgDmDChxFkUOYsCU4iwqHEWAOYsihxFgDiIVB4sgyPEKHEWAHiwoPEgHEWFB4sDI8W
FQ4iyAPFhQeLADxYUOIsglHiwINEKCIAKgoKiAImAFQARBQVEAQKNoIFBRtBAsAwKFoINhRsA0AY
ECWUCSA0VBqQAOQAKQAOQANhAOQAGSAASQQAkigBJBACSAASRQAkggBJBA3kgAEkVACSAG8kEDeS
KBtJBA3kioG8kANpIqBvJBA2mioG00AN5IIAyRQAkggDJAAJIAG0EApIAHIAQECWFGigwINEAlhR
hQJCDCASVRoINEAloA0UGgBLRAJKDCA9X9K/J6HUv9zhv8UThOXvz9j5QeTrHd88ZYoPTv8AR0jZ
Y186H/OQ4dR7vo3r8v1HnbTj1sXXfGrU/wATO0ePLkRVisi4+D2GvpfB/wC/pvudzOXDr0+Z8R1D
+kLK+Ow64UL9838DHTd/pPM+A8+nV5BgB6zxX7P0LXOjD+aqvicP5z332Pl+o8mHd4BgB6H/AKPF
K+LxM+FKK75fkceo9f0bmjkvTyr47SuMf/dRVXdJr3HTHhw6nN+IqRpzEloej8pxNGH1qkF3ySJV
x5HpD+kXWtDBQ4yqvuUF7zj03t+k+nzHl07vCMAPWfgy/YejGJq8sTPuhb/KefLl7+l4wvzHkw7v
AMAOseBPD+O01Rl9SFSX8jj7znnw9HQn2gvw3Yjx2mqsfqQpx/lUv8ww4Ov7Q5IdHmGrAHrXwgf1
Z0Uw9HY5Qw0H1pKT9cThjy+h1PGE+Q8lHd88YEHpX+jphb1MZV4RpRXa5N+xHHqPd9GnI4T0sxPy
3SGKq/Xr1WupzdjrHlzu7fjRAwk6bTW1FY2JzQ+C+WYzDwhsq1aaXJuSTXZ7LPeS1vHzZ8R6E/pF
Ytwjgqae+rPu1Evazl03s+k3geZa8b2nHJS4bmtq965NHd4RmIXjLVF6W372/v28M7biKPWfglqf
NegMTi3lJutUb4+Lglf+Vt82zhny9/R8Y2/EeTKi8dBS3q0X/lfdl2czu+eNNeOhffDJ/dezueXa
uAB0XwSYT5y0vhYP+znKa6oxbt3pWXNsxnw7dGbygtnh5xnyzScaH93Qi113lJ98Wu5GcOHT6Rd3
5DhuG+kvT+ts+8tnw7Tq8sBNH1FCerJ2hNasnwT2Psdpc7WBKPWkF/sn0QSqRz8XaUePjqma7pW6
jhzX0PZw/frR5HxFOWjq3kPOLUoS2XW2Mu1WZ3fPs0CaTpKM9eCtColOKWxX2pcoyTjztcQrTuvg
SwHzlpOOM+rh5qT/AOOJxh64yUm97bOWfD1dCbu/uSqv4YsWtMaSxFSO2hUjRf3dVW/mVS75xRrD
xGOtd34LHN8MvlWHqUvSpvxsOrKM0utasuSgzbjPMGaG/aJTw/8AfR1Y/fXlQtzbWpfcpMUx9w9a
dPsVHol0fwuGn5svEUKiW1x1G6nbZPtaPPj5r6HUvbjJ8Ijx9iKM9F1pQvadKbV1xi9q9qZ6Hzr4
U707SiqzqQVoVUqkUti1s3Fcoy1ofhJFyHpjwC4FY2VTH+lGjDDy64u/dqKmubTOXUr2/R5vz8kr
iXTTSP8AtFWxlW93SxU5R/3U3qd0XGFuc2dJNPNne7fxVV9B/tMa2Gf9pTco/fpeWu1xU4LnMtYx
9w10XnbG0YvONSapyXGNTyJJc7SduYqYcj01/SCxi0Zo/CYOm7J1Lq31aUbL/Eu449N7vpF1JEjz
L0niqmI8evNxEY1lbZea8tLkp68ew7x4svzUrSX7Zg8PW309ehL8L14N9am4rlAhfM/gPSn9HTDv
D4PF4ibtTdRRV9i1Y3k+1ON+o49R7Po08WpXnvRekPnnSVRz2Y2VWEr/AFq19Vvqm4y7DtxHkl3f
jv8AiqoYevPAVI1I+TOnJSXJxd16zTnLoXOego6S01Tw1NWpYitSlBcKdbVmu6Ms+oxvw69u8te+
/mO6f0lcXKFLBUV5spVZPriopf4mc+m9P0q8JHnbAftujsTS30Z068eUW/FT73Kn/CdnknmX8f0V
nQxqri1h3sxMJ0O2pFxh3T1X2DIw517/AAPTHgHw60BofFY+orXnOT+5Rh8dY45+a9v0eduNv78J
XmTpvTXy+tUj5tdqvH7taKqpdmtbsOuLw58/Hz+PlS9M/tuj8HX30/G4eX4JeMjfsq2XKPIsXLzJ
+H7/ABFs8E+jo9Iq0sBPY6uHxCXHxVRRml1wqSfYZz8N9Gd3j4X8P6yu0eGHpBGhpnRuFm7U0peN
+5iH4mV+qKl3nPCeHp62X2pP358JHkHG4SWAqzozylTlKMuuLszvHgs0q09OP2ivSxX/ADU4ejUf
3lHxdR/xwkyYtdT3++Qbn+36FT2ywuKa6o4iF12a1F9suZPVecfhfz/qGug6+U1cRhf+anC1oJcZ
Qj42H81OKXWMjDz498v9kVLA4uWj6sK0POpzjOPXF3XsNOcuhY+nmEjg9J4lQ8yVR1Ifcq/SR/lk
iThvqTVrUOekC+W6M0fiNrgq2Gk/93Pxkb9lWy5IkXLzJfjP3+I30W/bMDpHDb/E068eujUV/wCS
cy0w8yz7t/gInoZpFaI0lha782Fem5fd1kpeq4yjOF1Z8SozT+jXobF18M/7GrUp/wAMmvcWeUym
rpVm6b/tdHR2KX9pg402/tUJypf4YwM4t5+dX7vy8JGaG/btC4+i9tGrh8RHqvKjL/HHuF5MfON+
V/QNfBpio4XTGF1/MqVPEy+7WTpP1SLlwdK+Z++fBVMxuFlgqk6U/OhKUX1xdmVys0q8+Eb9qqYT
F78TgsPKT4yhHxMvXTM4/q7dT0vvk/sfokb0f+39H8VT34bF0K34asJ05euMPUPUnnG/dYsJ8FdV
LS9ClJ+RX8ZQlzVaEqftkhlwnS5/h+K1z2tRdCTjJWlFtNc0bcmnRPCh+04rD4vfisFhqr+8qapy
/mgzGLt1ed++RmN4L9v6N4iC24XG0qv4a1OUH64RHr8iecfhfzPUnwS1F88UKUn5FdVaEuqrTlBe
toZ8HS5+JXOqtN0ZOMlZptNc0bcWiADQQYAaANNBRoAwAwAwAwAwAwAwAwAwAwA3YA3YIMANgGwo
wAwAwAwA2gBRAbKDaIBYAqIGSgIUkFCgg//R9ensfEflYwAwAwAwA1YA1qgGrAGgDADADADADADA
DADADCA0AZYAwIMANAGWANWAMsAZYKNWKDADCAwA0AYAZYIMANAGACGAaAMCDLAGrAGAGAGBBgBg
BgBgBgBgBgBqwUZYAywBqwBlgDQUYAYEGAGAGAGgDAgwAwAwAwAwAwAwAwAwAwAwKNWAM1QDWqAa
sAaCDADADADADADADADADADADADADZQYUSsAjCA3YAUQGAGAGFBhQYAYAYAYAYAYAYAYAbCjYBgB
uwBuwBgQYAYAJasAaChSQBsIMAMAMAMANkUbCjCoMAFAGBBgBsijYUYUGFQYAYAKiQCiAwAw0DAD
ZFG0AKCDaChaAFxYULAFoAWgBaChaIBaYApACwBaYUKQAtMgFplAsAUmQBIsKCpgC0wAqYARMKCJ
kARMAImFBUwAiYARMAImFBUwAiZFC07ABEwBaYARMKFpgBEwAiYAtMKCJgC07kAtMKFBBsKNpgCk
wDdwDYBu4Aq5AYUCrgG7kBsKNp2AFXCDYUYAYAYAaCDABLZAaKowAwINAGBBhFGgDTZQJCDADADA
DRFGBBoINXKo0AYAYAauAYAaIgwAwAwAwA3cKNlBu4AogNhRtOxUCr3IowA2AKuAKANphQtMAInc
AUmALRFC0wBadgBYAtO4AtMKFpgC0AKTsALCgiAFpgCkRQtBAtFULIBYApFUKIg2AbCjaAFAGAG0
VQsiDYUYAaaAEgGgg00FCSoNEAhoA0UGmrgCADABDQANoIBtAA2gAbRUA2gATQANq4QDaABtACGg
gG1YAG0UAmggG0ACaCATRQDaABNBAJoAG0VANq4ANoAG0EA2igG0ADaCAbQANoAG0EAmgATQANoI
ENACGgAbQAJoIENXKATQAhoIBtAA2igQ0ECGgBDQAhoAQ0AJaAENFAhoiBDRQhDQGiWgBDQAhqwA
hoAQ1cIENAA2gKG0BohoAG0UA2ggQ0ADauAIaAsDaA0Q0AJsECWiqEkQJaKLCQK00QCCg00QCSiw
hoDRIAloIEACWgNkgG0AEQAtEULRQLRAGiFB4gB4hQeJBgaIAeLChzFkA4iwocxYUOIsgycxYVDi
LAHEWFDmJAOIhUpzEKhxFkA5iwocRYA4iwoPFkGB4sKDxYA4iwoPFkA4iwoPEDNHiFQ4iwA8WRQe
IAeIA4iyKlHiFQaLACoAIgAqIoLEAIgAqCgqIAiANoAWAYFC0EGwoVEIFBRsAwA0AaKyEkUJKgwA
GwAbABMAGwAbCAUgAEkEAJIoASQACSCAEkAAkioASQACSCAEkUAJIIG8kAN5IqBtNBA3kioG0kAN
5IqBtJBA3kigbSQQN5IIAyQACSKgBJAAZIAE0ADaCATQANlQaIBIUaKDAg0QCWFGioNAGmiASVRg
QaIBLRQJAMIBDVig0AesOmC1eiFBf8Zwv+VnnnL35+x8oPJyO7542Aeo/wCjtG1LGP7VL2SOPUe/
6N6jzTpKWvXqPjOT9bOseKhjYrIvngwp+M0zhF/xy/cmzOXDt0p9qC8/0gZ62k6K4YaPrnUMdPh1
+k8/IcKsdXkGWAPWPSlfJeh1KP1qOG9coSOE5fQz8YfKDydY7vAMsAel/wCjrRzxs+VFf42ceo9v
0b1+Q4D0kqfKMdiZ/Wr1X3zbOseTLm/EQuqVkWjoTh/lGlMHHjiKV+pTTZMr4b6c8z4wdi/pD1tb
EYWH1ac3/FJL3HPpvT9J5g862OrxjVig9Z6J/q3oZJ75Uat/x1JJepo8985PfPGHyo8lnoeAYAd1
/o/4bxuk6s90MPLvc4L2XOXU4er6PPPyFJ8KWJ+V6ZxcuFRR/hio+41jPDl1bvKigGnILpwdVqK2
t2XaAervD7NYTR2Fw62eNVuqEGv8xw6b3/SPEkHk47vAMAPWXgGgsBozFYl7PGy7oQT97OGfL3/R
/EtHk+c3Ubk9rd2d3zwgA6F4LcP8t0vhaTV14xTXJ00539VvXuM5cO3Rm8oOgeHrGfKdI0sPujQi
1ynKUvakl233GOnw6/SL519w4Nh/KvTfpbPvLZ71wzvuOryQZh826cslLLPc9z9z5NgHrHDwWhOh
1peS50WnfL99Utn/ABZ8jhzX0Z4w+X5jybRfiZOM8k/Jly/0efYd3zxkP2abUt14yXLY/wAudmDg
du8AujXLStWbzVKjKz5ylFJrk1exz6l8PV9Hnn5Cm+FXHSxGm8VNbYzjFfgjGPtRceHPrXeVHP8A
EQUJXjlF5rqe7s2dhtxoViY+MamvTz/FvXfnbg0Cj1f4aZfM+gsNhL5udKD6qcHf1pHDDzXv6/jG
T4DyxWXymhGfpU3qS6ndwf8AiXJKKO7wjKa+U4eUfSpPWX3ZWjLueq0ucmDmLHpP+jng3CljK72O
VOC/CpN/4l3HHqPb9GnJXAKmkPnjH15SeWLnUXbOWtB8kparfK50eTe78VQej8T8grRnJNpO048Y
vKUe1NrtNMS6E1oPQ8qmlKGFTu3iIR1lvWsvKXK3lLkS3w1jPOvvHdv6R2kP+JMOn/eVJL+GMf8A
McunHr+k3iJHnjSn7TTo198o+Ll96lZf4HBt722dXjvnyrc/2vBp+lQnq/gqXa7FJSvzmgenwHqL
wNr5g6P4nGve61VdVOFvbFnHPzXu6H2cbfileXuj8/G1/FSfk11Kk77Lz81vkp6suw7V4cfzVG4L
Ez0ZWhVivLpzUknxi72fvLykuh0joJoCNXpFQowzpxq+Ng39SMfG02+taveYyvh36eP2v38Rbf6R
WKlV0hQp+hCjdfelJ3XcovtRnpt/Sb5+SRxyt+2YCEvSoVHTf3Kic4LslGq/xHR5+Z8FZodfKsPi
cPvcFWgvtUnn/wAo5VH2CmPncHq/oVhoaA6Kx8a9RV4vWlw8fPxcZdilF9hxy8178J24fH9UeMpx
ngajTvGcJW5qUX7md3zeFTfSykvlc6kVaNZRrRS2JVYqdl91tx7CRrPkdm8EGivnzH4HFNX+TUq8
J9dNrUb7K8UvucmYzunp6M3Zfdv9/wAUpPhk0p8/YrHYdO/yNYeUeS82ol+KtC/3RhNHWu7fu1+/
4kce6HfS4tYd7MTCdD8VSLjDunqvsN158Ofj4VWqFaWEnGcMpQkmnwad0ac5dD2v09xNPo30YqKi
tRYjzY8PlE3UkuyMpLsPPj5r6fUvbh8f1R5M05+14LBYjeoVKEnzpS1l/JUgupHaPn5cS/L9/irN
FftujcZR30pUcRHqUnSl3+Ni393kPVcfMvyv6fqOpf0dNFPF6UqYh+bRov8Aim0l6lLuMdS+Hf6N
N3f3JVK8MGmHpfTmKmnlTkqUeXi0ov8AmUmbwnhy62W8qsQPTyKq46VdbMTCnX7asIzl3Scl1oYs
9Tn4+Rmkf23ROFqb6FatRf3ZatWHrlULOS+ZPn/ZGdFf2rD4/DfXw3jI/eoTjUv/AAKp3iph53Pu
/IRHRbSS0Pj8NiHsp1qcpfdUlrLtV0LEwurA26Q6MehsZXwz/sqs4fwya9xZdmU1dCf6Y/tVLA4r
+9wkISf2qEpUf8MIvtJGs/Or935eFjej/wBu0Liqe/D4ijWX3ZqVOfr8WS8k8437rP7Ck+Dlqekq
dB+biY1MO/8AkNTlTXrkn2DLg6fPx8fiVR5RcHZ5NG3JV38JC8fj/lK2YqjQr9tSnFy/m1jOLr1e
d++S/wAEjMT+3aBpSe3DYypD8NanGa9dOXeT1Ocfhfz/AKhrweftFbE4X/mowWIglxlCHjY+umhk
dP1nvl/slUXDYiWDqQqw86ElJdad0bc5dKuHhNw0cNpjF6nm1KnjY9VZKovVIzjw6dWeakH05+26
D0fVX9jVxNCXfCrFfzyJOTL2Z85+ozoF+1UdJYV7KmBnNL7VCcKq9UZDL9V6frPu/LyKboTHvRWK
oYhbaVWE/wCGSfuNVzxuq2sHhFwC0bpjG0lsWIqOP3ZSco+pomPDXUmrfiRJdKV8r0NoqvtcFiaE
n9yopxXdUy6iTmrl5xnzn7/FI30E/bMHpXC/XwfjV10KsJ+zW7LjL0XDzLPu/KlVDozj/mrHYbEb
PFV6U/4Zp+41XPG6vzWpXwg4D5r0vjaOxRxFW33XJtepomPDXUmrfiRTzTmrADQQYAYAasAasFGg
DADADADADLAG7AG7BBgBsAywBsKMAMAMAMAMAMAFogNlBgApEAoozS0QQpFAsgMKD//S9fWPY+K/
Kxlgg0AYAYAYAYAYAYAasAa1SAywBqwBooMAMAMAMAMAMAMAMIDADQBgBgQYAYAaAMsAZYA1YAyw
UZYA1YAwA0QCJFQJAMAMAMAMAMAMAMAMCDLAGrAGAGAGAGBBgBgBgBgBgBgUasAZYAywBqwBlgDL
AGgowIMANAGBBgBgBgBgBgBgBgBgBgBgBlgDWqFGtUA1YINAGAGAGAGAGAGAGAGFBsoMIMtpACiA
wAwAwAwoMKDADADADADADADYBhFGyg3YA3YAwIMAMAMAMAMAMauAJSChQQYAYAYAYAbIo2FGFBgQ
bQBsIMANkUbCjADCoMKDADABaIDZAYAYaBgBsijYUKDIwKFphQoAIALTAFIAIgBSIoWgBYAtMAUg
BaAFJhQtAC0wBSYAtEARMKCJgBUwAiYARMKCJkAVMAWgoKmAETuAETCgiYARMAImRQtMAImALTAC
J3CgiYAtMAImFC0wAiYARO5AbuFCkwDYQbChVwDYBsA3cAUQGwDZQbTIBQBgUKTCBQBgBoATcA0F
GAGAGggwIMAMIo1cASyg0EGAGAGAGiA0AZcoEgGAGAGAGgDREGAGAGAGrlUaAMuAKTAMIg3cqhVw
DaZAbANlApMKNkBsA2mUCkyAWmFCwBadwBaYApEUETAFpgC07ACwoWmALTAFgC0wBcWFC0ALRALR
QKIoIgBUQBaKBZAYAKCjaKBRAYAbRVCyINhRsKNBBoASAaCDVgoTYoNEQJaChJUGmrgCADAAbQAN
oIBtWABtAA2ioBtAAmgAbQQDaAENBANoAG0ADaKgE0ACaABtBAJooBNBAOSABNAA2ioBtAA2gAbQ
QDaKAbQQIaABNAA2gATQQCaABtACGggQ0ADaABtBAJooBtAA2ggQ0ADaABtFAhoIENACWgBDQAho
AS0AIaKBDRECGgNENFAhoAS0AIasAIaAENBANoAQ0BqBtAUNoAG1YoENBANoAQ0ADaA1CGgKRYAS
ECWiqEkQaaKNEgCWrkAmxQJauQCSjRLQFIAEtBAmwFhDQGmkAEQAtEULRQLQAWJAHiFBogB4kVge
IAeLChxFkA4iwocxYA4iyKzTmLCocRYA4iwocxZAOIsKlOYsCHEWFDiLIBxFhQ5iwoPFgZo8WRUH
iwBxFhQeLADxZAOIsKlHiwMjxYUOIsgDxYUHiwA8WFB4sgyPEKDIAIgAqIoIgAsQAkQAsSKCRAFh
QtBBgUKiECgo2ggWFGAGwDQBhUCWQCQDRUCGADYANgA2ACYQDaAAyQACSKgBJAAJIIASQACSKgby
QACSCAEkUAJIIATQA3mioG0kEDeSKBvNBA2kggbzRQNpIIG8kVA3kggbyQACSKAMkEAZIADJAA2E
ApIAGwBIQJANBRooMCDRAJKo0EGgDTRAJKo0EGEAhlBoAwgENWKD1f08+j6J4Zf8awq/liefHn8X
v6nsT5Dyed3gGAHq3+j1DVwmKlxqxXdH8zh1Hv8Ao3FHlWrPxknLi2zu8AQAdK8ENLxum8KuDqPu
pzZjPh26PtT9+gnfDvU8ZpdL6tCC9cn7yYcN/SPa+Q4wdHmGAHrHwm/snRnC0+WGj3Qv7jhjy9/V
8YT5Dycd3gGAHqz+j3S8XhMVUe+rFfwxv7zh1Hv+jcUeWK9Xx85TfpNvvZ2eACKDoHgrw/ynTWEj
wm5fwxlL3GMuHbozeUFx8PuI8bpSnD6mHj3uU38DPT4dPpF8/IcOOryjAD1j0o/q7ofShsc6OH/m
lGb95wnL35+MPwHk2x3eAZYA9Kf0dsLeeMq8FSiu1zb9iOPUr2/RpyOEdKsR8tx+Kq/Xr1Zd82dY
8md3b8RAWNMCwdEsJ8u0hhaW6Vekn1ayv6iXhvCbs+I7n/SKxetUwdH6sakn+JxS/wALOXTev6Te
B5rOzxDAD1r0P/qfojWq7HOliJLrk5QXsR575r6GHjD8R5KO754wA7P4CMH8p0vr/wB1RqS77Q/z
HPPh6fo8+18hGeGTEfLNMV5Rd1DUp9TUF6r3tzTLhwz1/OQ5piPpUqnHKXXx7dvXfgacKMrrxqVT
e8pfe49u3ruUo9XeF9vQ3R/D4Xe5Uab/AAQbfrijhh5r39bxjJ8B5RrfSxU9+yXWtj7V3tM7vnjK
v0sFPevJfZ5r7svw33gHp/8Ao9YZOjisQ9t4U78oqUv8yXUkceo9/wBGnNHnHTWN+eK1avvlVnP8
M5OXqb/m5HWeHiyuxGRXjabW+Ga6nk/XZrrZUFi6FYH53x+Gw7z1q9N9iktf+XP8JnLw6YTdk+8d
38PmO+U1cPgt/i6lRfeulHvUZxS4yOfTer6Rd6g816MalN0nsqrU7XnF9Skot8rnWvDAjAVlhKqc
76ucZrfqyWrLts3bmUngetOgNKXQ7o1iK7tr/tFTk5RvTj2NwVuTOGXmvodP7GO/iPJOksOsLVko
eY7Shx1ZLWjfnZq/M7vBWh9Mrxs1WWytFTf3s1Pq8pSsuFiQyHWPBJo7540rhMRt8VCpr9dOOrB9
Vp00uLizGd8PR0ZuxKc+HTFx0nj5qPnYVU4S5qpHXXZF3T5ySGB9Iu78COQYFfKqFajvSVWPXDKS
X4ZOT+4jbzxWaBXjqkqG6vB01952lT/njG/K4q4/mPV+kMRHoX0VoRmvOhRUo8fGyU6ke2LmjjzX
vv2MPwR5A0hhHo2tOk3d05uN1vs9q69qO751mlSHSJeMr+OWyvGNXlea8tLkp60ewkXL8x6E8Bej
fnKuse83RoSoS466knF/8m2orqZyzr2fR5vz92krm/hJ0n/tFisdLa8PifJ+5ZUZPq1qdO33nxN4
zTj1b3W/df6FUTQH7Qq+H/vaMnH71P6RdrUZRX3jVcsfd939IB0arrD4yi2rxc1CaW+E/Jmu2LaF
THkeovDfVXR/QmGwEHtlTh1xpR+OqccPNe7r/ZxkSPMXSteNxPj1sxEIVvxTV5909ddh3jxZ8/FW
9JfteBwtbfTdShLqi/GRb6/GNLlHkQvmT8B6N/o34WUKGLry8xzhGPJpNz9ThfqRy6j2fRpylcMw
ek/n/S9aT2Y2Vemlzrayp90nBrqOnEeWXuy+O/4qoeGxEsHUjUhlKElJPg07o25S6Fzx2g1pLTSw
1NWhiK8HDlTrNTj3RkjG9R0uO8te+/mO8f0k8a6GHweFirQlOpPl9GoxX+NnPpvV9JvESPO2B/bN
F4mnvo1aVZcoyvTn63S7jt6vJPMvyVnQn6bF/J92IpVaP4pwah/PqvsGRhz8R6U8AuGjoDQ+K0jU
VlKUpN8YUY39rmcc/N09n0eduNv78JXmfp3TUdJYia82rPx0fu1kqsfVJHbHh4+pz+/Xypenv2vA
YGvvjGrh5PnTnrr+WrFdSETLifOfv8RvQv7Zo3HUN8PE4hL7k/FO3ZWz5LkS+KuPF+V/T9QHoFVj
S0nh4zdo1ZOjL7tZOk/VIuXB0+f36+BVK9GWHlKElaUW01zWTNOQuHT76fFxxG7EUKFb8UqcVP8A
nUjGLr1Od++QaxK+WaEpS34fF1IfhrQjKK76c+8epfOPwv5jOhH7Q8Zhv77B1rLjKlauu36PIuRh
6z7r/Z/RpVtFY56LxFKvHbSqQmuuMk/cWzbnLqqmOnWAWjdKYulHzVXm4/dk3KPqaJjw31Jq34pE
h0o/a9H6NxG/xVWg+ulVcl/LUiSLl5k+c/j/AEjXRv8Aa9F6SobXGNCul/u6ni2+6qxeYY8X5X9/
iGPg+xi0fpfB1Jeb4+EZfdm9SXqbLlwnTurPiVWdJ4J6Nr1aEttOcoPri2vcWMWaVcPCB+0fIcTt
8dgaN3xlS1qL7fo0Zx/V06npfun9hI3o39u0Bi6e/D4rD1l1VI1KcvXqeoXknnG/dYEeCyaWmMPT
l5tbxlF9VanKn7ZIZcHS5K59Ug6TcXk07Nc0bcm3Q/Cf+0Yyjiv+anB4Wq+vxUYS9cH2mMXbq879
8n5JG6P7b0bqRWbw+PhLqjWpOPtpoevyTnH4X84erXgn+m0pHDvzcTRxFB8/GUppLvsM+F6PPx3P
4Fc12G3Fp0vwsfT6SWJ3YrDYauvx0YX9aZjF26vO/fJ+TMc0NuLTADADADADQQYAasAasAaCjaAF
BBgBgBgBsKMAMAMAMAMAMAMAMAFpEBsoMAMQAQglbRRksgFIKFBAqwUf/9P2BY9j4j8rGWCjVgDL
AGgDLAGggwAwAwAwAwAwgMANAGWANWAM1QDVgDLAGigwAwAwAwAwgMAMANEBgBhQYEGAGAGgDADL
ACZIFCAg1YAywBlgDVgDLAGWCjQBgBgBgBgBgBgBgBlggywBoAwAwIMAMAMAMAMAMAMAMAMsFGrA
GrAGWANAGAGAGAGggwAwAwAwAwAwAwAwAwAwA1qgCbAGAGgDADADADZQbSAlKIIwAwAwAwAwoMKD
ADADADADYBhFGAGwDdgDZUGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGyKNhRhUGwDYQYAYAbIo2FGA
GFQYUGAGAC0ZBsAwAw0DADZFGBQsIMKg2RoLTAFxYAtACwBaAFoihaAFJgCygWncgFJhQtACkwBa
AFogFJlAROxFBEwAiYARMAImFBU7ABEyAImFBEwAiYARMAImFBEwAidwBaZAETCgiYAtMKCJgBE7
gC0wBaYUETAFpgBE7kBsA2mFCgg2FG0wBRAbuUGwDdyA2AbAFXKDdyA2FGXAFXCDV7hRoAwAwA0E
GBBgBhFCbgGig0EGAGAGAGiA0AauUGgDADADVwDREGAGAGAGrlUaANAGBBoA2FCkwDZEG7hRsoN3
AFEBsoNphQogNgGyqFJkQLTChaYAQAWmAKTIoIALTuALTAFp2ChYAtMAWnYAWFBE7gCkwBZFC0EC
0yqFogFgC0AbAFBRtFAogMANlULRAbANhRgQaANACbAGgDQAlooNBAloihJUGmrgCADTVwAbQANo
IBtAA2gAbRUAmgAbVgAbQQDaAENBANq4ANooBNBANoAE0ADaKgE0ACaCATQANooBtBANoAG0ADaC
AbRQIaCAbQAJoAE0EA5IAE0ADaAENBAhoAG0ACaCAbRQDasAIasEA2gAbRQIaAENBAhoAQ1cAQAJ
aAENACGigQ0QWEtBFIaKBDQAlq4AhoAG1YAQ0EA2gKQ0BoNoAG0ADaKBDQQIaABtACGgNBtAUloA
SEGmgoSEWEtAUkoNEAhqxQJauQUko0S0AIAEtBAmwGibAUpAC0QC4lqhaACIgDxCg0QA8SKwPEAN
EKHEWAOIsihxFgDmDCs04iyCHMWFDiLAHMGRQ4iwpTmLAycRYUOIsgHEWFDiIA4iwrNHiyCDxYUO
IsAPFhQeLIBxFhUo8WBkeLCg8WQDiLCg8WAHiwoPFkGaPFgBohQVABEFBUQBEwAqACIKCogCACkA
bCjaCBYBgUEQQYFGwDQBgQJZQJIDRUGmADkACkADkADYQDYAKSAG8kAAkioASQQAkgAEkVACSAAS
QQAkgAEkVACSAG8kEDeaKBtJBA3mioG0kAN5oqBtJBA3kioG80AN5IIASRQBkggBJAAZIAEwAbQQ
DaAEFBoiBIBoKNFBgQaIBJVGgg0QGmAJKDQBpkAkoNAGMgPVvhR/Z+jWFh/zbx7qb+Bxw5e/q+zP
kPJx3eAYAesfAX9BonFVP+PT/lpxfvOHU5e/6P7N+P6Dycd3gGAHW/AlS8Zpmm/q06j/AJbe8558
PR0PaAvDTV8ZpqsvqxpL+RP3jDhOv7Q5SbcBuwB6w8O/7JovC0eFaP8ALTkvecOny9/0jxJ8R5OO
7wDAD1j4Hv6v0Biq3260+yNOK9zOGfL39Hxjfn+Q8nHd4BgB1zwIYfx2macvqU6kv5dX/Mc8+Ho6
E+0AeGnEeP01WX1I04/yKXvLhwnXv2hyo24DAD1l4av6t0JhsPsfjKUbcoU5e+xww5fQ6/jGQeTT
u+eMAPV/gGprA6NxWJls8a+6EE/ezhny9/0fxLR5TqTdVuT2t3fad3gCADo3glwnyzTWFW6MpSf4
YSa9aRjPh26M3lBZvD1ivlGlYw/u6EF2tyl7GidPhv6R5vyHErHR5RlgD1l0s/qXohSpbHOlQj2y
cZy9jOE819DPxh+A8mWPQ+eNWAPSf9HbA61TF136MacF+Jyb/wAKOPUr2/RpyOLdJtILSOkcVUb8
ipWqZ8FrPVfZl2XW86Th5sru34iv0lqSdOeV8nfc1sfY9r4NlZEv0Xwfy7G0cNJZVatODXB6yX5P
k2StYTd1949A/wBIHGqbwmF+sqknyfkqL9qfJs5dOPX9IvEHmbD7XCWSllnue58s8m+DZ2eIZh/J
k4SyUvJd9z3N9TtflchB6w8HFP5g6M1q8vIc1Xnd7ml4teuKOOXmvf0vs4fiPJtJ+InaWzOMl7e1
bVzSO7541B/Jalpbm1JcVsa7rhOB1bwMaL+UabpvaqMak+tauqn1XkmjGd8PR0J9ob8Nmk5V9Nz1
XnQhTinwdtf2yGE8L18vtfAcr0jSUKmtFWhNKUVuSe7sd49aNOFBNJ/SyjW/vY6z+9sl3tN24NCF
HqnwgVHoDorRw7ylOGHpPrspy/ws44+a9/U+zhr4DyxX/acPCe+m3TfVK8odt9fsSOz5/o0ymvlO
FlHfSkpr7s7Rl3NQt1sL6D0H/RywktfGVfRSpxXW3Jv2K/Wjl1Hs+jTlK5HprSPz5pfF53jialSn
H+L6L+aML8rnSeI8+V3b96qforFLBV4TlnBO01xhLKS7Ytotcp4D3A6KqPHwwkX9J4+NNNfW19VN
e1DayedfePR/9IrSCo4fCYSOSlOU7cFBKK/xO3Ucum9v0m6kiR5t0z+0Ro1/r01GX3qXkW69VQk/
vHWPHVZW/asFCe+jUdN/dmnOC71VfaDmD094Dqa0FoXE46exzqT/AA0oL36xxz817eh9nG1K8z6B
rSx2InTm7vExnB85y8qH/KRQZ2rxY+b8VROisa9GYilXSv4ucZW42d2u3YW+WcboX3oT0c8d0ho4
TzoUsQ5X3ONK80+pqK67mMr4dsMfta+8Xr+kZpB1cdh8P6NOi59s5NP/AAIz03T6TfMn3JHGcb+1
4ChU30p1KL5RdqkO9yqdx0ee8KzRi+VYLFUd8PF11+CXi2l2VbvlHkCeZfx/f4j1f0E0f8x9F0r6
lTExlZ/bry8XTfrgcMvNe/pzWHx/VHjDDYiWDqRqQylCSknwad0eh82XSpfpZhY4bHVlBWpynrwX
2Knlw/lkhK1nNUdt8FGiPnzSWAxbV1Rws9d/bpSdKK7IzptdRzzuo9XRm7L939CUPw2aW+f62JpL
P5DUoKP3akJeM7p6iJhNJ173b+7RHHuiC8fVrYf+/wAPWh1yjHxkF2zhFHSvNh7vfKqA0XjpaLxF
KvHzqVSM11xaa9hq+WZdeR7Q8I0aXQfo1Uw1F2VR+Lhu/ezc5fy6x58fNfS6v2MdI8m9KP2mjgsR
9fDKEvvUZyppfwKHedo+fl6X7vyVmE/a9EV4b6GIpVF92pGcJ+uNMeqzzPhYM6DfTYqWH3YihXpf
ilTk4fzqJcjp8698v5CpUK0sNONSOUotST5p3RXOXQs3T2hGjpPEuOUKlR1Y/dqpVI+qSJjw6dSe
aDaf/atHaPrb4xrUG/8Ad1PGL1Vl2CcmXE+c/f4jfR/9q0dpGhvjCjXS/wB3U8W/VVfYSmPF+V/f
4ht0AxMcLpXCufmSqxpy+7U8iXqky5cHTvmKq2Lw0sFUnSl50JOL607M052aaXHp/wDtFehiN9fC
Yeb+9Gmqcv5oMxi6dT3++T+wkaX7XoF73h8auxV6T9V6PePX5H834X85/QM8Hi8fiq2G/wCajCYm
n2+KlOP80IjJenzr3y/kVQ6NV4eSnHKUWmnzWaNuKrp4TaKpaXxUo5RqzVZdVaKqf5jOPDr1eakL
05+16E0fVX9lVxVB98KsV/PIk5MvOM+f9kZ0G/acPpPDvZPBSml9qjUp1F6lIZfqYes+78iqr0cx
3zZjcPX2eKrU53+7JP3GqxjdX5qf9PMB82aVxtHYo4iql1a7t6rEx4XOat+NXFNdL/2rRmicQ9vi
K1F/8gq0ml3TRJzW8+J8L+ZG+iH7VovS1Df4mhWX/IKtFN902LzDDi/L8yoToHjfm7S2Cq7o4mk3
1a6T9Vy5cMYXVnxi1G9KMB82Y/FUP7uvVh/DNr3FiZeLfiRbenn7Vg9E4n62CdLto1akfY0Zx9XT
qeZL935VI5obcWmAGAGAGAGAGAGggwA0AasALCjADADADADADADADADADADdgBSRAbKDADABSIIU
UZKiQC0UCyA2VQoiD//U9gnrfEflYwoMAMAMANWAMsFGrAGiAyxUGgDADADADADADCAwAwAwgNAG
WKDVgDLAGrAGWCDViqMAMAMIDADADRAYAYAYUGBBpoAGEGWANWAMAMAMCDADADLBRqwBlgDLAGrA
GWAMsFGgDADADADADADAgywBlgDQBgBgQYAYAYAYAYAYAYFGrAGWANWANWAMAMAMANBBgBgBgBgB
gBgBgBgBqwBrVANAGIoFWANkErAIwAwAwoMKDADADADADYBhFGAG7AG7AGwgwoMAMAMAMAMAMAMA
MAMANgG7BRoA0EGAGAGyKNhRhQYECkAYEGAGyA2GhgBgBhpBgBgBtEAsgMAMAMNAwA2RRgUKREGy
oNhRtZBQtMAIALQApABEAKTIoWALTuAbTsALAFoKFIAWgBaYAsAUmQBEwAiYUETACJhQVMAImAET
IBaYUETACpgBE7ABEwoImAETIBadwoImALTACJhQtMAImALTAFphQRMAWmAETuAbAMuRQpMA2EG7
hQq4BsgN3KDdwBVyA2AYAKTANgGwowAwAwA0EGBBgBoijVyg0AaCDADADADRAJbKDQBgBgBgBoA0
RBgBgAm5VGAGgDAgwA0QGAGAGFApMKN3ANkBu5QKTAFXIDYUbTKBSdyA2AbTAFpgC0woWnYAWmAL
TIBaYULTsAEAFp3AFphQtAC0ALTAFphQREAtACkUCwoIQC0ALRQKIDYUbKBZAYAbKoWiA2EGw0FB
BoA0AJAEtAGgDQQJaKo0ECWiKElQaauAI2ACWgAbQQDaABtAA2ggG0UA2gATQQDaAENAA2ggG0AD
kigFJBAJoAG0EAmigE0ADaCATQANoqAbQANoAG0EA2gAbVigQ0EAmgAckACaCATVgAbQAhoIENAA
2gAbQAJoqAbQANoAQ0EA2igG0AJaAENBAhoAQ1cAQAIasAJaAENFAhog0S0ECGUCGgBLVwAbQAho
AG0EA2gNQhoChtACGigG0AIaCAbQANoCwhoDRLQAhoA0AJaCBNijRNiAS0UGiAQ1YoEtXINQkopL
RAIKBLQRYS0BpiAFogFxCgiKBaIAsQoPEAPEisDxACxChxFgDiDIocRYA5gwqU4iQZOYsKHEQBzB
hQ4iRQ5iBk4iwoPFgDmLIocRYA4iwqUeLIMjxYUHiwBxFhQeLIBxFhQeLAwPFhQ4iyAPFhQaLAHE
WAHiwqUaLIIPFhQVABUAFRFBIgBUAETCgiIAqAFIAUAbChaCDAoVEIFBRsAwA0AaKyEkUJCDCgGw
AbABsAEwAbCAbQACSAASRUDeSAAyQQN5IABJFQAkgAEkEAZIoASQQN5IIG8kUDaSCBvJFA2kggby
RUDaSCBvJFA3kggbyQQAkgAEkUAZIIAyQAFoAG0EA2gAbQAkoNEQaaAElUYAYRBpoASVRoINEBpo
ASUGgDTRAJZQaAPV3hrXiNCYWnv8bSXdSmefDl9Dr+zP36Dyceh88YAesPBb+ydGsVU/5uJd1NL3
HDPl7+l4xvzHk47vAMAO4eAKj4zSlSX1cPN98oL3nLqcPV9H5+QqPhVrfKNNYt8JxX8MIx9xrDhy
63tUc9NuQkNE0PlWIpU/r1IR75JEq4+aPSX9Iivq08HT4yqy7lBe849N7fpPoPLx3eEYAesejH9X
9D6s9jnRxH80pQXuPPfae/Dxh8qPJp6HgGwDvf8AR9wuvj69X6tDV/inH/gnLqPX9Gnn5DnXhHxP
yvS+MlwrSj/B5PuN48OPV85X4ikmnISehMJ8uxVGl/eVYR/ikkStYzdHov8ApEYq0MHS4urJ9iil
7Wcem9n0m8DzAd3hGEB6y6G/1T0RrVdjnSxEl1tygvYjhly+hh4w/EeTTu+eMAO3+APB+P0pOo9l
OhJ9rlFey5y6nD1fR55+QqfhWxny3TWKlujKMP4IqL9aZrHhz613lRzw24guHovEzjCO2TSXW3Yh
B6o8PdZYHR+FwsdjqXXVTg1/mRx6b3/SPEkHlI7vANWCD1n4Fl8z6FxOLf16k/w04L33OGfmvodD
xjaPJrbk7vad3zw4q/SxU96tGXufcrdl94UdN8E2A+dNMYapa6hryn1xi7Ptds3tesYz8R26M3lB
K+HjF/KtKKKeVKlCD5N3n7JInT4b+kXyOO4heMtU+tt+8tvfk+06PNRmJXjLVPrbfvLb35Pt5Ao9
W9M5PQfROlReU6lOhF/ek1OffaVzhj5r6Gf2cPwHlDEfSKM+OT618VZ83c7vnjK30kYz/C+zZ6rL
sZAekP6PmBVaeJxT86MIUuu7cvYorsOXUe36NOaOI9M9IfPWNxGI2rx9RL7rk3D1J+o6Y+Hl6l3b
fvEF/wAUUPtUpfyy9yl65mmBL9GtG/P1SnhN7rU7fdnKMJ/5XySZL4bwnd4+8eh/D7i41qVDBrzr
VKyX3LLu1XUfWkcem9n0i+g8xaK+mc6P97FpfeXlRtzbWr1SZ2rwwJ0RNRrKMnaNS8JN7Epq1391
2l1pCkaerPBTD/ZPo/XxlRWletUaeT+jWoo98WutnHLzXv6P2cd/FK8m42g9H15RTu4SdpcbPKS6
8mju+ffCjabglXlOKtGolUSWxa61ml91tx7CRrIdU8GWi/nrTOCr2vFU3OfKVFOC7W1CT+8Yyuo7
9Kbyn74RI+HzExx2Ojqu7oJUprcnKKqRfW7yX4SdNfpHm/Ajj2H/AGrB1Ib6M41FyjLyJ+vxR0ea
eYrehV4+Neh9elKUfvU/pL9erGUV94UxHrR04dF+i9DDVPJ8fCnSlyeIlefcpSfYcOa+h7OGvf8A
qjxtTnU0dVUl5NSnJPqlF+5o7vncKfdIcPHDYqooK1OT14L7E0pw/lkhFymqPRngW0V84Y35xaul
g4Q6pqTpd7jSu/vHLOvZ0Ju7+7+j9ErmnhU0n/tFiK9dZ+IxU6N/saqUPXTqPtN4zTj1b3fKrFE0
T+04XF0eEYVo83Tlqv8AlqTfYarlOL+/3yFdEF47GQo/36nQ7asXCL7JST7BTDn4+B6c8NmkP9lt
F4PB0HZqpT1fu0Iq3r1GccPNe7r3tkn78JHlrpVh44bHV1BWhKbnD7k/Lh/LJHePBnNVR+kP7RSw
lffOgoS+9SlKml/Aod5IuXp8B6Z/o8w8Ro3EVqmUI1pasnuWpBz7Mo9xx6nL2/RvE+aV56wOkpdI
MVpBy24ulXnbnCXyhf8AKuy67HbWnkl7rfv3/ZVWOjukForGUK72U6sJPqUk2u1ZFsc8bqid0T0W
eK01DRrV0sU6cvuxnaT/AIU2TfjbUw+1r7x23+kppjysJgk9ilVkuvyY+yZz6cer6TlxEjg9X9r0
PB78PipR7K9NNLvpSfazr6vLfOPwv5/1K30T/aI4zD/3uEqNLnRca1+6m+xslTD1+H5eRD9G9IfN
ONw+I3Uq1Ob6oyTZb5TG6uwPpDo/5pxmIw/91WqQ/hk17iy7TKaom+mP7RHBYj+9wdJN86TlR9lN
GY3n6X7v6P0GqH7VoWrHfQxdOXZWpzi3304ruHqc4/C/n/UN9AvpsTUw/wDf4bE0197xUpR/mjEu
R0+fjL+Qp2HrvCzjUj50WpLrTuiucuhafCFQjQ0ritXzZ1XUj1VfpF6pEx4dOpzWoN0g/adF6Orb
XFYig39yp4xLuqicmXE+f7/iM6NL5To7SdDeqVGsv+QdWMX/AC1JEph5l+X5hj0AxiwGlsHUfm/K
Kal92UlGXqbLlwnTurPiVW9KYJ6Or1aL205yh/C2vcWM2aVb+n/07wNf+9wNC74unrUX2/Rmcf1b
6np8J/YSE4T9s6P4iC20MZRqdlWnUg/XCI9SecfhYNeC76XScKG7EUsRRa4+Mozil3tDLg6XPx3+
RXPDbkronhT+m0nKutmIo4esufjKMG333MY8OvV5+OvySNYpfKujlGT20MdVguSq0oSXrgx6/Jec
fhf0a9WeDP6fEYrD76+BxUF1qm6i9cEMv1Ol6z3ylc9oVnh5RnHbFprrWZtxaX/ws0VS03i3Hzak
41V1VYRqf5jGHDr1Z9qswXTC+W9HsBU/uMTiqL/GqdRe1icmXsz7rT1czsbcWmgowAwAwAwAwAwA
wA0EGAGwowAwAwAwAwAwAwAwAwA2kQCgDZQYAYAYBBCDLCgWiAUigWQC0FGyIP/V9hHsfFflYwAw
AwgMsAaKgwAwAwA1YA1YijLAGWANWAMsAaKgwAwAwAwAwgMAMAMANEBgBgBgBlioNWANWAMsAasF
GAGAGiAwAwAGyoNAGAGAGAGAGAGBBgBlgDQBgBgBgQYAYFGrAGWANWAMsAZYKMsAaAMAMAMAMAMC
DLAGrAGAGBBgBgBgBgBgBgBgUasAZYA1YAywBoA0AYEGAGAGAGAGAGAGAGWAMAMAywAwAwoMKDAD
ADYBhFGAGwDdgDZAYVBgBhQYAYAYAYAYAYAYAbIDLBRuxQYAYAYAJCDADADZFGwowoNoINhBgBgB
tEUbCjADCoMKDADABSIBRAYAYAYaBgBsijAoUiINlQbQUYFCkwAsQBSAFgCkwBYULTIBSyAFgC0w
BSChaCBSYULQAtMgFIoCJkARMKCJgC0wAiYUETACpgBEyAWmFBEwAiYAVMKCJgC0wAiZFBEwBadw
BaYARMKFpgBEwBaYAtMKCJgC0yAWncA2AbANphQoINhRtMA3cgNgG7lAq4BsgNgG7gCrgGwDADQB
gQYFCbgGgowINBBgBgBgBogEtlBoAwAwAwA0EGiAwA1cqjQBoAwIMANEBgBgBgBq5QYmAbIDZVG7
gCiA3cA2UCkyA2FGygUmAbIBSYAtMAWmFBEwBadgBaIBaYULTACJ2AFphQtMAWmALCggAtO4AtMA
WiAWgBaZVC0yAIALQBsKNlAtEBgBsoFoijYQbDQUgg2AJANAGgBLQAkA0ECbFUaCBLRFCSoNbQBL
VgAbQANoIBtAA2gAbRUA2gAbVwAbVwgG0ADaABtWCAbQAJoqAbQAJoAG0EAmigE0EA2gATQANoqA
bQANoIBtAA2gBDRQDaCATQAJoAG0EA2gAbQANoIENAA2gAbQAJoqBDVwAbQANoIBtFAhoAQ0AJYQ
DasAJaAEACGrACWgBFgLCGgKS0ECGUCGgBDVwBDVwAbQANoIENAbDaABtACGigG0AIaCAbQAhoDU
DaKK0QCWgBIAloIQmxVaaIgS0UCSAQ1YopLVyDRJQJaIBDRQJaCLCQrQiIgWgoWigWiAJEKDRAg8
QMjxIoNEAPFhQ4iyAcRYUOYsCU4iwrJzFkUOIsAcRYUOYsgHEWFZOIsAcRYUOIsgHEWFDmLCoPFk
GR4sKDxYA4iwA8WFB4sgHEWFZo8WBB4sKDxZAHiwoPFgB4sKUeLIMjxYUGQARABURQVABIgBIgBY
hQREAsKFhBgUKQQKCjYQLAMCjYBoAwIEsASwDRUCWACYANgA2ADYQDYACSAASRUAJIABJBACSAAS
RUAJIABJBACRQAkggBJADeaKgbSQQN5IAbSRUDeSCBvJFA3kggbTRUDeSAG8kEAZIADJFQAkgATQ
AJoAG0EA2ADKDADREGrAGiqNAGiINNAGiqNBBogEsKNFQaANMgN06fjJKK3tLvKD1P8A0gp6mEws
FvqyfdG3vPP03v8ApPEHlNo7vANIA9Y9F/2LofVn9ejiP5pSgcLy9+HjD5UeT7Hd4BlgD0L/AEes
PfFYqp9WlGP8Ur/5Tl1Hs+jTzRyPpzW+U6Uxkv8Auoqruk17jpjw8/U5vxFV1SuYtnQXDfKdKYOP
/dRTfYpJv2GcuHTp8z4jrX9ITEa2Kw1P6tKUv4pW/wApjpvR9JvmDz2dXjGrAHrDTv8AVfQ6Edjn
Ro2/HOMn6mzhOX0MvGHyg8n2O754ywB6c/o8YS0cZV4ulFdms37Uceo930acjzxpzE/LsXXq/Xq1
JfxSbOsePK7oirFZF58GuE+WaYwkeFVS/gTn7jOV8OvSm8oL/wD0gMV43SFGluhQT7ZSl7kjHTdv
pF8/IcGsdXkGWKD1j0n/AKl6IUqWxzpUF2zcZy95555r6GfjD8B5NPQ+eMAPTX9HfBZYuu/+NwX8
zfuOHUe36NOR586Q435xxmIrbfGVqkv4pNnaR5Mru/MQ4ZFv6A4H5x0rhKe1eOhJ9UXrP1Izlw6d
Obs+I6r/AEhcd4zF4ah9SlKf8crf5DHTej6TfMHns6vGMAPWcf8AkXuhvB1KPf4+fwl3HDmvoezh
8vzHkw7vng+Hmouz82Ss/c+x2fZYiwd9/o/aPbxuJqv+zpKDXOUvb5L9Zz6j1/Rp5o5v07x3ztpb
Gb9atKMeun5Ee+1uV77jWPiOHUu8qKZh14xOH1s195bO/NdbNuUD/QeC+da8MLvqzhFdbdvY2uux
LdLjN+B6T8PuLjGhhcGvSlOaXDxaSXepSS5nHpvd9JviQeXMP5alDirrrX5XS5tHd8+DMOvGKUPr
LLrWa7XmlzYWD1b4JKb0B0fr4v0pOtUjz1I6qXfF9rOGfmvodH7OO/iPKGF8uTh9davbtXrSvyOz
wQF0bJeM1JZRqJwd9mexvqdpdgIOk+BfRssVpqk2v3Mak5Lqi4+2SM53w7dCfaEl4Z9Na+nMs1h4
U4tbnfy2u1Ss+4mE8L18vtfAchxFN6NrvUecJXjLilnGS61Zo6cvPwN6VpRpVpaitCVpxXCM1rJd
idnzRItWPV/hAxEtBdF4UpZVK0aUJffn9JU77S7zjj5r39Txh+A8q6S+np0a3GGpL71PJL+DU7Tt
Hgqt4j9pwtOe+lKVN8oy8uHe3U7geg9D/wBHbCuosTVksqdowfOpZzX/ACjgcuo9n0b1SuO6f0p/
tDjdIO91UlOpT/5BSdu6nrnSTTz5XutVWuj/ANLX8TurRlStxlJeR3T1X2FrGIP0QoSxOkcLCKvr
V6cWuKckmuq178hTCeZ8R6E/pE6TVGjhMHHJOUqjS3aqUY/4pdxy6cev6TeIkedOkq8ZiZVV/bRj
V7akVKSXVJyXYdY8mXKt6X/aKGGrb3TdOT+1TlZd0JU0IXzoeovA/N9G+j1bG1NmtWqxv9WEbW/i
jLtZxz817uj9nHfxSvMOiqjxtHF05O8pU1VXOdOabf8ABKoztXhnnahdFPKxlOm9lbWov/kNF079
mtfsFMORZ/BJoZ6W01hotZUpOrLl4tXX82qiZ3Ub6OO8oVbv6Qel/luk4YdPKhSV19qflP8Al1TP
Tnh0+kZbuvckcr6RL5RDC1988PGMuulKVJL+GEH2m44Zenw/oVqX7TotcaGJ9VeHxovv5j1PT4X8
/wCoeqtH4KXRjog4xyq1MNUm+N6qc32qD/lOPNe+Ttw+SPJ3RLERwukMPKfmeNjGf3JPVl6mztXz
8PFioLF4aWCqTpS86EnF9admaZvgenfBdob5z0/LHtXisLSrX/45WpxjL1+M7jjlfD29LHeW/u/N
FO8N+kY6dxHj4bKNethn/wAg403/AIpVO4uHhz693fnZ+RHNtA/tGCx9HhTpVl106kYf4asn1XN1
xx8y/v1/pUnoJUUNJ4aMso1J+Kl1VU6b9Ui5cHT5n7+4VOrTdKTjLJptPrRXMW3p59LjnW3V6VCt
21KUJS/mbRnF06nPx1+QzSX7TojCVN9KtiKT6mqdSPrlMs5LxPjf0G+jH7ThNIUOOHjUXXSq02/5
XIlMOL8P1DHoRi1gNJ4So/NVenrfdckpepst4Tp3VnxEHpPBvR1epRe2nOUH+Fte4sZs0LT06+nq
YWvvrYLDtvi4R8U330zM/Vvqenwn9j9CNR/adBSW+hjYvqVak17aSHr8l5x+f5z+hpng/wDpsRXo
f3+ExUF1qlKcfXBDJOnz8r+RVIoVnhZxnHbFprrTuac1W/wk0FR0vjNXzZ1ZVF1VPLX+ImPDp1Pa
qQXpD+0aI0ZU+o8VRb+7UVRL/lKJyZcT5/v+I10S/acBpShveGp1V/yCrU7+qTJfRcPMvw/UqF6D
4v5v0rgqu6OJot9Wur+q5bwzhdWfGFRfSLB/N2NxFDZ4utUh/DJr3FjOU1fmq2dO/wBooaMrrZPA
whfnSqVKfsSM4+vxdOp6fBI3oX9q0DpGm/7KvhKq7fGU3/iQvJj7N+M/VQvBRUVLTeDUtk6jpvqq
RcP8wy4Tpe1Frn9ak6EnCW2LafWjbk06L4Tfpq+Er762Awk31qmoP1xMY/q7dX0+EZjeE/aujVeO
+jj6M+ypSnH2xQ9fkT2fnPyPVzU24tNWCBNgDQUYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAbsAKsQG
ygwAwAwAwDOykiCFFBgAQgFIKFooFEQKCj//1vYlj2PiPysZYAywBqwUaAMIDADADVgDCoMAMAMI
DADQBlgDLBRqwBlgDVgDLBBooMAMAMAMIDADCA0AYAYAYAYVBlgDVgDVgDLBRqwAOSCBIBgBgBgB
gBgBgBgBgBgBgBgBgBgQZYA0AYAYEGAGAGAGAGrBRlgDLAGrAGWCjQBgBgBgBgBgQZYA0AYAYEGA
GAGAGAGAGBRqwBlgDVgDQBoAwIMAMAMAMAMAMAywAwAw0DADYUYQGwDdgDZAYEGAGFBhQYAYAYAY
AYAYAbAMIowA2FGFBgQYAYAYAaYBoINkUbCjADCoFAGBBgBgAoijAowAwqDCgwA2iAUQGwDADADD
QMANkUYFCiINlQbCjAo2ALTACACkALAFoAURQsAXEAUUCyAUgoWgBaAFIAWgBaIBaYUETACJgC0w
AiYUFTACJkARMKFpgBEwAqYARMKCJgC0wBadiKCJgC0wAiYAtMKFpgBEwBaYARMKFp2AFgCkyAVe
4BhQbuRQpMA2EGwo2mAKIDdwDaZQbuQGwDYAq4BsIMCjVwBIUYAYEGggwAwAwA03YihFyoMAMAMA
MAEhBhAauVRoAwA0AYEGgDCAwAwA1coE3uAYUGAG0yAVe5AYAbKoUmAKIDZQbTAFEBsKNplAogFJ
gBEwoWmALTAFpgC0yKCJgC0wBaYARBQtABEwBaYAtOwULAFpgBEALQULIBadwBaZQLRFGygUiA2A
bKBaIowIFBoKQQbIDABLRQaANACWgDRQJIgS0FGioEtEUJKg0AIaABtAA2ggG0ADaABtFQDaABtA
A2ggG0ADaABtBANooBNBANoAE0ACaKgE0ADaCATQANooBtBAOSABtBANoAQ0UA2ggE0ACaABtBAN
q4ANoAG0ADaCBDQANoAG0EAmigQ0ADaCAbQAhoAQ0UCGgBAQIasAJaAENACGrACWgBDQGiGgBDQQ
JaKBDQAhoAG0ADauAIauEWBtAaDaAENAA2igQ0ADaCBDVwAbQGyWgBIAloASAaCLCWiqpJECWigS
QCGrFGoS1cgpJQJaIBLRQJaIjTaApaChcQBaACIALEKg8QMjxIoNEANEKHEWQDiLChxFgSnMWFZO
IsgHMWFDiLAHMWRQ4iwrNOIMAcRYUOIsgHEWFDiLAHEQrA8WQB4sKHEWAHiyKDxYA4iwrNHiwIPF
hQeLIA8QoPFgB4sKDxZBkeLADRCgqACoKCIgCoAIgAiCgqACEApAGwo2ggWAYFC0EGwo2AaAMCDT
KBBAaKg0wAcgAcgATABsAGwgFJAAJIABJFQN5IIASQACSKAMkEAJIABJBACSKAEkEDeSAG0kVA3m
ggbSRUDeSAG8kVA3kggbSRUDeSAG8kEAZIoASQQBkgAMkACYANhANgA2gBJQYQGgg00AaKo0AaIg
00AaKo0EGiASFGioNEBK6CofKcXQh9arTXfJIlax5HoD+kPWywcP983/ACJe85dN6/pPp8x5mOzx
DVgD1hjP6v6GLnRh/wApKq/4Rw9X0L4w+X6jygd3zxgB6g/o8YfVp4ypxlSj/CpP3nHqPd9GnI83
aUxHyvEVan16k5d7bOseK3dDAqDpPgiw3yrTWGW6LnJ9kJNeuxjPh26M3lBO+HbE+P0so/3dGEe9
yl/mJhw39Ivn5DjJ0eYYAer/AAxf1XoLDYffr0YW5Qpy96Rww5fQ6/jGT4Dygd3zxgB6w8Df9VaD
xOJeT16s78oU170zhny+h0PGNvxHk87vnjADsHgOwfynTEZ/3VKpPvtD/Mc8+Hp+jz7Qj/DHjPle
mq63QVOC7IJv1tlw4Z693kOXm3AEo0nXkoR2yaS62AeqPDvVWA0bhcLHY6it1U4Nf5kcMOXv+keJ
IPKZ3eAYAesPBR/UfR7EYrY269RP7kEl64s4Z+a+h0fGNvxHk6x3fPGWAOv+A/R/yvTEZ/3NKpPv
Wp/mOed8PR0JvIMvDNjvl2mayWapxhBdkU362y4cJ17vIcrsdHnCoQdRpJXbyRFHq/w1SWhtDYbB
x+vTh+GnB+/VOGHmvf1/GMg8nWO7wDQB608CUY6O0XiMbNWvJ6z4xpQyfra7LnDPl9DoeJaPLOOq
vFS8c9s23L72/vun2nZ4L5A8Q81UWWtnlulv9efJNAo6N4LtGrSOm8M0vIV6r5asW+5SVkZyvh26
U3lBYPDvpF1dKwgnbxNGFvvNuV+5ruM4cN/SL5HGa30M9aGSylHlv9WzrR0eajVdeJnrQyTtKPLf
6tnWipR6v6Y1P9meitOjHyJVIUopLdKb8ZJeqSOE819DP7OH4DydiopS1lkpeUrc9y6nddh3fPo1
i1eWtumtbte313QKPTfgJ0Z46tice/ThTin9qTbqfzRv1NHDOvd9HnNHCunWPWmMdVxcfNrTnblq
ycUuvVUZfiOuPh5epd3Ygcd9NTpVd7i4S64Wt/K4LsZWKJ7o/ov/AGhrYOja96yoz5RctZN9jn2R
JbprGd2viO5/0hsV4ylh6MX5kteUeUk4xfZqyXajn03r+k3hY83Yb6fDVYb6bjUXJN6krdblDsid
XjnClaM+nhWo/Whrx+9T8pv+DXXaCD1V4MMLLo/0cnXjlVreNnG/1n9HTXa0rdZxy817ulO3FK8n
aHxMcJiKc5+ZrJT5wllJdsW0dq+fjdVQK1Kei6zje1SlNq63Si/ii8nA7P4LtCLG9IteK+jpxliI
rcozitRdnjIvsOeV8PV0sd5fxSmnh5xTxOlkr3jGjGMeyUr9t7oYcJ9I835Ecyx/7RhMPU3wdSk+
pNVE+3xjS+6bcLxP3++VZRXynAVI76NWE1yjUTjN98aaBOB6u6X4H/Z/ovDAp6tSVGMbfajF1qve
oT7zhPNe/OduGvu/pR5P6LSSxlKDyjVbpSfCNVOm33SZ3rwY8qhYSlhJprKcHfqaZWOB6y8Degow
0jpDGpWg3FUvu1fpf8Op3nDOvodDHzb+/elcI8JuOjpvG/LoebiFJ/8AJupOkv5YRfadcY8vVu7v
3/1Kr9T9p0ZB76OIkn1VoJxXfSm+1l9WPT5/n/UJboNo19IZVsAttZUnH70asE32QlNkt01053eP
3yPS/hY0tHCV9HaNjaMK1SUZLcoTg6CvytUl3HLCer29a61P37v1SPFbTpPg0+5o7vmqs3TaKekK
1RbKzjWXVWiqv+YmLfU5/fr5HrHwUYinobo+tIVFnClU1n9aNGdVx/xNI45+a9/Rusd/vxtK8q0s
RLSmjsW5u844ijWb++qkJvtcoHZ4eZfjP1UHoV9LiZ0d1bD4in2ulJx/mURkmHPyv5Cr4TEvBVIV
Y7YSUl1p3RpiXQnumuGWE0liox83x1Rx+7KTlH1NEx4a6k834hx0m/aMNgK3HDOD66dWpFfy6pIu
XE+H6jMD+06HxMN9LEYeouqUasJevUHqTzjfjP1G+gX0uMdHdWoYml2yoz1f5rFyOnz8r+QptOo6
MlJbU011ormLb4Q6ShpXFSjsqVHVXVVtUX+Izjw6dTmgnSD6fRmjqu+McRRv9yr4z/nKWcmXE+f5
/wBIzo99PozSVLeoYesl9yqoeyqyXkx4vy/P+lQPB1WVDS+D1tkq0IPqqPUfqkXLg6fM+K1T8TQe
GnKD2xk0+tOxXPhV08IX02IoV99bB4Wb61SjB+uDM4unU5+U/JI1L6fo/wD7rH9yq0f+hQ9fkvOP
z/T+ga8HX02IxFDfWwWLgutUpTXrgi5J0+flfyKoNGq8POM47YtNdazK58Ku3hRoqlprGOOydV1F
/wAhEp/5jOPDp1faqQXT/wBPoTRk/qTxdJ8rShUX+NicmXsz5jfQj9pwelaH1sGqnbSrU5ey4y9F
w4vw/WKrfRLF/INI4St9TEUZd00zVYwurPjGq300wnyDSeMpfUxNaK6lN2JODOat+NIsfTX9p0fo
ivxwtSl/yar1F7GSerefE+H6pG+in0+htL0t6jhaq/BW1X6psXmGHF+X5lc1NuLTADADVggTYA1Y
KMAMAMAMAMAMAMAMAMAMAMAFWAN2IDZQYAYAYBGATbAI2iAWAYUG0QCwBaAFoKFIAVYA/9f2Met8
V+VjADADLBBooNWAMsFGrAGiAwAwAwAywBoqDADADCAwAwAwA0QGAGWKDLAGrAGrAGWANFBhAYAY
AaIDADADADADCgywQIkgBNgg1YAywBqwBlgDLAGrAGWCjQBgBgBgBgBgBgBgBgBgBgBgQZYA1YAw
AwAwIMAMAMAMCjVgDLAGrAGWCjQBgBgBgBlgg0AYAYEGANsAbYBNsAbYA2wKbasA21YBtqwDbQQ2
wBtgDbAJtgBgBhQbKowgN2AN2IDYQYAYAYUGAGFBgBgBgBgBgBsijLAGwowAwAwqDADADYBlgDdg
DAgQAYRRsKMKDaQQbCDADADZFGwowAwoMKgwA2QCgg2RRgBgBhQYUGAGyKNoAURBhQbCjAowAWgg
JEKFIAWALQAoKFogFIAIAKQApBQtBAtBQpAC0yAUUC0QC0woKmALTACJgBEwoJFgBEyAImFBEwAi
YARMKCJgBEwBaYAtOxFBE7AC0wAiYAtMKFp2ACIAWmALTChadgBYBvYQCk7gGwDYBtMKFEQYUG0w
oUQGwDdygUmAbIg2FG0wDADQUYAaCDAgwAwAwA1cihBQYEGAGAGACQgwgElUYAYAaCDADRAYAYAa
uUCbgGFBgBgBogMANgCkwDZAbKoUmAbIBRQZcAWncgNhRtMoFJkAtMAWmFC0wAidwBaYAtMigiAF
p3ACJgC0woWmAEAFp3AFxYULTACIgFoKCJlApMgCAC0FCigUiINhRsAUgo2ECgo2gBRAbKo0RAlo
oNAGrACWgDRQJIgS0FGioEtEUJKg01cAQ0ADaABNBANoAG0ADaKgG1YAG0ADaCAbQAhoIBNAA2ig
E0EApIAG0EAmigE0ADaCATQANooBtBANqwANoAG0ECGigG0EApIAE0ADaCAbQANoAG0ECGgAbQAN
oAE0VAhoAG0ADaCBDRQIaIAbRQJaAENBAhoAQ0AJaAENACGgEJaA0Q0AIaCBDRQIaAENWABtAA2g
BDQRsNq4AhoAG0ADaKBDQAhoIBtAWEAaJaAEgCWggS0FGgjRLRVCSIEtFAkgENWKNtWIBDVigS0Q
CWiitAaLRALiUC0QBAAkQqDxAyPEigyADRCg8QBxFkA4iwocxYVg4iyAcxYUOIsAcRYUOIsipTiL
AhxFhQ4iwBzFkUOIsAcRYVmjxZBB4hQ4iwA8WFB4sgHEWBKNFhWR4sKHEWQBosKDxYA4iwA8WRUo
8WBB4sKCxACIAKiKCIAIgAqCgiZAFQApACgDYULQQYFCohAoKNgGAGgDRWQlkUJAMKgGwAbABsAG
wAbCATQACSAASRUAJIABJBACSAASRUAJIABJBAGSKBvJBACSAG0kVA3mggbSRQN5IIG8kEDeSKgb
yQA3mioG0kEAJIADJAAZIqAEkACYANoIBtAA2AIANFBhAaCDTQBoqjQBoiDTQBoqjQQaIBIUaKgt
nQOh8o0rg4/8fpv+GSfuM5cOnT5nxHUv6QdfWxeGp/VpSl/FK3+U59N6PpPMHn07PGNEB6v8Iv8A
V3RfDUuMcNDuipf5Thjy+h1fGE+Q8oHd88YAer/Av/VuhMTiNj8ZVlflCnH33OGfL6HQ8Y2jygd3
zxgB2rwD4Xx+lZT/ALuhN9rcY+9nPPh6fo88/IVrws4r5XprFPcpQj/DCKfrTLhwx1rvKjnRtxEn
oTCfL8VRo/3lWEf4pJErWM3R6K/pD4u0MJR4urJ9iil7Wcum9n0m8DzEdnhGAHrDR39SdDpS2OdG
d/8AkLNxXqkjhzX0J4w+X5jyed3zxgB6L/o9YLWr4qt9WEIfxNv/ACo49R7Po05HGumeM+cNJYqr
tUq9S3UpNL1WOsnh587u34islcxa+guB+cdKYSntTrQb6ovWfqTM5cOnTm7PiOtf0hMd4zFYWh9S
lKf8crf5DHTej6TfMHno6vGMAPWOkf8AkX+h8Y7HUowt/wAhpqT9UmcOa+hfs4fL8x5OO754wA9J
/wBHnAXli8Q9ypwT67t+yJx6j2/RpzRwrpTj/nTH4mvtU61Rrqcnb1WOseXO7t+IgSsC19BdH/Om
lMLStdOtBtcovWfqTM5Xw6dObs+I63/SE0h4zE4bD/Upym/xyt/kMdN6PpN8yDzydXjGBB62oU/9
n+iCi8pVaNut15ZeqfcjhzX0fZw+X5jyjQjrqVN7XmvvL8rpLi0d3zxlJeNhKG9eUuzb6s/wgHf/
AOj5gfG18RXa/dwUU+dR3f8AgX6Zy6j2fRp5o5d090j896RxdW99WtJRf2IvUXZkrL7T5m8Zp5+p
lu34ioW8bT5wfqfuT/xFcxK6C0c9N16GHW2VWEPwzl7Fnd8yXw3jO7wPQf8ASExurRwuHi8taU5L
qWrF9Wckc+m9f0m8QeZX9JT5xdux5ruafedXhGfvKfOD9T9ya75d9B6s8H7/ANl+i9XFvKU41qq6
/Mh3uK7zhl5r39P7OG/iPLNJeOoTjvpyU11O0ZevU7mdnhgzC/TUatPetWoux6rS7JXf3QQdZ8BG
D+WaTbavGlTdTqkvIi+6cv0jGfD0fR5uhPhS0p876bxFBO8VRVGPXFKokubn5PaMfEOtd5X4f0jl
OhfKrxg9lS9P+NOKfY2n2G68+LQOiqvyXEU5NNpTSkt7i3aS7VdCmN8j1Z4U8Q+h2gcNg6btPWo0
01/xpa7l/FFd5xx817+r9jGT4JHlXTVGNDEVFBWg3rQX2JrWj6mjtHhy5UXTv0tSNb+9pwnfjK2r
N/xqQhkPUXgMwsPktTHS26kaMpPd4pyfdqumvwnHN7vo88bSvOXSHSL6QU54p+d8pqt33RreXBdS
cZnWTTx5Xu8/f+aovBfT4PEU98HTq9ibpvvdSPcVmcfv9+osngwwUdLaSp4SavCurS6qco1vX4u3
aZyb6U3de/8ArHa/DLp1LSeAwbdoK7q/drPxbv1RUu8xhPD09fLzJ+/PhI8rThPBza2ThLuaZ2eH
hUv0pgo42tKKtGpLxkV9molUj6pIkaz5HrDQWOfRnorLGNatWdC9/tOMaNJ9ygcL5r343tw3939C
PKVf9o0bTe+lXqRfVUjFxXfCb7Tu8Hp81ZohePwmMpcIU6q64VFD/DUk+q4pPMv7/fI6L4A9FSx2
l1W9GhSnJ8G5eQl/M32GOpw7fR5vL4JTTwydIHjdOTlB5YbUhHrh5T7pNrsLhPCdbLeXwWOe9LsO
sNpDExj5njZuP3ZPWj6mjccs55ocdJF8ohg6qzdTDRT66c50rd0I9jRIZenw/oHp3wkwfQzotSwU
cpTVKjJrjbXm+1xl3nHHzXu6v2MNfBHmDowvG08bR/vMLJrrpThV9kH2XO1eHD1+H9KmnRDFrA6R
wtR+bGvT1vu6yuu65bwmF1Z8RD6QwjwFapRe2E5Rf4W0GbNCxdNvpcRSrf3uGw031qlGMv5osYt5
/pPyGYz9o0Ph5b6WJrw7JwpSj61IepfOPzv6DfRf6fD6Qo/WwqmuunWpy/w6xKYcX4frAz6E4lYL
SmDqPYsRSv1OST9Vy3hOndWfEQWkMK8DWqUnthOUf4W0WM2aFo6crxtbD1v73B4aT5uNNU364MzG
+p+k/IaqfT6Dh/xrGzXZVpR/+dMevyX+b8/0/oG+g/0jxlL+8wOI/kSq/wDOMuX6ph6/C/2RVdE4
r5BiaNb+7qQl/DJMtYxuq0l+nOE+Q6VxlPdHE1kurXdvUTHhrqTVvxpEh0u/aMFoytxws6b/AOQd
eql6miT1az8yfD9aRrQn0+htIw+pUwtVcrSnB/40LyY+zfkEeC+SjpnCReyc3Tf/ACEi4f5hlwdL
2oVQakHTbT2p2ZtxVffCV9NjKVb++weEqdroQi/XExi69Xn5T8kjJrx3Rxf8a0g/+UlFf/Ox6/Jf
5vz/AEGeDP6XFYij/fYHFwXX4mUl/hGR0uflfyK57Tm6TUltTuuw24tr/wCFmmo6bxbWyc1Nf8hI
Rn7zGPDt1faqQrTn7RoDRs/7uvi6b7fFTXtYnJl7M+N/Q9SvB39LS0pS3S0dVl2wnTn7Exl6fE6f
r8Cuam3FpgBgBgBgBoA00ECQowAwAwAwAwAwA2kAKsAbAMAjAG2ANsAm2ANsAjADaVwBRAbKDABa
IDZQEIBaChSAFBB//9D2Oex8V+VjADQBhAYAYAYAaKgwA1YA1YijLAGWANAGAGAGAGAGWANWCDAD
ADADRAYAYAYAYAZYoNWANWANWAMAMANEBgBgBgBjABFQYAYAYAYAYAYEGWAMANWAMsAasAZYA1YA
ywBoKMAMAMAMAMAMAMAMAMAMCDLANtANsAm2BDbAG2ANsAbYFNtWAm2WANWAMsFGgDADAgywBoAw
AwIMAMAMAMAMCjVgDVgDVgDQQYAYUG7BQqwBsgMCDADADADCgwAwoMAMANkBgUYAbCjADADADCgw
IN2AN2AMCDADADADADTRFGgowA2kVBsIMAMANkUbCjADADCoMKDCAUECiKMAMAMAMKDCg2QGBoKQ
QbIgwoNhRgUYALDIVFhoEAFIAUgoIggUiKFlAtEApACwBSChSAFoAUgBYApMAWnYigiYARABEwAi
YUETACJkARMAWmFBEwAidgAidgoImALTACJ3IBaYULTACIAWmFBEwBaYAtMAWmALTCgiYAoAwAUm
QCgDADaYUKuQGyoN3ChSYBsiDAoUmAKAMANgGAGggwAwAwAwKEtgCQDAgwAwAwASEGrhRoAwA0AY
EGgDCAwAy4UJbKDRUGAGAGiAwgMAMKDADYBtMAUQGyqN3AFJkBsA2UC07kBsKNplApMgCJgC0FC0
AEAFogCJhQtMAWsgAgUETAFpgC07ACwoImALTACIAWgoWQC0AERQLCjaAFEBsAUgo2ECkFG0AKID
ZQYAaIDTRQJANWAEtAGig0RAloKElQaaChAAloIENAA2gATQQDaABtAA2ioBtAA2ggG0ADaAENBA
JoAG0VAJoAE0ACaKgG0ACaABtBAJooBtBANoAG0ADaCBDQANooBSQQDaABNAA2ggG1YAG0AIaCAb
QANoAG0ADaKgG0ADasADaCBDRQIaIBDRQJaAENBAhoAQ0AJauAIAENAWENAUloAQ0ECGigQ0ADaA
BtWAENWAsDaCNENAA2gBDQANooBtACGggG0BokCtNACQBLQAloCwkIrTQUICBLRQJILCWijRJAIa
sUCWiAS0UWFIg0XEAWgAiAFxCpRogZHiyKDxACxCg8QBxFkA4iwocRYVg5iwBxFkUOYsAcQYUOIs
gU4iwrJxFgDiLChxFkA4iwocRYVmnEWQQeLCg8QBxFhQeLIA8WAHiwrA8WAHiwoPFkAeLCg8WAHi
wFHiyKyPFhQZMAKgAiIoKgAkQAkQAsQoJEgFgCwDAoUggUFGwgWAYFGwDQBgQJYAlgGioEsAGwAT
ABsAGwgHIADJAAJIIG8kUAJIIASQAGSKgBJAAJIIASQACSKgBJADeSCBtJFQNpIABJFQNpIIG8kU
DeSCBvNFQNpIABJBAGSKAMkRACSKALQANoAG0EAmgBLCBIUaKDCA0EGmAJKowA0RBpoA0VRoINEA
kKOjeCXD/KNNYZbk5y7oSftsZz4dujPtQT3h1xHjtLKP1KEI+uUveZw4a+kXz8hxdo6PMFU6bqyU
VtbSXaUHqjw91FhdH4XDrZ4266oQa/zHDp8vf9I8SQeUzu8AwA9YdHP6q6H1JvJzo1/55SgvVY89
5fQx8YfKjyed3zxgB6P/AKPOE1qmLrfVjTivxOTf+FHLqPb9GnI4j0sxXy7SGKq7pV6rXVrO3qOk
4eXPzb8RXzTIvfgywXy7TGEjwqa/8Cc/cYyvh16U3lBevD7jPHaRpUlshQT7ZSl7kjPT4dfpF8/I
cKOryjYB6v8ACZ/UvRrD4bY2sPTa+7HWfriefHzXv6vjHXwHlA9DwDAD1b4EYLRWicTi5f3k3+Gn
BP2tnnz817+h4lo8qTm6jcnm27s7vAElB1vwJYD5ZpiE/wC6p1J961P8xzz4ejoTeQB4Z8d8t0zV
jupRpwX8Kk/XJjCeE693kOVWNuALQoSxE4wjnKTSXW8kDQ9TeHSstG6NwuEhsdRW+7Tg170cMPNe
76R4kg8pnd4BgB6x8Fn/ACL3R2vjNjl46qn9yOql3xfecMvNfQ6P2cd/EeTju+eMAOyeAzR/yzS3
jLZUaU5X5u0PZJnPPh6fo83REeGDSHzhpmvZ3VPUpr8MVf8AmbLhwz1rvIcyNuAPhsPLFzjTjnKc
lFdbdkRZNj1J4c8RHRWjMLgoZJzSX3aUbe1xOOHmvd9I8SQeX68m3Gqtr2/eW33S7bbjs8I3Ul4m
anFKztJLdzXUndc7AHqvwTUI9GtC4jGy2OVSqm98IR8ntun2nHPzXv6P2cbR5VT8VVam7ptqT4p7
/ejs8ARRj4qbhLK94vgufY7PsCaHUPAto2WM0xBtZUoTnJPl5K7pNPsMZ3w79CbyDrwx6S+ctMzo
p3VOnCkutrX/AMUkn1DCeGuvlvIchwnlScPrrV7d3rSNvPBmDXjJan11q9r8312BB638IMI9HtA4
fR3pVVSodqjfW6tdJvrOGPmvodT7OOvkPJ2i3eqoPZO8Hw8pWTfU2n2HevnwJ0bNUa0dfKLbjK+6
Mlqy9TYqTwPTXgE0V82YfF4uqtXy1Td9yppuX+LPqOPUr3fR5qWjznpjSFT5wq4iX7zx858tbXb7
jtHkyvnf3iO0jQWDrzjDzVK8H9l5xfarMM2aWL30U0OtN6dw8LeTOpGu1uUdXxrX+UzbqOuGO8v4
/qq9f0htJuti8Pht1Ok59s5W9kPWZ6cdfpN8yJHENJrx1KhV23g4Sf2oNpLsg4HR5qreJ+nwlKe+
nOdN8ou0497dTuBeB6iw8f8AY7oe5bJ1aLfO9d2XaoyXccea93s4fL80eX9GfTUMTS+xGpFfahJL
1RlM7PDPVWdHl4yrKl/e0qsLcZajcF/GoimI6/8A0fND/KsfWxLWVGlZfeqOy9Sl3nPqV6Po03dp
VB8KWl3pbTOKnfKFTxceXi/Jy7U32msZqOXVu8qqudKVfGVZrZVaqrqqxVRf4jUYz5DzSGClpeeC
UM516VOmvvRnKjFd0Y944Wzevv8A6h6O8OtVaF0Rh8FSyg5wh+GnF2Xek+w44ea9vX8TSR5m0Z9P
gsXT+r4qt/DPxf8AzlOzwzi/L+x+qt9FPpMRKl/e0a8OtunJx/mURTDn5X8h6R8A+BhoPReK0jVy
U5Nt/wDG6MW2+9y7jln5r2/R5qW/vwleZelsZR0ji1N3l8oq3fF67OseHPm/GqP0r+lq0av95hqD
7Y01Tk++D7RFz/SC++D/AEH/ALS1NGQavGliq+v9yEadVJ8m3JdpnK6269PHu18b+lHS/DlplaR8
fgFn8moUq7+9KrGn/hmn1MxhHfr5b8e6b/ikeeOhHl4+nT/vY1aX/J2nKn/mOuTx4c/v3KqUZOm0
1tTujTmLT06glpPEyWSnVdRdVTy1/iJjw6dTmhXSL6fCaPq7/ETpvrhWqNfyyiiQy4nw/UawP0+i
MVD+7xGHmupxqwl63EepOL8Z+o30F+kxc6X97hsVDtdGer/MkMjp8/K/kKjQrPDzjNbYtNdadzTn
wLP0+oqhpXGKPmuvUkuqcnJepmceHTqc34g3Sb6fBaNq7/k9Sm/wV6jXqkhDPifD9aM0V9PofHQ+
pWwtVf8AKWD/AMaF5MeL8v1GvBz5Wk6VP+8jWp/8nKU4e8ZcL0+fx/IUY24qvHhK8rSlaf8AeRo1
P+TlKE/eYx4durz+H5LGtLftGhMDP+7r4qm+1Upr/Ex6pfZnxv6DXQ36fDaTo7pYPX7adalL2XF9
Fw4vw/WFQfQ/EfI9JYOp9TE0Zd04st4ZwvmfGFNOlGG+R47E0vqV6se6bRYzlNW/FVj6dfS0dGVf
rYCEe2nVqw9iRnH1+LfU9Ph+tSN6I/aNA4+H93iMJUXaqsH7ULyuPs34z9RrwUf8xrCx+u50/wDk
5TlD3jLg6XtQrnLVjbi1HRvCh9Ljqdb++wmEqd9CC9xjF26vPyn5EZNeN6NL/jekn/ykoL/gD1+R
/N+f6HqzwWfS42tR/vsFi6ffRk/cMjpc/K/kVzU24tMAMAMAMAMAMANWCDTQAkKMAMAFaoGdt2sA
22BGAGAGAGAGAGAGAGAGBQsiDZQYAbQULIg2iqFkQLQULQAsgP/R9lHrfFflY1YoNWANWANAGEBg
BgBgBgBlgg0UGEBgBqwBlgDLBRqwBlgDLAGgDADADLAGrBBgBgBogMAMAMAMAMsUGrAGaoBqwBoA
0QGAAyoNAGAGAGAGAGAGAGAGAGAGANsCG2WAm2ANtANsAbZYBtqwDbVgJtlgptoAwAwAwAwAwAwA
wAwAwAywQaAMAMCDADADADAo1YAywBqwBoKMAMCDVgDADAgwAwAwAwAwA1YKNNAG0ig2QGBBgBgB
gBgBhQYUGAGyKMsAYAbCjADADADADLFQbsAbsAYEGAGAGAGAGAGAGyAywUIeQUYggUVBgBgBgBsi
jYUYAYUGFQYAKSIg2RRsAwAwAwAwoMKDZFGBQoiDYQYUG0FGBRsAUGRtBQRBQpACwBSAFkULQAqI
AsoFogFJhQsIFIKFAC0wBQAtMgFphQRMAImAETAFphQRMAImQBEwoWmAETACJgBEwoImALTAFp3I
oIncAWmALTACJhQtO4AtMAWnYAImALTChaYAoAwA2nYgFJ3ANgGwDaYUKIgwqjaYAq5AbCDdwoVc
A2EGAGAGAGAGrhQlsA0AYEGAGAGACQg02FGgDADQBgQaAMIDLhQm5QaKgwAwAwgNAGEBhQauECbh
RlwBSYBsA3cAVcA2QG7lULTANkBsoFJkAoKNplAtMgCJgC0woWmAETAFpkUETACJ3AFpgC0woIgB
aAFpgC4sKCIAIiAWgoWmUC0yAIgAiYUbRQLIDYBtFUKIg2goUgBRAbKDdrgGgDCKEtFQJAMAEtAC
Sg0QCWgBJUGmgoQAIaCAbQANoIBtAA2gAbRUA2gAbQANoIBtAA2gAbQQDaKATQQCaABNAA2ioBNA
A2ggE0ADaKAbQQDauADauECGgAbQANooBNBAJoAG0EA2gAbQANoAQ0EA2gAbQANoIBtFANoAG0EC
GgBDRQIaIBDRQJaAENBAhoAQ0AIauAJAENAaIaAEMAQ0ECWigG0ADaAENAA2rAahDQRQ2gBDQANo
AG0UCGgAbVgiwloDRABpoATYA1YAQ0BY0BSWggQAJaAEgahLRRSSAQ0UGrEBiAuy0A2UgGxEA2Wg
psWIEHiFBokAaIAeIUHiQDiLChxFgZOYsKhxFkA4iwocRYUOIsgHEWFZOIsAcRYUOYsgHEWFDiLA
lOIhWR4sgDxYUOIsAPFhQeLIA8WFZHiwIPFhQeLIA8QoPFgB4sKDxIMjxYUHQARABUFBEQBEAFTA
CIKCogCACkUGyKNoIFgGBQtBBsKNgGgDAg0VAgijRUGmADkADYANgA2ACYQCkAAkgAEkVACQACSC
AEkAAkioASQQAkgAEkUAJIIG8kEDeSKBtJBACSKgbyQA2kioG8kEDeSKBvNBA3kggBJAAZIoASRE
AZIoBtAA2ggE0AIANNBAkKNFBhAaCDTQUJKDADREGmgo0UGgg0QHY/AZhfH6Wcv7ujOXe4x/zHPq
cPV9H5+QgPC3iflWmsS90XCK7IRT9dzWHDn1r9qjm5pxE70Uwny3SGFpfWr0k+pyVyXhvCbs+I7f
/SGxWtUwdLhGpJ/icUv8LOfTer6TeB5xsdXiGWAPV3S/+qeiVGlsc6WHj2txm/YzhPNfQz8YfgPK
Fj0PnjLAHq7wGwWjdF4nFS/vJPspwT97PP1OX0Oh4lo8rTk6jcnm27s7vn7CQDsngMwXynS2v/dU
Zy7XaP8AmZzz4en6PN35CE8LmM+WaZxHCGpBfhgr+u5cOGetd5Uc2NuAktC4L5yxVGh/eVYQ/ikl
7yVcZuj0V/SExurTwlBb5VJtdSil7Wcum9v0m8DzGdnhGAHq/Bf8i/0PlJ5OpRl/ymm4r1SRw5r6
E+zh8vzHlA7vnjAD0d/R7wGtUxWIa2RhBPrbb9iOPUr2/RpzRxHpZjvnTSGJrbVOtUa6tZ29VjrH
lzu7fiK9YrAufg80d856WwlPavGqT6oeW/8ACZyvh16U3YOlf0gNIeOxmHw98qdJy7Zyt7Iox03b
6RfOhwKx1eQZYA9X9KV/s50Tp0dkqlOjHtm1Oa/xHCea+hn9nD8B5Psd3zxqwB6f/o+6PVGjisVL
Y5Rgnw1U5S/xLuOPUe76NOaPOWmse9K4mtiHtq1Jz/ik37zrI8eV3diMKyL54MdG/Oul8LC11Gp4
x/8AINOftSRjK+HXpTeUF68PukvlOkKVBPKlSu+Uptt+pRM9OO30i+RxOj9JGUOWsutbfVftSOjy
jI/SU2t8HfseT9drdbAPVPSv/kVeilPD7J1KdKH4pvXmv8Rxnmvfn9nDXwHlat9JGM9/mvs2eqy7
GdngGYjy1GfFWfWsn6rN9YKPTPgG0blicc/TUIJ81dz73Z9Rxze76POaPPnSjH/OmNrYlN2rTlOL
5NvLs2LqOs8PHnd3YiMVlPWWWt5Stzzy6nddhWKLd0L0T88aYw1JLyZVY1Gvsx+ka7k0ZviOnTm8
oOmf0gtLOpisNhov93TdR24zdl3KHrM9OPR9Jy8yDg+k19K5LJTtNctZa1uy9uw6R5KFaV8qq57q
iU+2Su0up3XYIUer8XX/ANmuikqmypXo3fFzxDzfdJvlY4c19C/Zw+M/MeUdKrxjhU+vTi+2PkNv
rcW+07×8+jNJLxsaVX61NRfXB6qX8Ki+0FHoPwEaK+W1XjX/AGNKVD8Up69/4XqnLOvZ9Hm/PyHM
fCVpX/aDF18Qs/F4idJP7CSUO/Vm+03jNOHVvdfm0pkPpsHJb6dWLXVUi1J98Id5pz9BJdGNGvTz
lg47ak6Mk+euqfsqtvqJfC4Tfj4f2P1HpTw0aQjQwtPRkLJVKdSdvqqglOPfZrsOOHve7r3xr9+E
jyz0c8vFQp/3utS/5OxdNd2tc714MeVMtF4z5vxFKt/d1Iy/haYqS6Hrjwd6PXQPQ2MxU/OU68lf
eqV4RXa4u33jhld19Dpzsxt+KPKnSj6TFzqb6qhVfXVhGo/XJnePBlyrNOfS08NV3zoJPrpzlTS/
hjEkXL0+A6v4H9DfPuIwk2rrCVa85dWrT8X/ADtsxndO/Rx7rPu2lSXhn0z884jFYaLvHCxw8u28
lL/ldFPmhhNL18t2z3a/f8SOLdGV4ypVpbqmHrrtjB1F64I6V5sP0qm3RrErBY7D1H5sa1NvqUlf
1Cpj4s+I9U9OoroJ0Xhgou05xhR/FN69TvtJdpxx817+p9jDSPL3TBa+LdT+9p0avbUpQm/W32na
PDnz+H5KzTP02DwVT6sKtL+GrKfsqLssIZcT9+v9I9B/0ccK5U8VVkvJUoRg+bTc/VqHLqPX9GnK
VybGaa/2m0rpGqneNejidX7tKOvD1UkdJNRwuXdb98v7/gqidGsX8gx2Grf3delL+GaZquWN1Z8Q
00xhPkGJrUf7upOP8MmhEymqJrpl9JWo1f7zC4Z9saUYP1xZMWs/0n5DeM+n0Rh5b6eJxEOyUKMl
61IvqXifG/oM6OLx2E0hT/7p4TXXCvS90pEpjxfh+sA+gNRU9K4O+yVeEH1Teq/UxlwdPmfEVSrT
dKTi9qbT7DTmLd09+kxqqbquHwtT+KhTb9dzOLp1OflPyGtI/T6Gwkv7vE4mD7Y0Zr2sTlb7M+N/
Qb6LfTYTSVLjhYzXXTr0n7GxUx4vw/WBn0ExHyTS2CnuWJo36nNJ+oZcJ07qz4wV7SOG+R1qlP6k
5R7m0ajNmha+nq8ZUwlT6+Bwr7Y01D/KZx/Vvqenwixr97oB/wDG8ev+UlF//Ox6/Jf5vz/RWeD/
AOkrYmn/AHmBxa7VSlNeuIy/U6fr8L+RVGw1Z4apGa2xkn3O5pynhVu8JlDxGmsclseIqS/iet7y
Y8OnVn2r8UgvSb6TROip8IYmH8NZy/zknNMuJ8/zG+iv0ui9LU9/iaE1+GvBP1SYvMMOL8vzEd4O
6/ybTGBl/wB1VFdjmk/aXLhOn7U+MKrmmsP8lxVan9WrOPdJosZynlYufhD8uOjZ/W0dQ/llOH+U
zj+rp1PT4RY3or6fo9jY/wB3i8LP+KNWIvJPZvxn6nqzwQr+vMLH67qQ/jpTj7xnwdH2p+/Qyc0N
uLTADADADADADADADADVggS0AaChaAzWwIwAwAwAwAwAwAwAwA2kRQoINlBgBgApEUKCBSAFoKFo
AWgBQB//0vZR63xX5WMAMAMAMANWKDVgDVgDRAYAYAYAYAYAYAZYAywBoIMAMIDADVigywUasAaA
MAMAMsAasEGEBoAwAwAwAwAwAwAyxQa1SBsKUbFRNkgNtANsAbYA2wBtgE2wAwAwAwAwAwAwAwAw
AwAwAywQZYA0AYAYAasAZYA1YAywBoKMAMAMAMAMAMAMAMCDLAGgDADAgwAwAwAwKNWANWANBRgB
lgg0AYAYEGAGAGAGAGAGAGAGAGAGFBsAwKNgGBRgBgBgBgBuwQZYA2EGFBgBgBgBgBgBsAwijLAG
AGwowqDTVwDQBgQYAYAbIo2FGAGAGFQYUCkiA2EGyKMAMAMAMKDCgwA2RRsAURBgBhQbQUYFG0EC
gg2goXEKFACwBSChYAtEAoAWAKTAFgCkFCgBaYAoAWiAUigWiAWmFBEwAiYARMAWmFBEwAiZAEQU
LTACJ3ACJ3ACJhQtMAInYAWmRQtO4AtMAWmAETChadwBaYAtMAImALTChV7EApMA2UGEArWAFAGA
G72AFXuRRsIMuVQpMAUQGAG0wBVwDYQauFCbgGgDAgwAwAwAwASAJbAMAMANAGBBoAwgNNlUaANF
QYAYAaIDCAwoNXCDVwo0UGgDADYBtMgFAGwDaYUKIg2VQpMAVcgNlUbTCBRFCkwAiYAtMAImFBE7
gC0wBaZFBEwAiYAtO4ARMKFpgCwAgUETuALTAFpgBAoWQC0AEQULKBaIDYBhVCyINoKFACgDYBtA
G2rkUJKgwKNNXCBABgAloASUGmiATYASUGmggQ0FA2ggG0ADaCAbVgAbQANoqAbQANoAG0ECGgAb
QAJoIBtFAJoIBNAAmggG0UAmgAbQQCaABtFANoIBtAA2ggQ0ADaKATQQDaABSQANoIBtXABsAQ0A
DaCAbQANqwANoIBtFANq4ANoIEACGigS0QCGigQ0AJaCBDQAhoAQ1cAQBYS1YCkNACGggQ0AIaKA
bQAhq4ANoCkNAaDaCAbQAhoAG0ADaKBDQQIA1CWrgUloA1YAQ0AaAEtAaJAEtBAgA00AIA2S0AJA
EtFAkgFoAXEAWgBaCgkQA8QA0SKDRADRCg8SAcRChxFgZpzEKhxFkA4iwocRYA4iwocRZBk4iwoc
RYUOIsAcRZFDmLAHEWFYHiyAPFhQeLADxYUHiyAcRYVKNFgZHiwocRZAGiwocRYAeLADRZFSnEWB
B4sKCoAIgAqIoJEAIgAqCgiACogFIAUAbChaCDAoUggUFGwDADQBorISyKEgGFQDYANgA2ADYANh
AKSAAyQA3kioAyQACSCAEkAAkioASQACSCAEkUAJIIG8kAN5oqBvJBA3kigbyQQN5IIG0kUDeSCB
vNFQN5IAbyQQBkgAMkVAGSABMAEwAbQQDeQBoA1YIEhRooMIDQQJaCjRQYAaIgS0FGFBoIPQn9H3
C6+IxVX6tOEf4m3/AJTh1Hs+jTzRx7ppivluk8XPc69S3UpNL1I648PPnd2/EVg05jofgownyzTO
FW6MpSf4YSa9aRzz4dujN5QWTw8Yrx+lYw3U6EF2tyl70Tp8On0i+fkOLo6PKCUaTryUI7ZNJdby
APU3h3qrA6OwuGjsdRW6qcGv8yOGD3/SPEkHlU7vAMAPV2gv6k6IVJvJ1KNV/wDJyTgvU0cL5r6G
PjD5UeUTu+eMAPSf9HvBXeLrvcqcF26zfsRx6j2/RpzRwjpNjvnLHYitunWqSXU5O3qOseTO7t+I
gysjoXgqwHzhpnDR3Rk5v8EXJetIxlw7dGbygtXh4x3ynScKS2UqMU+uTcvY0Zw4dPpF8/IcTOry
jaWtkgD1b4YH8x6Dw+DX1qVO3KnB39aRww819DrfZxk+A8ond88YAer/AAU/8i/0fxGMeTbrVU+U
I6qXfF95wz819Do/Zx38R5Qbud3zxgB2zwEaP+VaTnVaypUZNP7Umor1ORyz4er6PN35CreFbSHz
jpjEtPKElTX4IqL9aZrHhz613lRzw24iS0NgHpXE0cOttWpCH8UkiXwuM3dD0X/SBx6pUcLhY7HK
U2uGqlGP+J9xy6b2/SbxB5iOzwjAD1h0b/5FjonUrPKVSnVn21HqQfdqnC+a+hj9nAeTzu+eMAO+
+ADRnj8ZXxLWVKkorrm/hF95y6lev6NPOxzXwiaS+d9K4qrtXjHBdUPIX+G5vHxHHq3doptOTpSU
ltTTXYachYuj+i/nHSFDDxV41akY/gm8+1Ju/NGbW8Zu6HfPDxpK/wAmwS9NTm1zyUPXfsOWEev6
ReIPM9Ba6lDirrrjn7L9tjs8MGqa8ZCUd68pex+5v7oB6q6Pf8il0TnW2TqU5zv9qq9SD7nE43zX
0Mfs4Dyr+8p84v1S9yafbI7PAMl9JTT3xdux5r16wB3bwC6MWMxc8S/7Cm4Lk5u6fcpo59SvV9Hm
7v3Ch+FDSi03pPEVU7qFR0lwtDJPtakzWM1HLrXuopOIXjaNOX1XKD6r6yfbrNdhpyEjo7R0tOSw
1GPnSq+Jy3KUk032yl2LkTempO7Q9DeH3F/JMHhsJTyhr6zS3KMWoLqd3/Ccum9n0i6kg80y+mwq
e+nUafVNXS7HCXedni9BtfTYV/8AG6qa6qkc+7Uj3hPQeovBmv8AZHo5Wx0spT8bWV+S1ILtccus
45ea9/S+xjv4jy9g269HEQeeUanNyjLV9k5N9R2eGeWmtEfSKtT+vRlb8DVT2Qa7RTH9P6R0zwGa
MljtLKp6NGnOb4NvyUu93XUYzvh3+jzdSnfhM04sf0ijFv6Oi6dF/df7z/FJdgxng6uW8hxiDno6
qnsnTnfqcX8UbebhT3TOD8XjKtKmrrxslBcU5eT3qwjWU8j1P4YcZ/s9oOlg7+XVcIStvUVrTfbJ
K/WccPNe7rXtx0keXdMfS0sLU3ujqt84VJxS/h1TtHhy9PgrMQvHYCk99OtVi+qUYOK71MHp8x6O
/o/YH5uwWKxtR2hKaWe5U4tyf838px6j2/R5qWpXBKGk5aexWNqT24mlXm1936ZLs1PUddaeTfdb
9+/7KoronNQx+HUvNlVhGX3ZvVfqbLWcOYJXwe6Bem9LYbDyWSqa019mn5Uk+u1u0mV8NdLHd0Op
/wBInTfyjFYfBxeVKDqS+9N2SfUo3/EY6cd/pOXnSRxjpD9JTwdT6+GSf4KlSn7Io6R5svT4Kyqv
HaLh/wAaxVT/AJSU4f8Aztj1PT5/v8h6g0JRl0G6IzqxVqtSjKpz1q1lF9kXHuON817sfsYfv1R5
f6E+VpCjD+8cqf8Ayci4f5jtk8PT5VVPNzRpgWjpyv6zxMlsnVlU/wCTnl/5jOPDfU5o30jXjcNg
KnHDSg+uFer7nEQy4nw/WjMOvG6HrL+7xdB9k6dVP/Ah6k9n5z9RnQ36SpiKf18Hif5Kbqf5C5GH
r8KIHQuI+R4qjU+pVhLukmKxj4oc9KsN8j0hiqf1K9WPdNoRrLxb8aJTph5ccFP6+CpfySnT/wAh
J+q5+nwGRXjNCS+xjYf8pKUv/nY9T+b8/wBBroP5c8VD6+CxP8sHP/KMv1Xp+vworOiq/wAlxFKp
9WpCXdJM1XOciV6b4f5LpTGw+riay7NeViY8NZ8340SHS76bC6Mq8cG49sK9aPwJGs+J8P1pGtF/
TaEx0fqYjCTXaq0X7ULyY+zfjP1aZ4M/K0pSj9eFeH8dGpH3jLg6XP4/kVz825KvnhQV9LVpfXhQ
n/HRpy95jHh16vP4fkkJ0t9NoHAy/u8Vi4fxRoyE5L7M+N/QZ0D8ulpOH1tH1H2xqUpe5jL9Tp+v
w/sFVfo1W+T47DT+rXpPummarnjzPip706o+I0rjofVxVdf8pJEnDWfN+NSJrpn9Lo/RNTjhakP4
K9Re8k9Ws+J8P1rUK6M+XoXS0eHySfdVcf8AMLzDH2b8vzKZ+C+r4nTeBf8A3UU1/E7e8uXCdL2p
8SqfpKh4ivUh9Wcl3NornVMLFRWgDADADADADADADADADVggxZBWa2BGAGAGAGAGAGAGBQqxAKCD
CgwAwA2goURBsoFoihSACIAWgBVgD//T9l2PY+M/Kxlgg0AYQGAGAGAGAGWAE2ANWAMsAZYA0AYA
YAYAYAYAYAZYA0EGEBgBgBqwDbLFU21YCbaAbYA2ywDbVgG2ERNtAGAGAGAGAGACZFQIAMANWAMs
Aa1QDNUA1YAwA0AYAYAYAYAYAYAYAYAYAYAYAYAYAYEGWAMANAGAGBBgUasAZYA1YA0FGAGAGAGA
GAGBBlgDQBgBgQYAYAYAasFGWANWANBRgQaAMCDADADADADADCg2FGAGwowAwAywQbsAZYAyxAbC
DCgwoMAMAMAMANkBlgowA2FGAGAGFBgQYUGAGiA0EGAGyKNhRgBgBhQYVBtIgFBBsijADADADADC
gwoMANkUKQBsiDADDQNkUYFG0ECgg2go2sgoWALQAoKCIINoighQKTIBRQLRAbQULQQKQULQApMA
WAKTIBaZVBEyAIgBaACIKCJgBEyAImFC0wAiYAtOwARMKCJgC0wBadgBaIoImALTAFpgCwoIncAW
mALTAFoKFpgGyAUmAKAMKDd7EApO4BsA2AbTAFEBgBtMqhVyA2EGBQq4BoA0AYEGAGAGAGACWwBI
BgBgBgBoINAGEAkqjADRUGAGEBoAwgNNlAm4BooMAMAMIDADQQbCjd7AC07gGACkwBRAbKo3cAUm
QCig2nYAURQtMAImALTChaYARMAImALTIoImALTACIKCJgC0wBaYUETsAEQARAC0RQuLKAiIBaAC
IKFoA2AbKBaIo2AbAFhBsNDaCBRFGNXAEFQYAaauAIAMAEtACQDTQAmwBooEtXCAbQANoAG0ADaC
AbQANoAG0VANoAG1YAG0ECGgATQQDaABNFAKSCAbQAJoqAbQAJoAE0EA2gAbRUA2rAA2rACGggG0
ADaKATQQCaABtAA2ggG0QCGigG0ADaCAbQANoAG0VANoAQ0EA2gBFgBDRQJaIBDAENFAhoIEMAQ1
YAS0AIA0Q0AJaCBDQAhoAG0UCGgAbVwAbVwNQhoIobQAhoAG0ADaKBDQANq4RYSBpq1wBDVgDQAl
oASBYS0BSbACWggTYAS0BYQBoloASAJaKDaIBcQBaAFoAWgoNFgB4kUGiAGiFB4kAeLAHEWFSnEW
FZOIsAcRZFDiLAHMWFDiLIM0eLChzFgDiLChxFkA4iwocRYVmnEWQQeLCg8WAHiAHiwoPFkEo8Qr
I8WAHiwoPEgDxYUHiwA8WFSjxZBB4sKDJgBUAERAEQUFQASIAWIUEiyAWgBZQYRQpBAoKNhAsAwK
NgGgDGECWAJYBoqBLABsAGwATAByCAcgAMkAAkggBJFACSCAEkAAkioAyQACQQAkgAEkVA3kgBvJ
BA3kigbyQQN5IqBvJADeSKgbSQQN5IqBvJADeSCAMkABkigBJEQCaKATQANoIBtACCgwgNNBAkKN
FBhAaCBLQUaKDCA0ECWgowoPUngGorC4HFYiWx1LN8oRv/mOHUe76PNS0eXsRWeJnKb2ybb627nZ
4dgBQdr8A+D8fpOdR7KdCT7XKK9lzl1OHp+jzz8hU/CpjPl2mcVLdGSh/BFRfrTLhw59a7yo56bc
Raug+C+cNJ4SntTrQb6otN+pMzlw6dObs+I65/SDxuvicLQ+pTnP+OSX+Qx03o+k3zB56OrxjAD1
d4SP6j6NUMNsclQpvrjHXfricMfNfQ6v2cNfAeUTu+eMAPV3gn/qLQGIxbybdaonyhGy9cWcM/Nf
Q6P2cbfiPKJ3fPGWIDu/gCwHjsfWrPZTo27ZyVvUmc+o9f0eefkKD4Scf846Xxc9tqjh/wAm0of5
TWPDl1bvKijmnIWboZo/510lhaNrqVaF/up3l6kyXhvCbs+I7H/SC0hr18Lh16MJ1GvvNRX+FnPp
x6fpF4g87HZ4xgB6v6Sf8i30Tp0dkqlKlHtqNTmu7WOE8178vs4DygdngGAHqPwCYOOCweKxk8lK
ajflTjrP/F6jjm930ealo8z6RxktI1qlaXnVJym+uTbftO0eK+QzKyOn+B7Rvzjpii2rxpKdR9is
v5mjGd8O/Qm8hJeHDSXy3Szpp5UaUIdrvN/4l3Ewnhr6Rd0ceOjzBdKm60lGKu20kubAPVXhjqLQ
GhcPgYPbKnDrjSjn61E4Yea+h1/s4yDykd3zxgB6u8EVNdHdB4jHzXnOpU64042S71I4Z+a+h0fs
47HlOc3VblJ3bd2+bO754SAdo8CejPnLSUar/wCSaE5fxeTH/FJ9xzzvh6ehN34CO8MukfnHS03F
3jSSpLritaXrkMJ4Tr3dHNK1TxdRVFvtJcL7+y91+rm3AOMJhnUxMKUM9eSjHi1PJd6YWTyPT3hi
xEND6NwujobJyUF92nGy7pOD7Djh5r3dfxJB5Wwy1m4fWTXbtS70kdnz4E4daylHjFvtjnfuTXaC
D1P4JKS6NaCr4+Szl4yp1xpqyXepd5xz819Do/Zx2PLUajxCqazvJ+XzbTz9Tkzs8AXhfpKVWHBR
muuLt7JN9gIOq+BDR/zhpPyleNKLq/iV4R/xt9aMZ8PR0Jugnhe0t88aSxNFO8aFOmor7UHeXcqk
79XImHiHWy3b9w5LgPpIVqfGGslzg02+yOudHCAuhqTxbqUIq8qlNqK5xan61FrtFMfI9V+EqMNA
aGo6Mj6cPFrn4mm537Zxj13OGPm7e/q/Zx1+/A8paD8quof3inTXXOLivW0zvXgxCNByUMVS1soy
moy+7LyZepsVMeWnpnwHaOWgtH4rH1lq3k78oUU233uS7Djndvd0JqW/vwleaekdSVTHYiU3eTrV
G3z1mdo8WXN+Ks6RZ4qrPdUfjF1VEpr1SEMuR0XoRoX5/wBN4NtXgqdKtL/kFBRd+ucbPrMZXUdu
nj3ZQT/9IPHyxOMoUU/IpU32Tk05fy6neTpt/Sb5SON1vpcBTe+Feqn1TjTcf8Mjo83p81bwf0uB
xEd8alGp2JVIP1ziFnH4D1XjsE+iXRX5MvJqzw8k1v1pxlUqLsjrLqRw5r3WduGvuR5T6KLWx1GH
95J0v+TqdP8AzHevBhyqCw9Z4ecZrbFprrTuVkeq/A/0eVPSuksXbyadSdKm/vTcm12KPZI4Z3w9
3Rx82pXEvCrjY6W0pUxUHeFaMJQf2UtT/KdcOHm6t3dqr2kfpdH4Wf1Z16f8Pi5/85Cs3ifMTfQz
Q76SUp4KO2eKwr6o/Swk+xSTfUS3S4Y93j75+o9G+F3S0aUaei4WSnhsTUcVuVKlJw/wy7jlhPV7
etfT7r+SR5I6M4j5HjsNU+pXpS7ppnevn4+LPipjpTD/ACPEVaf1Kk49zaESzVE30zWviYVPr4bC
y7fEU0/WmTFrPn5T8hmkvpdF4OX1auJp93ip/wCcepeJ8/0G9DfSaOx8OCoT7qmp/nFJxfkE9A1f
SFOP14Vofx0pw94yOnz+P5Cnp2NOYt/hBV9K4qX16rn/AB+V7zOPDp1OaM6RfSYHR096o1Yfw16k
v8whlxPhfzo3ov6TRGNj9WthZrurRf8AiQvKz2b8Z+ozwfLW0hGP16OJh/FQqR94yTp8/j+QpBpz
F28JKvpfFS+tU1/40pe8zjw6dXmjXSDy9F6NlwWJh3Vdb/OJyuXE+f5jOj3l6L0nHhDDz7qyj/mF
5hjxfl+ah+DOfi9M4K+x14R/i8n3jLg6XtT4rVFq0/Fyae5tGnJV58I3l4qhU/vMFg5f8oIL3Gcf
7Lr1OflPySNVPL6Ow+zpCf8ANRh/wR6/I/m/P9BrwdrWqY2P1tH4v1U3L3DL9Tp+vwpVDwlXxFSE
vqyT7mbcoq6eFCl4nTeOX/dRUfe7+8zjw6dX2r8Uhx0n8rQ2iXwWLj3VVL/MSc1cvZnz/NY10N+k
0dpeHHDUpfw16bF9DDi/D9VqD6CVPE6WwMuGKoP/AJSRLlwx0+Z8YtMulVPxOkMVHhiKq7pssTPm
/EiBKyrVgBLQBoAwAwAwAwAwAwAwAwCVgGWAGAGAGAGWCjaRAKsAbCDCgwAwAwAUiKFBBsoFEAtB
QRAC0ALID//U9nHrfFflY1YKMsUGrAGrAGggwgMAMAMAMAMAMAbasA21YIm2rBTbLANtANsAm2AN
sAMAMAMsAaIgwAwAwAwA1YoMsFGrAGgDVgDCINAGAGAGAGpFAMIMAMAMAMAMAMAMAMCDVgDLAGao
BrVAMsAasAYFGgDADADADADADADADADADADADAgywBgBoAwIMCjVgDLAGrAGWCjQBgBgBgBgBlgg
0AYEGAGAGAGAGrBRqwBoKMsEGgDAgwAwKNlBsKMAMsEG7EBsAwIMAMAMKDADCgwAwA2QGWCjADYU
YAYAYAYAYVBhQYAYAYAYQCQgwA2RRsKMAMAMKgwAWEGBRsgMAMAMAMAMNAwA2RRgUKREGwgwAw0D
ZGhgBtBAoA2gDAoXFgC0ALAFIAWFCkyAUALAFJgCgBaChSAFIAWALTANgCyAImFBEwBaYARMKCJg
C07ABEyAImFC0wAkWALTACJhQRAC0wBaZALTCgiAFpgC0wBadgoIgBaYAtMAWmFC7gGAG7kAq4Bs
AwAUmAKIDCg2nYAUQGwDCqFpgGyIMCjAgwAwAwAwA02AJbANAGAGAGAGgg0AabCjQBgBoqDADCA0
QGXKBLYBooNAGAGAGEBoIMAMAMANhRsoFJ3IDYBtMAWmRRsoNgCkyAUUG07AC0yKFpgC0wAiYULT
ACIAIiAWmFBEwAkQAiYULQAtABE7gBEwoImALTACBQtEARAC0FBEAKANlApEUKCDZVCiAUFG0ECi
KNgGgBLVig0EGmgBOwA0AJaAEgGigS0QGigQ0EA2gAbQANoAG0EA2gAbVwgG0UA2gAbVggG0AIaA
BNBANooBSQQCaABNAA2ioBNAA2ggE0ADaKAbQQDaABtACGggG0UAmgAbQQCaABtAA2ggG0QCGigG
0EA2gAbVwAbQANoqAbVgBDQQIaAEMAQ0UCGiASwBDRQIaCBAAhoAQ0BYSwKQwBDQAloIBtFAhoAG
0ADaAENAbDauECGgAbQANoAG0UCGgBNgjUIasBWiAS1YoEgCWgBIGo00ECGgoS0ECWgBLVwNQgCt
NACADABUQBaChYQLQUEiAHiFBokAeIAaIUHiQDiLCpTiLAycRYUOIsihxFgDiLChxFkEpxFhUOIs
AcRYUOYsgHEQocRYGacRYVB4sgDxCg8WAHiFB4kAeLCsjxYEHiwoPFkAeIUHiwA8WAHiFZHiyAOg
oIgAqACIigiACoAIgoKgBZALRQbIo2ggWAYFC0EGwo2AaAMCDRUCCKNFQaYANgA2ADYANgA2EAZA
AZIABJFQAkgAEkEAJIABJFQAkgAEggBJFACSCBvJADeSKgbyQQN5IqBvJADeSCBtJFQAkgBtNFQN
5IIAyQACSAAyQQBaABtFAJoAGwgGwDRQYQGmECQo0UGEBoIEsKNFBhAaCBLCj1V0N/qbopWrbHOn
Xkut3hH2I4Zea9+HjD8R5TO75400Aelv6PmCtHF13vdOC7NZv2o49R7vo05HnzT2N+csXXr/AN5V
qT/ik2dpHjyu6IkMjrHgVwPyvTFOX91CpP1an+Y558PR0JvIJ8NGO+WaYqx3UoU4L+HWfrkxhwde
7yHKTo84ldBYD50xdCh/eVYQ/ikkStYzd0PQv9IPHasMJh1vc5tdVkvbI5dN7PpN4g8zWOzwjLBR
6u0x/wAi90RhT2SqUqatzqyUpeps4TzXvy+zgPKR3eAYAepvATho6PwGKxk8lKdm/s043/zM49R7
/o81LR5hxeJljKk6svOnJyfW3dnZ4bdhuEHX/Aho75ZpZVLZUac59r8hf4jnnfD0dCboj/DDpD5f
pislmqShTXZFN+tsuHCda7yHMLG3ASWh9HvSuJo4dbatSEP4ml7xbpcZu6Hovw/49UaOFwsck5Sm
1w1Uox/xPuOPTe36ReIPMdjs8I1YA9X4Ff7L9EZSeUqlGT7a8rR/lku44c1759nD5fmPKFju8AwA
9If0fdGXlisU1sUKcX13lL2ROPUe36NOaOHdKtJ/POPxGIvdVKs3H7t/J9VjpJp5c7u2ivlYF38G
+i/nfS2Fp2ulUU31U/Lz67W7TOV8OvSx3YOheH3SfyjG0cOnlSpOT+9N/CMe8z03X6Rd3Q4LY6PI
MKD1j03/AORT6MUsLsnONKm/vPy599pLtOGPmvodT7OGvgPJx3fPGAHqTwC6PWCwmJxs8lKSjf7N
NXb/AJvUcOo9/wBHmpaPOeOx0tL1a9WXnVJyq9rbb9Tb7EduHit2GH7ynzi/U/cmu+XeQdJ8Feif
nnSuGbV1S1py/wCQavF97il1Gc7qO3Rm7BN+HfSXyvSUKKfk0aSX4pPWfqcTOE8N/SLujj2Im4VP
GLa7ST5vN9zuuw6PNRt/QVk4q6Uk4rk80u4A9V+ECceh3R+jgr5y8VSlzS8qo+2zT+8cMfNe/qfY
x0PJ9GHiKurLLNxl1PJnd4ICaNWrWjB5azcHy104vuuCD0z4BdGLAYPE42eWvPVT+zTV2++T7jj1
K930ealo87R0hLS2OlVn52IqT1uXjbp92sdeHj3u/H9Qx0R/xRCL2Teo+qa1X6my1nHkXTwT6Jlp
LTFBbqblUn1RT9rsu0zlfDr0ZvIXfw0dIFLTGHpXvDCqEpL7UmpS/lUTOE8OvXy+1PuHDfK0TiPt
0qnrg/yOnLy8UZpSgsHiKtOOyFSSXUm7CF8Uj1v4QsQuivR10Y+TKvaFudWTqVF3ayOGPmvodS9u
PxV5P08tatr/AF6dKbfFypxcv5rnaPBkrNM/SKhU3zoQ/kbpeyBYZfp/QPS/gJwEKmHljZZOnB4d
PglOVWX+OPccc3t+jz1+X6pXCOlmmH0kVTFccXVa5RqRhqLsVOx1k08ud7vP31UDhF4zA4iO+NSj
PsSqRfrmgxOPwFm8GOilpzHPCSzjVjHW+7CrTqS74wa7SZXTp0p3XX75Ha/C9pvx2kMLo+L20qzk
udanKlHtWf8AEc8I9PWy8yfH+PhI8u6JxXyHEUqv1KkJfwyTO1eGeKrNM4T5Dia1L6lScf4ZNCF8
UexJ42PRHo1PFx8mrXoxqc/G1oRin1rJ9hw5r6O+3Hfvn5o8l6b8vD4KX/GJxfXGtVfsaO8fPy4n
w/Wqxrxui/8Ad4n/AJWU/wDoWPU9Pn+/yHYf6O+j5VsZiK9vo6dNL8Unl6lI59R6fo08pUN0m07/
ALQ9Jp2d4LXw0OrUlTffJyfaWTUYzy7sv4DiMJum1JbU7rsOjzKsPTamqek8XbY8RVa6nJtepknD
efN+IJ0o8uGDn9bCQ/lnUh/lEM/T4DVRa+iIfYxc/wCenD/gD1PT5/oM6M+XQ0hD62Ev2xr0ZexM
Uw9fh+sCegc1DSuDvseIpRfVKST9oy4OnzPjBUqtN0pOL2p2NOYt3Tzysc5fXo4af8VCnL3mcXTq
c/KflBml1r6KwMuFXFR7vFS/zCcmXE+f6DWgPK0dpGPCnQl3Vox/zCrjxfl+Y34Oc9LYVfWqav8A
EnH3jLg6fMFIaNOQuvhEz0jKX1qOGl/FQpv3mcXXqc/h+UG9K/SaFwL+riMXH1UJe9j1S+zPjf0G
uiX0mE0nDjhIy/hxFFi+i4cX4frBGdBanidLYGXDFUP+VkS5cM9PmfGNVCaapeJxNaPCpNd0mWM5
cqtPT/yngZcdH4f1Jx9xnH9XTqenwiRqn5XR6r9nSFL+ajU+A9fkfzfn+lGvBn5WOnD6+Fxcf/Te
p8BkdLn5X8iudm3JXQ/CxnpvFvjKMv4oRfvMYcOvV9qpG9O+XoHRr+rWxi73RYnP4GXsz439BnQH
yqGlY8dHzf8ADVpMZenxOn6/D9Y1VT6Lz8Xj8LLhXpPumjVc8eZ8Vp/09h4vS+PXDF1/+VkiY8Nd
Tm/GkVM05qwAwA00AJaCjQQYAYAYAYAYAYBGAZYAYFGyA3YA3YA2EGFBgBgBgBgBsihYQYUCkRQo
IFoKFoAIgBZAf//V9nHrfFflXtgDbAG2ANsAm2rFU21YASRBgBgBgBgBgBgBgBgBoiDQBlig1YKN
AGAGAGAGAGAGrEBgQYAYAYAYAYAasVRqwBqwBqxAYAaCDGACKgwAwAwAwAwAwAwAwAwAwAwAwAwA
wAwINWAMsAasAasAZYKMANAGAGAGAGAGAGAGAGAGAGAGWCDLAGAGgDAgwKNWAMsAasAYFGgDADAD
Ag1YAwAwIMAMAMANWCjVgDVgDADZVG7BBliA2AYEGAGAGAGFBgBhQYAbIoywBsAwKMAMAMAMAMAM
KgwAwoMAMAMAMAN2IDTQBogNhRgBgBhQYVApEQbANkUYAYAYAYAYUGFBgBsijaAFEQYAYUGAGw0M
ANoIFAG0AYFG1kAEQAtACkFC0EG0RQQoNpkAsoFJkApBQtBApBQtACkwBYApMAWmFBEyAWgAiYAt
MKCJgBEwBaZFBEwBaYARO4ARO4AtMKCJgC0ALTuRQtMAWmAETAFpgC0woWnYAWmALTAFphQq4BsA
wgFJgCgDCg2mQCyAwoNgCrgGyAwA2nYqhd7kBgQYAYAYAJbAEgGAGAGAGAGgg0AauFGgDADRUGAG
iAwgNNlAkoNAGAGAGEBgBoIMANXANFUYAbuRAoKNlApMgNgG7gC0yKNlBsAUmQCig2nYKFpkARAC
0wAiYUEiwAiYAtEUETACIAWmFBEwBaYARMKCJ2ACIAWgAiIoIigWiAIiqCIgFgGwDaChQQKKoUiA
2AbAFkUbKDADRAJaKDQQaChLVgg0AaaAEAGigS0QGigG0ADaCAbQANoIBtAA2gAbRUA2gAbQANoI
ENAAmgAbQQCaKATQQDaABNAAmioBtAAmggHJAA2ioBtAA2rgCGggG0ACaABtFQCaIAbQANooBtBA
hogBtFAOSCAbQANoAG0EA2igQ0ADaCBDQAloAQ0AIaKBDRAIaKBDQQJaAEMAQ0Bohq4AlgCGgBDQ
QDaKAbQAhoAG1YCwhqwGg2ggQ0ADaABtAA2igQ0AaCNENWArRAJaKBIAloASBppoIEMKNMIEMAS0
BsgA00AIAFRAFoAWALQUEiAGiFB4kAWIAeIUGiQB4hUpzFgZOIhQ4iQDiLChxEAcQCpTiLIIcQCh
xEKHESAcxChxECU4iFZHiQB4hQeIAeIUHiQB4gZo8QqDxADxIoPEAPEKDxADxIrI8QA8QoKgAiAC
oigkQAiACoAIgoKiAUgBQBsKFoIMChUQgUFGwDADQBorISyKEgGFQDYANgA2ADYANhAKSAAyAASR
UAJIABIIASQACSKgBJAAJIIAyRQN5IIATQA3mioG8kEDeSAG0kVA3kggbyRQN5IIG8kVA3kgAEkE
AZIADJAAJIIBMoBtAA2EA5IAQUGEBgBpoIEhRooMIDQQJYUaKDCA0EHqnpd/UfRSlR2SnToR7ZNT
l7GcMfNfQz+zh+A8qHoeAJIg9WeDL+o+jmIxWxvx9RP7sdVeuJwy819DpeMd/EeUT0PANBB6K/o+
YDWrYrEfVhCCf3m2/wDCjj1Ht+jTmjjPTHHfOekcVW2qVadupSaXqSOknh5s7u34it2KwOk+CPR/
y/TOH4U9ab/DF29djGfDt0ZvITvhzx/yrSqprZSpQjbm7z9kkTpzw39Iu6ONWOjzB3gcI8dVhSj5
05RiuuTshsnkemvDzio4LBYXCRyUpuSXKnHVX+I4dN7vpF1JB5cO7wDAD1bhP+Ra6IuTylUoyfX4
+Vl/LJdxw5r6E+zh8vzHlI7vnjAD014ANHqnSxWKlsco00+GqnKXticepXu+jTmjzxpvSD0tiq2I
f9rUnP8Aik2dZ4ePK7uxGFZHTvBBoz5x0xRbV40lKo+xWX8zRjO+HfoTeQkvDdpL5bpV008qNOEO
13m/8S7iYcNfSLu/AcfOjzBxhcNLGVIUoedOSiutuyIsmx6e8N+JjonRuGwUMlKaSX2aUbe1xOOH
mvd9IupIPLJ3eAYAeruhX/IqdGKuKeU5xq1F96XkQ77R7zhl5r6HT+zhv4jyid3zxgB33wBaK8di
6+Jayp01Bdc3f2RfecupXs+jTzscz8IOlPnjSmKq3uvGOMeqHkL1K5vHxHDqZbtFNsachZeh2ifn
vSGGw9rqdWOt91Zy9SZm+HTCd1kHZv6QGlNerhsIn5sZVJL7z1Y/4Zd5z6cen6TlxB50sdXiGWAP
WGOX+x/RNQ2Tq0lHneu7yXWoyfccea+hfsYfv1HlypPUqKptUrSfO/nLqvddR2eEapUvF1JU3ne8
et7vWkNoPRP9H7RepHFYuWzyacX1eVL2xOXUr2/RpzRw7pNpV9IMTiMRt1q0px+7J2XclFHSeHlz
vdbfvEFNa9OL+q3F9TzX+YrAuvQDRHz9pPBwavFTvPqpeXnytqxM5XUdenj3WC/+H7S3j8XQwqeV
Km5v703b2RXeZ6cdfpN86HCsV5UlL6yT63sfrv8A6HR5aMxfnuW92l2ySfvBR6y6U1/9kOjWpDyK
laKilsalWbnNdicl2HCea+hn9nD9+o8o6S+jrzlHJOWvG3CXlR9TR3j59GaVWpiJuOSctaPVLyo+
poQo9M+BbQ6p1sbj5JKMpKMHwjL6V+pwOOde7oY839+8ee+meOelNIV67d1Vlrx+7JKUV2RaXYdZ
Hjzu6IzTa1q8p75qFR9c4qb9bETIXHoxoX/aHTGEpNXhNUpz5qEE5363GS6yW6jphj3ZT5DoP9IT
S7qYjD4RbIQdR83N6q7lF95jpx2+k5eZFjh+kvLo4aX/ABpxb5qpP3OJ1eW+isxi8bhKEntU6tPs
WpP2zZC8fiPT8/8AkQ+idtlWrS7dev74xf8AKcua93sYfv1R5fwn0mCxEd6nRn2LXj7Zo7PDOPwV
vQ3l08VDfKhl+GpTk/UmKY+vw/Udt/o96E8diMRjZLKnBU4/em7vuSX8Ry6ler6Nj52lc+070gWm
OkPyu94LFU1H7lOSiu9K/abk1HHLLeW/vVzjEUXhpyg9sZNPsdjTjRdq+h30h038nj/yUV1J8o1G
pt9ibZN6jrce7L40dl/pCaXWGo4XR9PJNupKK3RitWC6s5dxz6cen6TlrUSPP2N8vR2GlwrYiHYl
Sl/mZ0eS8T5/orMF5ejcTHhWw8u6NaP+ZFScX4z9R6h8G2EfQ7o3VxtvpZ06uIz5Raguq0U/xHHL
zXu6U7Md/Go8udEa2rpPCTln+00nLneaudrw8WHM+Kq5WpujJxe1NruK5iydNVrY6pL68aU/46cZ
e8mLefP79w1p3y8HgJcKNSPdXqS/zCGXE+H60bw3l6Ir/ZxeH/mp1/8Agj1Jx85+ozoitaWKj9bC
V/5Y63+UUw9fhRF9GKviMfhp/Vr0n3TRamPM+Ia6bpeJxVaH1as13SYiZcib6a51cPL62Dwv8tKM
fcTFrP8ASfkN4ry9C0Ps4zEL+KnQfuHqt9n538oM6LLXw2koccGn/DiKLFTDi/D9YG/QGfi9L4F/
91VFd84ouXB0+Z8YKzi6fiqk48JNdzKxRbOny1sRRl9bB4N/8oIL3Gcf7Lp1OflPyG8R5WgqP2cd
X9dKj8B6/I/m/O/lBnQpXhpBccBU9VSnL3DL9TD1+H9gV/otPxePwsuFek+6aLWMeZ8VJ6V0/FaQ
xUeGIqrumxFz5vxrSc6dZ09GvjgKfqq1V7iY/q1n6fD9akZo/wAvQGLX1cXhX3wrIepPZvxn6hPg
t/5itNcaWJXfh6iGXCdLn8fypXPGjTkroXhWz0vWfGFB99CmzOHDt1efw/JIzSXldHsG+GMxK74U
WJyX2Z8b+gV4O846SXHRtf1Sg/cMv1On6/CqpGhXqYqg+FWH+JGq5zlpYfCRHV01j/8Am6reubJj
w11PavxqRSjTm0wAwAwAwA1YAS0FGggwAwAwAwAwKw2QG7AG7BBsoMAMAMAMAMAMANhQoiDZQYAK
RFCggWgoIgAiAFAH/9b2gex8Z+VTRAaCDADADADADLBQnVANWsEGgDADADADADADADADViAwINAG
AGrFBlgo0AYAYAYAZYgNAGBBgBgBgBgBgBoAywUasAasACaCDVioMsAYAaAMAMAMAMAMAMAMAMAM
AMAMAMAMAMAMAMCDADVgDLAGrAGWANWAMsFGgDADADADADADADADADADLBBgBoAwIMAMCjVgDVgD
QUYAYAYAZYINAGBBgBgBgUasAbCDADADADADADADCg2AYFGAGwDAowAwAwAwAwAwAwqDADCgwAwg
N2AN2AMsEGwDADLXAEEaGAGAGAGFQKSANhBhFGwDADADADADCgwoNkUbAFEBgQYAYUGwowKMAFII
NkBtFBgUYAKiwAiAFgCkALChSZAKKBaIDaAFgCkFC0AKQAsAUmAKAFogFphQRMAWmAETAFphQRMA
ImQC0woImALTsAETACJhQRMAWmALTsALTIoWncAWmALTAFp3ChaYAtOwAsAImAKTChVwg2FGAG0y
AVcA2AbuAKTANkBhQbTAFEBsAwKFKQAoINN2AEN3AMAMAMAMAMANBBoA02FGgDADRUGAGiAwgEtl
AkoMAMAMAMIDQQYAauFGigwAwA1cIMuFCkyA3cA2AbTsALANgCkwoUAbAFJkAoAUmVQtMgCJgBEw
BaYUETACJgBEyKFxYARMAImFBEALQARO4ARMKFpgBEyAImVQREAtABEFBEwBQBtFUKIgUgoUgDZA
bNAWjKjZQbCjQQaIDTRQJCDAoQ0AaCDTQAgAwoENEBpq5QCaABtBANoAG0EA2gAbQANoqAbQANq4
ANq4QIaABNAA2ggE0UAmggE0ADaKgE0ACaABtBANoAE0UCGggQ0ADaCAbQAJoAFJBAJoAQ0ADaCB
DQANoAG0UAmggQ0ADaABtFQDaAENXCAbQAloAQ0AIaAENFAlogENFQIaAENXAEAWENWApLQAloAQ
0ADaCAbRQIaABtAA2gNkNAA2rBAhoAG0ADaAENFAhoCxoI0S0AJIBLRQJANNAWEAVpoIENBQloIE
tAWEtXA0QAaaAMQApABEFC0AKiAGiAHiRQWIAeIUHiAGiQDiIVg4iwocRIBxFhQ4iwBzEKU4iyDI
8QocxAHEWFDiLIBxFhUo8WBk4iRQeIUHiAHiFB4kAeLAlHiFZHiAHiyKDxYAeIUHiwA8WFZo8WQB
osKDoAIgAiACxIoJEALEAJEKCIAWiAWAYFC0EGwo2ggWAYFGwDQBjCBLAEsA0VAlgA2ACYANgA5B
AOQAGSAASCAEigBJBACSAASRUAJIABIIASAAyRUAJIAbyQQN5IoG0kEDeSKgbyQA3kioG0kEAJIq
BvJADeSCAMkABkigDJEQBaABsoBsAGwgQ0AJKDCAwgNNFQJCjRQYQGggSFGigdYHCPHVYUo7ZzjF
dcnYlWTY9KeHvFLD4XC4aOSlOUrcoR1V/jOHTe36RdSQeXj0PCMAPVXSD/kX+iVOlslUpUl21JKc
l3OR555r35fZw/AeUmju8A0UHq3wRR+YdBYjGS3urUT5U42XrTPPn5r39H7ONvxHlR+Vmzu+eNWA
PQP9H/R3jMVicR9SnGC/HK/+Q5dSvZ9Gnm0cr6d6Q+dNKYqrtTqySfKL1V6kjePDz9S7t+IqZpzF
/wDBdo75z0xho7oT8Y/wJyXrSMZcO3Rm8oLf4d9I/KdI06K2UqSv96Tbfq1TPT4dPpF3fkOInV5Q
XD0JYmcacc5SaS627IhPI9R+GyvHRGi8NgoZJzil92lG3tcTjh5r3/SPEkHlc7vAMAPV3Rz/AJFb
opUrPKdSnUn+Ko9SD7tU4XzX0MPs4Dyid3zxuwB6P/o/aMvLFYprYoU4vrvKXsicepXu+jTmjh3S
jSfzzjsRiL3VSrNr7t/J9VjpJp5c7u7ECVgdC8Fmi/nXS+HTXk05Oo/wK6/msZyvh26WO8oLV4dd
KfK9IwoJ5UaST+9Pyn6tUzhG/pF3RxOx0eYLpUnWkoxV22klzYND1R4Xai6PaEw+Ag/OdOn1xpxu
33qJxw817+t9nHQ8pnd88YAervBjFdFuj9bHS86Xjaqvv1VqxXa1l1nDLzX0Ol9nHY8pSk5u7zbO
7540Adw8BGiflekKmIayoU3b703ZepSOXUr1fR8d3fuFO8KGlvnfS+IkneMJeLj+Bar9ab7TWM1H
PrXeVFANuImejuinpvGUMMv7WpGL5JvN9iuyW6axnddDvvh+0oqcMNgo5K7qSXBJasfbLuOXTj2f
SbxB5y/eU+cX6pe5Nd7OrxDdaTahNbbJX4OOXss+tgHq/R8odDujDqtarqwc7LLOu7RtzUWu44c1
9CfYw/fqPKVGm4TlTe13j27vWkd3zwih5cZx5XXXH8tb/WwB6B8AGivGVMRipLKCjCD5yzlbsUb9
Zy6j2fRpzRybpzpf/aDG4jEJ3j45qPONtWPqh6zePh5+pl3W37xU6nlU4vem49m1e1/pGnMWjoho
b/aHHYSha8ZTtNfZg9eX8rJbpvDHusg67/SB0s5Tw2EXmxUqkut+THtST/iOfTj0/ScuIOA4/wAt
Up75U1f8LcF6oo6PJRrSK11SnvlTj/K3D2RQhR6rxFd9D+ius/Jq1KEY89aqlFdqj/hOPNe/2MPk
PKukvLVGe+VJX/C5QXqijvHgo3pHyoUJb3Ss392c4r1JAo9E+AzRCxDeNf8AZUfEr70qkpy7lq95
xzez6PPX7tfxHIfCJpj/AGkxMsWndOrVpQ+5TcXF90jpj4efq5d138RVKvl4On9mtUT/ABRp29kj
Tn6fNYsnQ3Qv+0sqWFtdfKqd/uyjNz/lpmbdN4Y93j7/AN/krtnh50lGtRhg4+dT1a8lybdOPtfq
OeEer6RfT5/okecdELXpYqO90Mvw1acn6kzrXix9fh+sVnR5XrSj9ahiF2+Jm160hTH9L+Q9Z9A8
PHoZoGjOplOvKEnx1q8owh3RcW+pnHLzX0OnOzH4/qy8YQm6Mk1tTv3Hd81pMdKaSp4/EpbFXq26
td2JGs+b8R3/AME2gfl2lZY2S8mjhMMov7dSjBN9ymn1o55Xw9fRx3d/dPySufeGXSsdO46FeHmq
M6S5+KqzV+3aawmnLr3uv795FEmvGaMj9jEy/nhH/gG/Vx9PmqS6HaLnpyOIwlPzqio25Xr04X7N
fMl8NYTu8fD8x6d8JWkoaHo4fRdHJVKGIVuEIYapGK72mvunHHz5e7q3Xj7r+SPHWh6viMTRn9Wp
B90kz0V83HxVK0/R8Ri68Pq1ai7pNCLlyJLpf5WIpy+thcI+7D00/WiRc+flPyG9KLX0dg3wniI9
zg/8wheJ8xrRq1tGYxcKuGl3eNX+YXknF+X6jOhXlYmpH62Fxi/9N6j9wyMOflfyor2jZ+Kr0pcJ
xfc0VmCS6XU/FaRxceGIrLunIThc+b8aH3S9aywb44Ol6nKPuJGs/T4DUlfQq5YyXrpL4D1+Sfzf
n+gzofnDHLjgqnqnTfuGX6rh6/ARvRCWppLBvhiaL/niKzhzPjBG6ajqYqsuFWa/mZqJlyLH04zn
hHxwOG9ULe4zP1b6np8IMmr6Cjyx0vXRj8B6/I/m/P8AQZ0GzeNXHA4j1JP3DL9TD1+FFX0E9TF0
Hwq0/wDEi1jHkP8ApvDU0pjVwxVf/lZIThc+b8a1Er00WthtFv8A7ord1esTH1+LWfE+H60hOh/K
0HpBcMRg33qshefxMfZvxn6hPgt/5jFDqreulMZcHS5/H8iueG3FXQvCor6Um+NHCv8A9N6RjHh2
6vPyn5RIzF+V0cw/LH11/wAoqQ9fkX2fnfygzwc7dIL/AJ5uK9kWMv1On6/CijaNdq9N/bj7Uarl
G1r8KEdXTeO/5uKntM48OnV9q/FIoZtyaYAYAYAYAYAYAasAJaCjQQYAYAKSuFZpQRGAGAGAGAGA
GAGAGAGwoUkQGyoMANhQpEQKRVC0QBEAEQApIA//1/aB7Hxn5VMANEBgBoIMAMAMAMAMANWANaoA
mwBgBgBgBgBgBgBgBogMAMCDQBgBlig1YKNAGAGAGEBqwBgQYAYAYAYAYAYAYADkVAkAwAywBqwB
lgDVgDLAGWANWAMANAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGBBgBgBqwBqwBlgDVgDAo0AYAYAYAY
AYAYAYAZYIMANAGBBgBgUasAasAaCjADAg0AYAYEGAGAGAGAGAGAGFUbsAYAbCjADADADADADADA
DADADCoN2AMsAbsAbCDADADADADLEUbAMAEyQUJAMAMANpFQKCDADZFGAGAGAGAGFBhQbIDYaGyI
NhBgBgBhQbQUYFGACkRBsA2UGBRgBgAVMAWAKQULQQKRFCygVEgFFApMgFBQtBApBQtAG0AEANoA
WgoIiAIgBaACIKFoAIgBaIAiChaACRYAtMAImFC0ALTAFp2AFkULTAFpgC0wAiChaYAtMAWALTAF
BRtMIN3CjYBu5AbTAFAGAG0wBVyA2AbKDaYAogMAMuAYAYAYAYAYAaAMCDVwBNwowAwA0VBgBhAa
AENhRoqDADADCAy4BoINXCjRQYAYAaANEQYAYAbuAbKoUmRBsKNp2AFp3ANgCkwo2QCigUmAKIBa
YULTACJgBEwoInYAImALTIoImAETuAETAFphQRMAInYAInYKCIAWiAIgoIgBaACJhQRACwDZVCyI
NoKFIAUQGzQFIyBRVCkAY0AJAMIBLRQJAMAEtACSoNNXIBABhQIaAEtAAmgBDQQDaABNBANoAG0A
DaKgG0AIaABtBAJoAG0EAmigFJBANoAE0ACaKgG0ACaCAbQANooBtBANqwAhoAG0EAmgAbQAJoIB
NAA2gBDQQIauADaKATQANoIENAA2gAbRUCGgAbVwgQAIaAEtACGgBDRQJaAENBAhoAQ0AIA0Q1YA
S0AIaAENAA2ggG0UCGgAbVwLA2rgaIaABtBAhoAG0AIaKBAQIaCtNBFJaAEkBpooEAGmgNEtACWg
gQ0FCWggS0Bolq4FIAMAFRAFoKFoAXEAJEAPEig0QA0QoPEANEgDxCsHEQBxEKHMSKHEQBxFhQ4i
yDJxEKHEWAOIsKHEWQDiLCocRYGR4sig8WAHiwoPFgB4sKDxZBKPFhWR4sAPFhQeLIA8WFDiLADR
YEo8WRUHiwAyCgqACIAKiKCIAKgAkQoIiAWAEKDCKFIIFAGBQRBBgUbANAGBBoqBBFGioNMAHIAH
IAFIAGwAbCAUkAAkgAEkVACQAGSCBvJAAJIqAEkABkggBJFACSCAEkEDaSKBvJBA3kioG8kAN5Iq
BtJBACSAG8kVA3kggDJAAJIADJBAGSABtFAJgCGggQAJasAJKDCAwgNNACSg0UGEBoIEtBRevBng
PnHS+FjujPX/AIE5+1GcuHXpTeUF08PGO8fpClRWynRV+uUm36lEx054dfpF3fkOHnV5A6wGDePr
U6MdtScYLrk0veNtSbHpTw9YtYXCYXCRyUpuVuVOOqv8Rx6b2/SL4kHl07PANNAHq3Tn/It9EoUt
kqlKnG3OrJTku5yOE819DL7OA8pnd88YAeq/BBBaA0JiMbLe6lTrjTjZetSOGfmvodD7ONo8rTm6
jbebbu2d3zwkA774AdG+OxeIxDWVOmoLrm7+yL7zl1Hr+jTzscz8IGkfnbSuKq3uvGuKfKHkL1I3
j4jj1Lu0U8rmL34M9GfOul8NBrKM/GP/AJBpy9qS7TOV8OvSx3lBd/DzpP5Tj6WHTyo0rvlKbu/U
omenHX6Rd0cNOjyglGk68lCKvKTSS5vJBR6m8MdVaC0Ph8DB7ZQh1xpR+OqccPNe7r/ZxkHlU7PA
MAPV3RD/AJFPovUxOydSFSovvT8iHsicb5r34fZw2PKJ3eAbAPRPgA0Xr1cTimvNjGnF/eetL/DH
vOPUez6POaONdMdKfPWkMTiL3U6stX7qdo+pI6SaebO7tFaNMC+eDPRPzxpbDQavGM/GS6oLW9bS
XaYyuo69KbsF38PGlvlWOpYZPKjTu+Upu79SiZwjr9Iu7ocMOjyhUIOo0lm3kkAeq/ChJdF9AUcD
HbLxVJ23qC1pPtaV+s44+a9/V+zjoeUjs8AwA9V+CWjHozoSvpCa8/xlTrjTTSXepd5xz817+jO3
HY8sVqsq8nOTvKTbb4t5s7PABWKg7T4DdEfLtJSrteTQptp/an5K9Tl3HPO+Hq+j47u/cK94WNLf
O+l69neNK1KP4PO/m1i4TUY613kKBhfKbj9ZNdu1etI04wSmgdGS05Wp4WPnTqQS5KTUZP1p9SFu
msZ3eB6C8PGkFg8LhsDTyi5azS3RgtWK6nd2+6cem9f0i6kg82V5uMo1FtaUu1ZN96bOzxBaUaNa
2yDf8svyYB6m6M0n0M6MzrPya1SE5rjr1PJp+rUOF819DD7GA8p4fylOPGN11p39l/ZvO758GU1r
U5rhqy7nb/N6gDvHgD0T8oxFfEyWVKKjB/aqedbsil28zlnXr+jzd2OfeETTH+0GMxFZO8YV3CPO
Oqopr/k232m8Zpx6uXdb8f3+Qpc/Lw8fs1JJ8lJRt7JGnL0Fh6N6HfSKthMNt168oS5Q8mT9Wu+8
lum8ce7U+8dp/pA6SdOnhcJHzW5VJLqSjH2yOWEer6TeIPO9da+GpPep1I9loNets6vH6DVZa2Fp
vhUqLsag17/WU9B6i0T/AMiH0VdXzatWm5rjr1sodqi436mcb5r3T7GH79R5fX0uDf8Axusv+UkX
/wDOzs8Pp8/3+Qyj5WDqrhVpPs1aifuIen4fqO5/0fdGOrVxGIkvJgoKL+21LZ1RbX4jnnXr+jTm
rVC6Yac/2i0hpGonePi9Snw1adSnmutRcu03Jpxzy7rf36xVK6P51Zx3OhX9VKcl60jVcsf0v5B9
0Iwb0jpLD0Ur689V/daak+xXZMmunN2D0B4btPLRrwWCp5KNSNaSW5QerDs87uOWEevr5a1EjzHp
mh8lxNaH1ak13SaO0eLKeVPulGeLqS+soT/jhGXvJFz5Hqzo9i10O6NfLWrVJUFNc5OKhS7PN72c
b5r343sx39yPKekG6mBw0nm1Urx7vFy/zHZ4LxPmrWH8rRtf7OJw/wDNCvf/AAoep6fOfqOuf0e9
HSrY+vXt5EKOq/vSnFx/wNmOpXo+jTz8kph0t098/wDSV2d4UnKhHsjKMu+Tl2Fk1Gc8u7L+A4dT
n4uSlwaZ0eZVg6Zw8XpPGLhia3+ORMeGs+b8aF9KleWGlxwtH1R1fcIufp8INY3ytFYV8MTil/Jh
372PVLxPjf0G9D+VgMcuVF91S3vFMeL8hroQv25LjSxC76FRDJenz+P5CqUpakk+DRpzFm6eQ1NL
Y7/m6r/8rJGceG+pzfjQvpXnSwD44OPqq1V7hFz9Ph+tG456FlyxkfXSl8B6n835/oNdDVf5Yv8A
uir+qzF/Uw9fhRDdGXbHYZ/8fpf40Ws48z4hHSSNsbif99U/xMRMub8RNdNs/kX/ADY0P8xMf1bz
9PhApZ6Cf/N8v+VLHr8j+b8/0GuguU8Z/wA2OJ/wC/qdP1+FFU0V/wAUUv8AeQ/xI1XOciX6eK2l
sd/zd1/+VkiY8N9Tm/GrD/ph/wAR6L/5tJf9BFYk9Vz4nw/Wq1oX/mCaRX/HsH/zmF5/Ex9m/Gfq
NeC3LTGG66n/ACrmMuDpcwrnZtyV0HwoO+kn/wA2+E/6B6ZjHh16vPyn5RI3il/yLlD/AJ+Ff/lT
SHr8j+b87+UCvBv52kP+fbiv8KGX6nT9fhSqFo/99T+/H2o25Rtb/Cj/AMxvHf8ANxP2mMeHTq+1
fikUE25tNBBgBgBgBgBgBgBgBqwBpoKEhBuIEpYGWAGAGAGAGAGAGwowgFJBBsAwoNgGyKFBBtFU
LRAEQARABEQH/9D2ket8V+VTLAGrFUaANEBgBoIMAMAMAMAMAMIDVgDVig1YA0AYAYAYAYAYAYAa
IDADQQYAYAZYoNWCjLAGgDADCA1YAwIMAMAMAMAESKgQAYAYAYAYAYAYAYAYAYAasAZYAywBqwBq
wBlgDQBgBgBgBgBgBgBgBgBgBgBgBgBgBgQYAYAasAZYA1YA1YAwKNAGAGAGAGAGAGAGWCDQBgQY
AYFGrAGrAGgowAwINAGBBgBgBgUbKDYUYAYAYAYAYAYAYAYEGWAN2AN2AMsVBsAwAwAwAwAyxFGw
DADADADADADCgG8iKMANpFQKCDADZFGAGAGAGAGAGFBsAwKFEBsIMAMAMAMKDYUYFGwBREGFBsKM
AMAMAFxYAVAGwoIgg2RQsoFIgFlBtMgFAC0FCkAKQAsAUmAKAFogFphQRAC0AEQAtBQRAC0wAiZF
C0wBYARO4ARMKFpgC0ALTuALTIoWnYAWALTAFpgCwoIswBaYApMAXcA2FG7kAoINlUYAKuQGwDYB
sAUmAbIDCg2mAKIDYBgBgBgBgBoAwIEthRoAwAwA0VBgBhAaChABoqDADADCA0EGrgGiqMAMANAG
BBogMAMANXAMuAbANlUKTIBQBvYUCk7kAoA2mFCiIFFUbTAFpgBEyKCJgC0wAiYUETACJgC0yKCJ
gBEwAiYUETACJgBEwoJFgC0AETIoImUBEQBEALQUETAFFAtEUbQApACiA2UCkAKIo2igWQCWig0A
aAEtACQDAgS0FCSoNNXIBABhQIaAENAA2ggG1cAG0ACaCAbQANoIBtFANoAG1YIENAAmgATQQDaK
ATQQCaABNAA2ioBtAAmggG0ADaKgG0ADaAENAA2ggE0ACaABtBAJoAQ0UCGiIBtAA2igG0EAmgBD
VwAbQQDasUCGrACGggQAIaAEtACGgBDRQIaAENBAhoAS0BqEACGrACWgBDQANoAG0EA2igQ0ADaA
2Q0ADauECGrgA2gBDQANoASVFhLQVokINNACSAS1coEgI00BohoAS0ECGgoS0EWEtAaJauAJasAK
QApBQsAXEAJEANEig0QA0QoPEANEgDxCsHEWAOIsKHEWQDiDChxFhQ4iQZOIsKHMWAHiFDiJAOIs
KHEWBgeLCg8SAcRYUGiwA8QocRZBKPFgZGiwocRYAeLIoPFgB4sKDRYEo8WRUHiwA0QoMgAiACIi
gqACIAIgAqIoIgBaKDZAbQAsAwKFoINhRsAwA0AaKyEsihIQYUA2ADYANgA2ADYQCkgAEkAAkggB
JFAGSCBvJAAZIqAEgAEkEAZIoASQQN5oAbyRUDeSCBvJADeSKgbSQQN5IoASQQN5IqBvNAAJIIAy
QAGQAGSCATKATABsIEAGiAS1YoElBhAYAaaAEgGgDADQQdv8BGjvH4+rXeylSsuubVvUpHLqXw9f
0eboo3hK0h85aXxU90amov8AkGlD3G8Z4curd5UUY05DoHgt0d85aXw0bZQk6j5aicl60jGV8OvR
m8oLR4ddIfKdJQop5UqMU/vSbk/Vqk6c8On0i7o4mdHmD/RWBek8RSoLbVqQgvxNL3kvgk3dD0d4
fccsPh8LhI5JylO3BQWqv8T7jl03u+kXUkHmE7PAMAPV3ST/AJFfopTo7J1KdOFvtVHrzXdrHCea
+hl9nAeUTu+eN2APVfglgujug6+OkvOdWp1xpxsl3qXecM/NfQ6P2cdjytObqNtu7bu2dngCSg7/
AOALRfjsViMS1lTpqC65u/sj6zl1Hr+jzzscw6faT+d9KYqre68a4p8oeQvUjeM8OHUu7RUDTmL3
4MtFfO2lsNBq8Yz8Y+qmtZetJdpnLxHXpTdgu/h40p8qx9LDp5UaV3ylN3fqUTHTjr9IvnQ4bY6v
KDUKEsTOMIq8pNJLi3kgD1H4YasdAaHw+Ag/OcIdcKUc/XqnDDzXv697cZB5Ysd3zxgB6t6H/wDI
odGKmK2TnCpUX3peRT9kX2nC+a+hh9jDY8pHd88ZYA9DeAHROvVxGLa82MacXzk9aXdqrvOPUr2/
RpzRx/pppX580jicRe6lUlqv7MfJj6kjpjNR5s8t2isWNOYvXg20P886Vw9Nq8Yz8ZLqh5WfW0l2
mMrqO3Sm7Be/Dxpb5VjaWGTyo07v7038FHvM9OOv0jLzocKsdHkCowc2kldvJIA9V+EmS6J9H6OB
jlKap0nb7K1pvtaz+8ccfNfQ6v2cdDylY7PANWAPVXgiw8ejWhq+kKi8/Xn1wpJpLv1u845+a9/R
+zjseW8RWlipyqTd5Tbk3xbd2dngt2Bwk6bTW1ZoA7V4GNC/K9KyrW8ihTc11zyin2NvrRzzvh6e
hju/ARHhW0x89aUxEU7xoqMI9cPOXfKfcXHxGetlu37hzNrXpp/Vlbsea9j7zbgJHR+jJaar4ejD
zq0owvwd9X1KzfeTempN0eivDhpdaLw2FwVPfNTa+zTVop8m3/KcsHs+kZakg80UqXiq+pu1nDsf
k+87PDoBwucmuMZK3HK69aXaCD1X0PpvoX0anitlWpCdVfektWn6tV9rOF8178PsYbHlrDeXTqp7
lGXapKPskzs8EGqC16FWK3OE+xXj7ZoKO5+ALRSxFeviJLKkoaj+1JSTt2Xv1o5516vo89RR/CLp
v/aDF4uoneEK9OEPuxjOLa5Nq/abxmnLq5d1vxFFp+VhZ8qtO3bGd/YjTl6Cc6K6HfSGUcKv7TEU
U+UWqmu+xK/YZvhrDHu8ffB3fw8Y+MMJSwdPJxlGpKK3QtKEey9+454PX9IvjQ82YTy8NXjwdOfc
3H/OdninA3o7yqOJW5U4y7VUgvZJgnr+/UepOjFF9COjE66yrVKc6v4pq0O5ar7zhfNe/D7GGx5d
0F5VSa3OhXv2UpSXrSO1eHH9L+TTXRxXxVOP1taH8cXH3imPI7D4AdBfK8ZVxkl5NCGrH78+HVFN
P7xjqV6Po+PnaVz/AMJ2m3p7S2IqX8mEvFw6oeTl1u77TWM1HHq5d1VXulOePxL41qj75NljOfN+
ImKmh5af0lhsNDbWp4SN+CdGnrPsV2+om9NdvdZPh+UHbPD3peOj8LhtG0slLy2luhBasF1Xb/hO
eEen6RdSRI894jytG0eWIxHrhQ+B1eS8fO/orMEr6PxK4VcPLuVVf5gTi/L9R6e8HWFfQno5VxrX
0tSFSvnyjamup2T/ABHHLzXu6c7Md/NHmTohN1dJ4Zyd3KvC7e9yl+Z2vDw4cz4qqrRpzFl6a56S
xT41pvvdzOLp1Ob8RnSbOGDfHCw9U5r3FiZ+nwGYhX0TR5Yuv66dH4D1X0+d/QZoP/iLH/7qk/8A
lNT+Ipjxf36jOg6vj6a4xq/8q5jJOnz+/cKg0aYFt6f/APMWxv8AzcVf8TM48N9Tm/EZ0pj9Bo//
AJs//giuIufp8P1oyl/zBan/ADeUv+VVQevyP5vz/SjOhivLF/8ANliP8Iph6/CiC6PZY3D/AO+p
/wCJFrGPPzC+k6tj8T/v6v8AjYi5c34ia6bZrBf82NH/ADEx/VrP0+ECY5aCl/zfR/5VSHr8j+b8
/wBBvoK7Txf/ADY4r/AMv1On6/Cip6J/4ppf7yH+JGqxORMdPf8AmLY7/m7r/wDKyRMeGupzfjSH
/TCNsHov/m0l/wAr6pJ6rnxPh+tajWhP+YJpH/fYL/nMLz+Jj7N+M/Ua8FuWmMO/96/+UUxlwdLn
9+4rnTNOSuheFP8A5ikv9xhf+gekZx4derz8p+USMxWXRyhzx9d/8oqQ9fkX2fnfygzwdKz0g/8A
nnYr2RQy/U6fr8KVRtGK9el/vI+1GnOKtfhOetpvHf8ANxU/xEx4b6vtX4rFFsacmibBRoAwA0EG
AGAGAGAGAGAGACbWAhQGWAGAGAGAGwowA2QG0gg2UGAGAGwoUiINlApEUKQAVABEAEIo/9H2ket8
V+VTADADADVgo1YA0AZYA0EGAGAGAGAGAGAGEBqwBqxQasAasAYAYAYAYAYAaIDADAg0AYAYAYAZ
YoNWCjLAGgDCA1YAwIMAEyAEWKgwA0AYAYAYAYAYAYAYAYAYAYAYAYAYAZYA1YAzVANaoBqwBgBo
AwAwAwAwAwAwAwAwAwAwAwAwAwIMANAGWANWANWAMCjQBgBgBgBgBgQZYA0AYEGAGBRqwBqwBoKM
CDQBsKMANlBgBgBgBlgg3YAywBsgMCDCg2AYUGAGAGBRliA2AYAYAYAYAYAYAYUGAGFBgAmSIDSQ
AoIMANkUYAYAYAYAYAYUGFBsihSIDYQYAYAYAYAYUGw0MANoIFEBhQbCjADADADaADIAUAKQAsKF
ogNlAtO5AbKBaIDaChaCBSChaAFJgCwDaYAtABERQRAC0wAiChaYAtOwAREAtMKFpgBE7AC0AEQU
LTAFpgCwBadyKFpgC0wBaAFpgC07BQsAWncAWmAKANhRsA2RBsqjYBtMgFBBsKMAFJhAoijADdyg
UmQGwDADQBgQauFCbgGAGAGAGioMAMIBNwoSAaKgwAwAwgNBBq4UaKDADADQBoiDADADVwDRVGgD
Ag2mAKIDZVCkyAUAbKBSdyAUAbTChRAKKBSYAtMKCJkARMAWmFBEwAiYARMAWmRQSLACpgBIsKCJ
gBEwAidgoIgBaZAETKoImQBEwAiYUETAFgCkFCgg2VQogFACkAKIo2igWQGAGmigSAaANNEAkoNB
AloKElQaauQCNgBhQIaABtAA2ggG0ACaCAbQANoAG0VANoAG0AIaCATQANoIBNFAJoAG0EAmgATR
UA2gATQANoIBNACGioBtACGrgA2ggE0ACaABSQQIaABtAA2gBDQQDaABNFANoIBtACGgAbRUA2gB
DVgBDQQJaAENACGigQ0QCGigS0AIaCBDQAloDRDQAhgCGgBDQANoIBtFAhoAG0BYG1YDRDQAhoIB
tAA2gBDQAhooEkRoloqqSEGmgBIBpq4AhqwFhLQFJaAEtBAhoKEtBGoS0BSWrgGIAWgoWALQAuIA
WJFBogBohQeLADRAlGiRWTiLAHEWFDiLIBxFhQ4iwBzFkVkeLAHMWFB4sKHEWQDiLChxFgYHiwBx
FkUHiFB4gB4sAPEig8QMDxYUHiAHiRQeLADRYUHiwA8WRWR4sANFhQaIAVABERQWIARABEAEQUFQ
AtEAoA2FCkEGwo2ggWFGAGwDQBgQJYAlgGioEMAGwAbABsAGwgHIABJAAJIIASRQAkggDJAAJIqA
EkAAkggDJAAJIqAEkAN5IqBtJADeSCBvJFQN5IAbyRUDeSCAEkUDeSCBvJBAGSAAyQAGSCALQANo
oBsAGwgSAYQCGrFBooMIDADTQAkA0UGEB6h8CWHjovR2Jxk8lKbv92lG9++Ujhn5e/6PNS0eYsVi
JYupKpLzpycn1t3Z3eHew3Kg794A9G+NxWIxLX7unGC65u/+X1nHqPX9HnnY5b090j87aUxVW906
sop8oeSvUkbx8R5+pd2ioG2B0zwRaM+ctL0W1eNJSqP8Ksv5nE553w79GbyEn4b9J/LdK+KTyo04
Q7X5b/xJdhMJ4X6Rd0ceOjzCY6P6N+eMXQw/97UhF9TaTfcS3TeOO7od/wDD/pJQhhcJHZeVRrqS
jH2yOXTev6ReIPNJ1eIYUHq7pqv9lOjFLC7JzjSpv7z8ufsku04Y+a9/U+zhoeU7Hd4Blgg9WeDO
K6L9H62NeUpeNqr8K1Yrtccus4Zea+h0vs47+I8qt6zu9p3fPGgD0J4AtFeMr4jFNZQhGnHrk7vu
1V3nHqV7Po05o5L030r89aSxNdO6lUkov7MfJj6kjpjNR5+pd2iqmnMdB8FuifnfS2Hi1eNOTqS/
Arr+ay7TGV1Hbo47ygtnh00r8s0hDDp5UKauvtT8p+rVM4R0+kXd17hxM6PMHGFw0sZUjSgrynJR
iubdkFk2PT3hlxMdBaKw+ApvKTjG3GFKK9+qccPNe7r3tkg8snZ4BgB6t6Lf8ib0YnifNqVITqL7
1TyKfq1Wcb5r34fYw2PKR2eAYAeifAFojWqYjGNZRiqUX1+VLutHvOXUr2fRseaONdMNLfPukMRi
L3U6ktV/ZXkx9SR0k082d7raK2acxe/Bpof560rh4NXjCXjJdUPKz62ku0xldR26WO7Bd/Dvpj5X
jqWFTyoU7v708/8ACo95npx1+kZbuvcOGHV5AunTdVqMVdt2S4tgHqnwlzXRLQFHAQflTVOk7b1F
a032tZ/eOGPmvodX7OOh5TO754wgPV3gppx6OaFq6QqLOSnNvjGldRXfdLsOOXmvodH7OOx5orVZ
YrEynJ3dWTbf+8zf+I6vDzQxoeVGceV0uafwuVB2PwI6IWksc60l5OGTkvvVFqr1JtHPPw9P0fHd
+AhPC9pb540nNxd4UvoV1wzl65MuE8M9bLd/gOb4rNqXGMc+pWfrTNOFErozR8tJ4+lRhtq1o26p
STv3O/Ibak3fmPQ/hn0lHR2HwujqWSm80t0Ix1Ir+a65xOWD29e6kg8y6OznJbnCp6otr1pHZ4IN
4Dy/GQ+tTl/Laf8AlFIPUnQ6D6E9Gp4q1qtSE6q65eTT7Lar7WcL5r6GH2MNjy5g/Lp17/3afb4y
Cv62dngg1glrUq63KEZdqqRXskykHbPAFol4jFV8S15FKCivvyvmuqKaf3jn1K9X0fHzsU/p1pz/
AGhx+kKid4QgoQ4WhVpxuuvyn2lxmnLqZd1v79RRdG508QuNFeqpTfsRquU9fh+omOhGivn3FrB7
PHx1G+CUoyb7FFvsJbpvpzuuvePQfhg0xHDqjo6nZJ0a9SUVujCjNQXVe/8ACjnhPV6+tfT7r+Q8
ydHs8RGP1o1I/wAUJR952rw48q30Z/4uw3+/pf40SmHM+KvUHRVLwf8ARp4mWVWpF1fxVLRp+rVb
XWcb5r34fYx2jyx0gpeKxmIjwrVF3SZ2jwZcqN0nzxdR/W1ZfxRT95YufI794ItA/LccsdJeTRwl
GMX9uUdX1Ri0+tHLOvX0cd3f3RK534X9Lx09jI1oeavGU4viqc3G/bm+01h4cetl3VYos89Gx5Yi
XrhH4GnL0+Ymehmh5dII1cJDbVnQV+C17N9ibZLdNYY93j4D0b4VdKwwFGGjKVknhq82luhTpSUF
1N3/AITljPV7OtdePuv5I8s9C8tKYP8A5uaP/KyJ2vDw4cz4xVZNMCydNF/WFf7/ALkSN58jOkn7
rBf82q/5W1SQy9Ph+tG6q/qmn/zdVf8AlXTHqnp87+UGaC/4j0h/uKf/AEEUi1ceL8P1g10HX9YU
rcKn/KuQyMOSqkVzFr6fr+tsZ/v6n+Jkx4dOpzfiN9KXeho//mz/APgiuIZ+nw/WjVNf1LU/5vKX
/KqoPU/m/P8AQZ0MWeL/AObKv7EMjD1+FEN0bV8dhv8Af0v8aLWceZ8QjpJnjcS/+PVP8TEMub8R
NdNVZ4Nf90VD2Nkn6tZ+nwg2/wDmBdeO9lL8x6/I/m/P9BroNlLGP/uhxHril7xl+p0/X4UVnQkd
fFUFxq0/8SLWMeRIdNnr6Uxr44qv/wArJCcLnzfjRJdM/Jw+jI/90V++vWJj+rWfE+H61Y1orydB
458cThF3KsxeSezfjP1Vngu/5i1F8IV33UajGXB0ufx/IrnRpxV0DwqZaWqrhTwy7qFNGceHfq8/
h+USN6R8no9hFxxmJfdCkhOUvsz439BvweZR0k+Gja/rlBe8ZfqdP1+FKpehIa2KoLjVh/iRqsY8
qnvCPLW0zj/+bqt6psmPC9T2r8asUs05tMAMsAJsFGgDADQQYAYAYAYAYAYAYBhgBsKMAMAMAFJE
BsIMKDADADYUbIBQQbRVCkQCkAEQAVACyKP/0vaZ63xn5VMANBBgBgBgBgBqwUasQGrFBoIMAMAM
AMAMAMAMIDADVgDQQZYoNWCjQBgBgBgBhAaAMAMCDQBgBgBgBgBlig1YKNWIDADTQAOwQYAaAMAM
AMAMsAZYqDADQBgBgBgBgBgBgBgBgBgBgBgBgBlgDVgDNUA1qgGrAGgDADADADADADADADADADAD
ADAgwA0AYEGrBRlgDVgDAo0AYAYAYEGWANAGBBgBlgo1YA1YKNACrFQZYA3YAyxAYEGAGAGAGFBs
AwoMCjLEBsAwAwAwAwAwAwAwAwAwoMAMKDADADADCA0EGAGEUbAMAMAMAMAMKDCg2RQqxAbCDADA
DADADCgwA2GhgApEQbAMRQbCjADADADaACoAWAbQULAFIgFlBtMgFlBtMgFgCkFCkAKQAsAUmAKA
FogFphQRMoFpkAtMAImFC0wBaYARMihaAFp3ACRYAtMKCJgC0ALTAFp2IBYULTuALTAFgC0woUnY
AIALTAFJgCgDYBsKNpkBsINlUbIDYQbIo2UG7gCrgGyAwA2mAKCDVwDVwo0AYAYAaAMKgwAwgEth
QkAwqDQBgBhAabAElBgBgBgBoINEBgBq4BoqjADQQYAYAYAbTAFEBsqhSZAKANlApO5AKAFJhRsg
FFApMAImRQRMAImALTCgiYARMAImRQRMAImAETCgqYARMAWmFBIsAImAETIoImUBEyAIgoIgAiAF
IKFBAoqhSIBQBtACyKMRQLRAKRQaIDTQAkqjQQaaIBNig0ECWgoSAY1cAHawBjzKgG0ADaABtBAN
oAE0EA2gAbQANoqAbQAhq4ANoIBNAAmggG0UAmggE0ACaABtFQDaABNBANoAE0UCGggG0AIaABNB
ANoAE0ACaCAbQAhoAG0ECGgATRQDaCAbVgBDQANoAQ0VANoARsAENBAhq4AkAQ0UCGiAQ0UCWgBD
QQIaAsIaApDVwBIANoAQ0ADaCBDRQDaABtAbIaABtWAENWABtBANoAQAJaKLCSDTTRQIAMauECGr
AGiAQ1Yo0S0AJaAEtBAhoKrQRohoA0AKQAtBQRACogBIkAZBQeIAaIUGiQZo0QqHEQBxEKHESAcR
ChxEAcQCsnEWQDiLChxEAPFhQ4iQDiLCs0eLAhxFkUHiAHiFB4gB4kUHiBgeIUHiAHiFB4kAeLAD
RCg8QMjxZFBogB4sKCoAIiAIgoKgAiACRCgiACIgFlBhFCkECgo2ALQQYFGwDQBgQaZQIIDRUCZA
A5AA5AA2ADYANhAKSAG8kAAkioAyQACSCAEkEAJIoAyQACSCAEkUAJIIG8kEDeSKBvJBA3kioG8k
AN5IIG8kVACSAG8kVA3kgAMkEAJIAFJAAJIIBsoBtEANoqBBQaIDCAS0UCSgwgMIDTRQJANFB6px
H/Ir9E1HZKpRS5t15Xf8sn3Hn5r3+zh8vzHlVo7vAEgHqnwVxXRzQVfHS2y8bUXNQWql3xfecM/N
e/o/Zx2PK8pObbebe07vAENBB6N/o/6L8rFYprYo04vr8qXsicepXu+jTmjhvSjSfzzjsRiL3VSr
Nx+7fyfVY6yaeXO7uxA2KwOu+BTRXy/SsajXk0Kc59r8hf4r9hzz4ejoTd+Aa+GLSnznpepFO8aM
Y012LWfrk0XCeE6+W8hy6xtwFl6H6K+etIYfD2up1Y633U7y9SZnK6bwndZB2Xw/aU16uGwqfmxl
UkvvPVj/AIZd5z6cen6TeIPOx2eIKjFzaSzb2IA9VeEyS6LaAo4GPnT8XSdt+qtaT7Ws+s4Y+a+h
1fs46HlM7vnjZAerOhP/ACKPRqpi3lOcalVfefkU++0X2nHLzX0On9jDY8pnZ4BgB6N8AWic8TjJ
LYo0ov8Aml7InLqV7fo85o4l0q0t8+Y7EYnaqlSTj929o+pI6SaeXO912K+VgdL8EmiPnbS1FtXj
RvVf4fN/mcTGd1Hfo47omPDdpf5fpPxKfk0KcY/il5T9TiuwmE8NdfLd+A44dHmD3R2BlpOtToQ8
6pOMF1ydkFk2PSnhtxsdE6Pw2Ap5KTWX2KUbJd7XcccPL3de6kg8vHZ4BgB6u0P/AMiV0WlW82pU
pyn+Kt5MH2JxfYcb5r6GP2MP36jyidnzxgB6Q8AeiNX5TjZZJWpRf80/8py6le36PjzRw7pTpf5+
x1fE7qlSTj93ZFdiSR0k08ueXddiAKwOheC3Qvz1pWhFq8KT8bLqhmv5tVdpnK6jt0sd0Wrw56Z+
XaQhhk/Jw9PP70/Kfq1TOEdPpGW7r3DiZ0eUFoUZYmcYQV5SaSXFvJA0PVHhQkujGg6WAptXkoQf
OMLOT7Zat+tnHHzXv6v2cdDy3W8qEJcnF9ad/Y0js8Ac+dX5TfqmvbZ94UemfBbh49FNCVtIVF5U
1Op1xppqK7Wnb7xxy817ujO3HY8xVq0sXGU5u8nUu3xc7tv1I7PDyA1fKhB8Lx7ne/8AN6gg7V4F
9CfOOkPlcl5NCkmvvyvTXqUn3HPOvV0Md3fugrHhW029J6Xqyi7xo6tOH4c3/M2XGajn1st5fAUb
C01SxUYrYqqXZrWNOU5Drovo+Wk8bSw6verJ03yU04t9ibfYLWsJu6Ho3ww6UjgKNDR1LJShUk0t
0YU5Rgupt5c4nLCPZ17rx++B5j0X5Upx3OlUv2Rcl60jtXhg3ozy3Uh9alP+Va/+UlIPUvRHDvoV
0aniFlWqU51l96S8j1KL7zjfNe/D7GOx5a0V5bqx+tSn/Ktf/Kdq8MGaG8qc47nRq+qEpe4tTH9K
Oz+APQXynFVsbJeTRhqR+9Pa11RTX4jl1K9P0fHd2Kj0o07/ALRabr1E7wtVpQ4aqpygrdeb7TUm
o555d2Qo/RxftuHXGrBd8kjVc8eQ96E6NlpXSWFow2utBvlGL1pPsSbFvhcJuwdx8Pum1Qhh9HU8
l+8kluS8mC6vO7kc+nHq+kZcRY4D0n/4vxX+/q/42dI8mfN+Ks6SK+IT40qD76MGIZf2PyHqnRuK
/wBhejKxD8mtKimuOvUSUO66bXJnHmvfL2Y7+5HlbSL1sHhnzrL+ZP3nZ4LxPmrLX0a/+bhf4GPU
9PmO0/0e9EurXxGJa8mEYwi/tSu33Lb1o59SvT9GnNSqp0l0/wD7SaaxlWLvTjQxNOHDVhRmrrk3
eXaak1HPLLuyvwv5CgdDv+Yng/8Am5o/8rImrw5Ycz4xVamrN9ZpgWTpkrY+v973IzG8+RnSRfRY
L/m1X/K6qWGXp8P1oyt/zCaf/N1V/wCVdIep6fP+wM0Flg8f/uaX/K+mSmPF+H6wZ0Hyx9N8I1X3
U5lyOnz+/cKja5pzFs6fO+lsb/zc1V3TaM48OnU5vxo10qVqWAXDBr11qz94hn6fD9aNxy0LLnjI
+qlL4j1P5vz/AEGdD1ZY18MFV9biveKYevwoi+iUdfSOEXHEUV/Oi3hnDmfGBlpyWviq741Z/wCJ
iJlyJ/pyrTwq4YLDeumn7yY/q31PT4QZUy0FDnjqnqpQ+I9fkfzfn+gzoVlHHvhga3rlBe8X9TD1
+FEB0Yh4zH4aPGvSX86LWceZ8RnSuXjNIYqXHEVX/OxDPm/Gib6cq1PRy4YCn66lWXvJj+rXU9Ph
/ZGsH5GgMS/rY3Dx7qdZj1J7N+M/VonwZeTpJS+rQxT7sPUGXB0uflfypXPJI24q6B4Vv+YziVwd
Nd1OC9xjHh26vtVIzTf0egdHL61fGS7vEoTlcvZnxv6DOgXkUNKS4aPmv4qtJDL0+KYevw/WFVfo
tDxukMLHjXpLvmjVYw5nxU56dT8ZpbHS44qu/wDlJImPC58340iqGnNtgBgBgBlgBNgo0AYAaCDA
DADADADArNbAjADCA3YA3YINlBgBgBgBsKNkBsINlBsKFEQLQUEQAWJAKCj/0/ah7Hxn5VMIDQBg
BoIMAMAMAMAMIDVgo1YoNAGggwAwAwAwAwAwgMANAGAGBBqxQasFGgDADADADCA0AYAYEGgDADAD
ADADADLBQMrI0AYAZYA1YAywBqwUZYgMANAGAGAGWAMKg0AYAYAYAYAYAYAYAYAYAYAYAYAYAasA
ZqgGtUAzVANWANAGAGAGAGAGAGAGAGAGAGBBgBoAwINWCjVgDAo0AYAYAYEGAGggwAwAwKMCDADA
DADADADAo3YoNgGAGAGAGAGAGAGAGAGAGAGAGFBgBhQYAYAYAYAYAYAYyA0EGyKMAMAMAMAMAMKD
YUKIDYQYAYAYAYAYAYUGwowKMAFEQbANooMCjADADABUQgWFC0AKChaCDZFC0UGyAWgDZQLRAbQU
LQQKQULQBtABADaAFoKCIAWmQC0ALQUEAFoAImQC0woWmALACJ3ACJhQtMAWALTuAKTIoWAETAFJ
gC0wBadwoWmALTsALAFJkUKuVBgBsKN3IBQQbuFGFBu5AKCDZFGFApMINkUbAMAMAMAMAMANFQYA
YAauQCbhRgBoqDQBgBhAabAElBgBgBgAkiDADABNwowoNBBgBgBogMAMAMAFXKBVyA3cKN3AFpgG
ygUncgFAG0woUQCkUBEwBaZFBEwAiYAtMKCJgBUwAiZFBEwAiYARMKCpgC0wAiCgiYARABUwoWiA
ImAETCgiYAtBQsIFIqjaIBSANgCyKNlAtEApFBgUZYIEkAkqjQQasQCWig0ECWgoSAY1cAQ1YAS1
cqAbQANoAG0EAmgAbQQDaABtAA2ioBtACGggG0ACaABNBANooBNBAJoAE0ACaKgG0ADaCAbQANoo
BtBANqwAhoAFJBAJoAG0ACaCBDQANoAQ0EA2gATRQDaCAbQAhoAG0EA5IoEtXAEACGrBAhq4AgAS
0UCGiAQwBDRQJaCBDQGiGgBDVwBDQAhoAG0ADaCBDRQDaAsIaA0G0ADaAENBANoAQ0AJAENFGoSQ
VpooEgGggQ1YA0QWENWKKS0AJaAE2CBLQVYSEaIaAFIAUgoIALiALiAFiRQeIAaIUGiQZo0QqDxA
HEQBxFhQ4iRQ4iAOIsKycRIBxEKHEWAHiwocRZAOIsKzR4sCHEWRQeLADxCg8QA8QoPEgyPEKg8Q
A8QoPEgDRADxCg8WBKPEioNFgB4hQVABUAERFBEAFQARBQREARACyoNkaCkECgDAoWgg2FGwDADQ
BorISyKEhBjKAbABsAGwATAEMIAyQAGSAASRUAJIABIIASRQBkggBIABJBAGSKAEkEDeSAG8kVA3
kggbyRQN5IIG8kEDeSKBvJBACSKgbyQACQQBkABkgAMggE0ADZQDYANhBooNEBhAJaKBJQYQGEBp
ooHmjMDLSdelQjtqTjBfiaXvFqybHozw7Y5YTC4XBwyUpOVuChHVX+L1HHpvb9IupIPMh2eEasEH
qnp5/wAir0bpYTZOcaVJ9fnz77Ndpwx819DqfZx18B5TO7wDAD1Z0X/5FLotUxHmzqQqVPxVHqQf
dqnC+a9+H2cNjygeh4BgB6h8BWAjgMHicdUyUpat+Eaa1m+ryvUefqPd9HmpaPN2lMdLSlerXl51
Scpvrk2/edo8Nu7sMSoO3+AnRPyvH1MQ1lQp5cpTyXqUjl1K9X0fHd37hTvCdpb530tiJJ3jCXi4
9UFqv1pvtNYzUc+rlvKihG3EXbwc6I+edK4am1eKnry6oeVn12t2mMrqO3Sx3YOg+HnS3ynGUcMn
lSpuT+9N/CKfaZwjt9IvnQ4QdHkDjCYaWNqQpQV5TkoxXNuyCybHp7wyYmOgdFYfR9N2UnGNuMKS
Xv1Tjh5r3de9skHlk7PAMAPVui/+RM6Kyq7KlWm5c9as9WL7E49xwvmvoT7GH79R5SO7543YoPTP
gJ0WsHh8TjqmSbUE3ujBa0n1ZruOPUe76PPFo896c0k9NYqtiZbatSUrcE3dLsWR1nh4sst3Yi7F
QdY8DOhvnPSsajV40ISqPr82Prd11HPO+Ho6E3fgB+GPS/zppWcE7xoRjTXX50vW7dgwnhOvlu/A
cqsbcBK6D0VLTWKo4aO2rOMb8E3m+xZi+GsZu6HoTw66TjhMPhsBTyTeu0t0YLViurN/wnHCPZ9I
y1JB5msdnhGWAPV0v+RH6LW2VatPt163vjF/ynDmvoexh+/UeUrHd88asAemPATopYOhicfUyTeo
m90YLWm+rNfwnHOvd9HnNHn7T2lJabxdbEy21akpdSbyXYrI6zw8eWW7sRFisjpvgk0H88aVpNq8
KCdWXXHzf5mn2GM74d+jju/AT/hi01856U+TRd4Uaepbc5zWt7dRcnEmE1G+vlu6HHIrXptfVkmu
p5P2R/TOjzB1Rwk9ITo06ec6jUF97Wsl3OPZYm15Hp7wr42OgdHYfR1LLxzVP8EFZvvcXzzOOPny
93WvbNDyvQV4zX2cuxr3X7LnZ4IMS1qT5SVu1O/sRQep+gFuh3R+eOmkpyjOor79qprtea+8cMvN
e/p/Yx2PLONm67VSTvKcbt803H12ud3z6E4puNTWW1qMu1pN+tgo7r4HNA/KtKYjFNeTh9ZR+9Nt
Luipd6OWd8PX0Md233Cn9OdNfPunZSTvCFWNGP3YvVfY3rPtNY+I59TLuyHP9Eq9ZR+spQ/ii4+8
24wTPQjRfz1pClht1XXi3wThJN9izJldNdPHd0O/+GHTKw3iNHU8l4qtUklujGlOMF1ed3I5YR7O
vlrx8fyHmjQ372X+6rf8qpnWvDj/AGfyGaFX0r50qy76U0KuP9n8h6r6MYX/AGI6O678mtVg589e
ovI7VHVv1M43zXvwnZiPKvR7PF0VxqRXe7Hevn48jOjmWNw3++p/4kSmPM+I7b4AtAeOr1sdNZU4
+Lh96Wcu1JJfiOeder6Pj6jlvhG0xLTmlcTVeyNR04/dh5K77X62bx8Rx6mXdaRCdJv+LcR/vZvv
bLGM+WlmwOgn0k0thsLunTwut9xUKbl/Kn2k3qNzHusnw/IdS8P+m9T5Po+GSS8bJLZvjBf4vUc8
I7/SMuIkcHx//EWG+/W/yHWPLeJ81ZH/AJh0v+biP+CRT0+Y9PaNg/B10XlVStXnT13xVStaMe2K
cb/dZwv2q90/k8P36o8w9GF9LVf/AHTYn/lTM7V4cP0v5KzoZ/zE8H/zc0f+VkReDDmfGCsvM05i
ydNMtI4jlUa7siR0z5GdJPMwa4YWPrqVH7yQz9PgN4lW0TQ54rEeqnQ+JfU9Pnfyg1oZWwOOf2KK
/wCUsX7hTHi/L8xvoTljU+FLEPuoVGSmHP4/kKxhafjKkVxkl6zTEE701n4zSmNfHE1/+VkiY8Nd
Tm/Gg/S1Wjg1wwdP1ym/eIufp8Bk1q6Gjzxk/VSj8R6/I/m/P9BnRPKlpB8MHL11qS94yMPX4frA
26DU/GaVwS/7qqP/ACsiLwnT5nxgrmNn4yrOXGUn3s0zRa+nq1cTSh9XCYNf+m9N+8zj/Zb6nPyn
5BOM+j0Jhl9bGYmXdToITkvsz439Bvof5GH0lPhgmv4q1FDIw9fh+sEZ0JpeN0rgo8cVQ/5WRLeE
w5nxgiNNT8dia0uNWb75MRnLkWfp75MsFHhgMN64uXvJj+rfU9PhAmK1Oj8vtY+H8tGX/CHr8j+b
8/0GvB0tTE4if1MDjJf8oZL3jL9YdPn5X8mq5/Cn42Sit7S7zTmq8eFOfjNN418K0l3Ze4zjw6dX
2r8UgnSRauhtFLj8rl31Ix/yic0y9mfP8xnQ76PR2lp8MNSj/FXpr3C+i4cX4fqVCdA6XjtLYGPH
FUP+VkS5cMYcz4wqO6T1PH47Ey+tXqvvmyxMub8VQJWWmgisAMAMAMAMANWChIBgBoIMAMAMQVK2
QZKsUGwgwAwAwAwAwA2FGACkQGwg2VRtEApACkAEQAWIAsA//9T2set8V+VTViqNWIDADQBgBoIM
AMAMAMAMIDAo1YA1YoNWCDQBgBgBgBgBhAYAYAaAMCDQBlig1YKMsAaAMAMANEBgBgBgQaAMAMAM
AESKg0AaAMAMAMAMAMAMAMAMsAasAZYKNWIDLAGAGgDADLFQaAMAMAMAMAMAMAMAMAMAMAMAMAMA
MsAa1QDWqAasEGWANBRgBgBgBgBgBgBgBgBgQaAMCDLBRqwBqwBgUaAMAMsEGgDAgwAwAwA2FGWA
MANlUYEGAGAGAGAGAGAGAGAGAGAGFBgBhQYAYAYAbIDLAGWCjdgDLAGWAE2sRBgBgBgBgBgBhQbC
hSRAbCDADADADADADCg2FGBRgBsAURBgBtFBgUYAYAYALREGyqFxAFBQtBAoKFJkAooNxIBZQbTI
BYApBQoAUgBYApMAUALQAtMKFpgBEQC0ALTCgiYAtMAIiKFoAWmALTsALWQAQKFpgCkwAgApMiha
dgBYAtMAWnYKFgC07gC0wBQBu4UKuRBsoNgGwo3ciDYBsKN3ANhBsijZQbTAFBBsijADADQBhUGA
GACbkUaANAGFQaAMAMIDTYAkoMAMAMAEkQYAauFGigwA0EGAGAGiAwA1cATcoNpgCiA2UCrkAoKN
lAtMgNlApO5AKANphQogFplARMKFpkARMAImAETCgiYARMgCJhQVMAImAETCgiYASLCgkWAETACx
ZFBEUC0QBEFBEAEQARBRtACkAKQBsoFmQbKoUgBSAFBRgBqwQaIBLKo0ECQBLQBoIEtBQkAxq4Ah
qwAhoqAbQANoIBtAAmggG0ADaABtBANooENWABtBAJoAE0ADaKgE0ACaCATQANoqATQANoAG0EA2
gAbRUA2gAbQANoIBNAA2gATVwgG0AIaABtACGggFJFANoAG0EA2gBDQANoqBDQAhq4AgIENWAEtA
CABDRQJaIBDAENFAhoIsIApDQAloAG1cAQ0ADaAENBANooENAagbQFDauAIauADaCAbQAhoA0AJa
A2SAaKBDVgDQQJaAEkGoQ1YoEtACWgBIQJaCtQkIrABSChYAtAC4hQWJAGiAGiFBogYGiQBohQ4i
AOIhQ4iyKHEWAOYsDI8WFDiLIBxFhQeLChxEgHEWBKPFhWTiLCg8SAcRCg8QA8QoPFkGaPFgQaIU
HiwA8SKDxYAaLCg8QJR4sioNFgB4sKDIAKgAiIoIgAiACIAKgoIiAIig2QGwBYBgUKQQKCjADbAN
AGFQJZAJANFQIYANgA2ADYANhAKQAGSAASRUAJIABJBAGSAASRUAJIADJBACSAASKgBJADeSCBtJ
FA3kggBJFQN5IAbyRUDeSCAEkUDaSCAEkEAZIADJAAZIAEwgG0UA2gAbCBBQYAaIDCA00UCQDQBh
AdO8EOi/nLS1OTV40YyqPsVl65JmM74d+jjvIOfDRpT5fpWVNPyaEIw7X5T/AMVuwuE8L17u/Ack
NvOLR0K0V89aRw1C11KpFyX2Y+VL1JmcvEdOnN2DrPh80p4yth8Kn5kJVJLnJ2X+F95z6cej6TeI
PPbR2eMOMJhZY2pClDOU5KMVzk7ILJsem/DRiY6E0XhsBTyUnFJfYpRXvcThh5r3dfxJB5aO754S
0FHq/SP/ACJ3RSNPZUq0lHnrVneS7IuXccOa99+xh+/UeUju+eMAPVXgppR6MaEr4+azn4yp1xpq
0V3qVus4Z+a+h0Z247HlqrVdaTlJ3lJtt8W9p2eEDCD0P4AtEa9XEYxrzYqnF85PWl3Wj3nLqV7P
o+PNHH+mel/n3SOIxCd4yqPVf2Y+TH1JHSTTz55d1tFYK5jpvgi0P87aWpNq8aKdWX4co/zOJjO6
jv0cd0Snht0v84aT8Sn5NCnGP4peU/al2DCeGuvlu/AcfsdHmEroPRctM4qjho7atSMepN2b7FmS
+GsZu6HoXw66TjhMPhsBTyTeu0t0YLViurN/wnLpvX9IupIPM52eEZYij1Zpf/kSei8aPm1KlNQf
HWreVNdicl2HGea+hfsYfv1HlQ7PnjAD1F4G8HHQOjMRpGrkpuUr/YpJ+/W7kcc/Ne/oTtlo8z47
GS0jVnWnnOpKU5dcndnZ4bdhqEHafAdoX5dpCeJa8nDwdvvT8lerWOeder6Pju79wrPhT0z89aVr
NO8KTVKP4Mn/ADazNYzUc+td0c8NOIsXRLQv+0GPoYbdOa1vurOXqTJbpvDHuuh2jw9aZV8PgYvJ
J1ZL+WH+bvOfTj1fSMuIPOljq8Q3a4B6t6Sf8iL0ajhllVqQjTf3ql5VPVrLuOE8178vsYaHlE7v
njAD1B4F9Hx0Lo/EaRq5Kbbv/wAbpJtvv1u445vf0J2y0ecMfpOekMTPEz8+dRzfW3fuOunit3dh
KpqE6lNbLSSf3Xre63bcIOp+BnQvztj41ZLycNrVHzlJase6zfYYz8PR0Md34Bv4YtNvSGlLQfk0
IqEfvJvW7b5dgwng6+W78BzWMFCtKK4zil1ppI24B1oHRs9NVlhoedUlBLk3JK/Ym+wl8LjN+B6H
8NeOjonR9DAUcotxvHhCCtFd6X8Jzwezr3U0PMtVa0IPhePc7/5vUdXiGYnPVlxivV5PuuUo9YaC
nHoR0fnjdlWrDx346iSgvY+84XzX0MfsY7Hl+vV8TjpT4V2+6dzs8F5+YHo6l4nGU4fVrRXdJBJz
8x2fwDaB+UYitjZLKlHUh96W1rqSt+I5516vo+O7sUXpRp3/AGj01Vqp3g5SpQ+4ouCt17e03JqO
WeXdkKboXOvFcVNd8WvearliJzwf6K+edJ0KFrxk5a33dV63qM5eG+nN0dy8LunU8Zg9HweSkqk0
ud4QXdrZc0c8Y9XWy8yDzj0eyxuH/wB9T/xI6148eZ8QjQOWLof72n/iQpjyPU87eDno5bza1RW5
+Mre+Mf8Jx9qvd/beP79R5X0+rYzEL/j1T/EztHgy5+YL0mX7bX++xFy5NvSPgl6P6terpCorKOH
w1KDf+4pym+xaqvzZyyr29HH1+6flFrinhM01/tFjIYlebOm9T7qqVFH1JHTGaebq3uu/wB8rFax
/wDxFhl9qt7Ylc7xPmLf0C6Pf7TeJwzV4PFqVT7kINy79nW0Zt06dPHu8feOs+G7Tiq0amCg/wB3
CnOfXOa1V2KLfVJGMI9HXy9Ejzt0aynWfDDV/XBr3nWvHh+lVnQ5W0lhHwr033STF4MOZ8RWDTAs
3TRf1li1wr1F3Sa9xnHhvqc34jXShavyZcMLS9d37xDL0+EGY7LReFXHEYp/y0F7h6l4nxv6DNFr
V0djHxlh497m/cCcX5DOhq1cRUl9XC4t/wDpvUXvLkYfpfyohNC0/G4qjHjVgu+SFZx5BuktTx2O
xMuNeq++bLDLm/ESXTLyamHjwweG9dNS95I1n6fCDeM+j0Phl9bF4l91OgvePUvsz439Bro6tTBa
Sl/3T049+IpP3C+hjxfh+sGeDxf1thH9WrGX8OfuGXB0+YKW8zTmLl4Q8tIzX1aeHj/DRpx9xnHh
06nP4fkN6ZWrojALjUxUu904/wCUk5LxPn+g10b8jR2k5f8AGqEe+vB/5S3mGPF+X5hHg3p+M0xg
r7q8H/C7+4ZcHS9qfEUmrPxknJ7233mnMXbwirUxdKn/AHeEwke6hB+8zi6dTn5T8hrELxfR+ivr
46s+yNKmvePX5H83538oNdAfJ+Xy+ro/EfzasP8AMMv1On6/Cqp+hKPyjF0IfWq013ySNVjHlpLd
P63j9L46X/dVW7lOSJjw11Ob8akSvS/6LR2iafDD1Zfx16j9xJ6rnxPhfzI30b8jQulpcfkkO+q5
f5ReYYezfl+YaeC6j4/TeBX/AB+D/hd/cMuDpe1PiVS8dW+UVZz+tOT73c25VTRoCwkDTLAGggwA
wAwAwAwA1YKEgGAGggxAQQDLADADADADADYUYAYAbSIBQQYUGwo2iAUgBaACIALEAIiA/9X2set8
V+VTADADADVgo1YAwA0AYEGgDADADADCAwAwA1YA1YoNWANAGAGAGAGAGEBgBoAywBgQaAMAMsUG
rBRlgDQBhAaAMAMCDQBgAmQBoAwA0UGWCDADADQBgBgBgBgBgBgBgBgBgBlgDVgDVgoyxAaAMAMs
VBgBoAwAwAwAwAwAwAwAwAwAwAwAwAwINWANaoBqwBoKMAMAMAMAMAMAMCDADADQQYAasFGrBRoA
wAwIMAMAMCjYBhQYEGAGAGAGAGAGAGAGAGAGAGFBuwBuwBlgDLAG7AGWAMIDYBgBgBgBgBgAloAS
AYAYAYAYUGwBSQUbIgwAwAwAwAwAwAwqjYUYAYAbQQKIDADZQYFGAGAGAC0RBsqjayACAG0FCwDa
IBZQbIBYBsoFogNoKFhAoKFoA2gAgBtMAWgoIgBaIBaYARMKFoAWgAiYAtMihYAtZgC07gBEwoWg
BaYApMAWAEIoUmALQAtAC0wBewKF7QBSYAoA2AbTIoUEGFBsKFXIDYQZcKNgCrhBsAwijaZQKuEG
yKMKgwAwA1cihNwDADQBoqDADADCA02AJKDADADABJEGACSqMANAGBBgBogMANNgCWygwA0AYAKT
sAKuQGygUmQCgo2igXcgNlApMgFAG0woWgBaYARMihaYARMAImFBUwAiYARMigiYAVOwAROwUETA
CIAIgoIgAiIAqZVBEyAWmAEiwoKmAEiAKANlULIDYApEAoqhSAFEAoqjdiINFUaANWIgTYqjQQJA
EtAGggS0FCQDABDVgAbRUA2gATQQDaAByQQDaABtAA2ioBtACGgATQQDaABNBAJooBNBANoAE0AC
aKgG0ADaABNBAhoAG0VANq4ANoAG0EAmgAUkADaCBDQANoAQ0ADaCATRQDaCAckAIaABtBAhooBt
WAEtACAgQ1YKEtBAgAQ0AIaAEtACGigQ0EaIYAhoAQ0AIaABtAA2gBDQQDaKKQ0BoNoAG0AIaABt
XCBAAloASBqEtAUloA0VAhoKNBAloASQaIasUGgBDQAkIpLQVokIFIKFgBEAKiAEiRQaIAeIVBYg
ZGRAGiFB4sAcxChxEgHEWFDiLAzR4sKHEWQDiLCg8WAOIsihxFgSjxYVk4iwBxFkUHiwA8QoPFgB
4sipR4sDI0WFB4sAPFhQaLIA8QA8WFB4hWRokAeIUHiAEiAFRAEQUEiAEiAEiAFiFBEQCigwihaC
DYUbCBYBgUbANAGBBplAggNFQJkADkADkADYANgA2EAZIABIIASRQBkggBJAAJIqAEkABkgAEggB
JFAGSCBtJBA3kigbyQQN5IqAEkAN5IIG8kVA3kgAEkVA3kgALQQBkgAMkABaCATAEMoBtACGgBJU
GAGiAwgNNFAgoMID0p4CdGrD0cTjZ5JtQTe5RWtL2ruOPUe76POaPP2m9IvTGKrYh7atSUuq7ul2
bDrPDx5Xd2IlqxWR3PwE6J+U42riWsqNPVX3pv4KXecupXq+jzzsULwj6W+edK4moneMZ6keqHk5
dbTfaaxmo5dXLdoo5pyHSfBLof510tRbV40b1Zfh83+ZxM53w7dGbyEv4btLfL9J+JT8mhTjH8Uv
KfqcV2E6c8N9e7vwHHDo8wnui+iPn3HUMNtVSpFS+7e8vUmzNumsMd3Q7j4fdLW+TYKOxXqyX8sP
8xz6cev6ReIPOB1eILp03VajFXbdkuLYUeqPCdUXRXQNHAQflT8XSdt6gtaT7Wlf7xxx817ur9nH
Q8qHZ4BgB6u0B/yJPReVfzalSnKovvVfJg+7VfYcb5r6GP2MNjynY7vnjAg9OeA3R0dH4TE4+pkp
PVTe6NNa0n1Xf8pw6le/6PNS0eddMaRlpfEVcRLzqs5TfLWd7dmw7Tw8WV3diOKyOzeBDQ3y/SMs
Q15OHg3+Kfkr1az7DlnfD1fR8d3fuEB4VtM/PGlq1neNK1KP4PO/mci4TUZ62W6Ocm3AWnoTob5/
0jh8O1eMppz+7HypepNEyunTp4910OteHrTPjKtDBxeUIupLrllHuSfec+nHo+kZeg8+HV4wunTd
VqMVdt2S4thR6n8IlRdD9AUsDB2nNQpO2+3lTfa1Z/eOOPmvd1fsY6HlU7PAMAPVXg8proboCrj5
q05qdXPl5NNdrzX3jjl5r6HS+xjseWKlR1ZOUndttt8Wzs8AQEHf/APoXx1etjJLKnFU4/elm+5K
34jl1K9n0fH1HLunmm/9oNJV66d4a+rD7sPJXfa/abxmo8/Uy7qKiacxdvB1oP5/0nQpNXhGXjJ/
dhnZ9btHtM5XUdelj3UdB8O2m/lWKpYOLyow1pfensT6kk/xGcI7fSMt3Q4QdHkBKNKWIkoRV5Sa
SXFvJIKPU3hGrR6G6CpYCm/KqKNLLel5VSXa8n9444+a9/V+xjoeVTs+eJKOdWm90lFdnmP2PsI0
PS3gvw8eiOha2kKqs5qVTPfGCagu13t95HLLzXt6U7cdjzNjcRLGrxs3ecpTu+N2pe2TOzw3yNuS
hWhJ/YbfYm37wDsHgP0FLE4+piJLycPC345ZLuSl22Oeden6Pj537hWvCbpz5/0jiHF3hScYR6oN
xffKTa5FxmmOrl3Wjnks6UeUpetR+DNOAnej+hn0hxeFwq/tGk+UdaTk+xJslum8ce6yDtfh20ws
PTw+j6eS/eSS3JeTBdXndyOeEer6RlrUHnvSmdaUvrWl/ElL3naPHQ8rT8Vj3LhXb7pkW8/MeqdE
0Y+D7QdOLyq1ZR69etJJdsY/4ThfNe+fyeP79R5M0J/xVR/3kP8AEjvXz8eRmg1+1Uuc4rvdhTHk
d68AmgbOvpCayX0UG+yU3/hV+s5517Po+PqOV6R04+kum/lXozxEFD7qkox9SV+ZvWo89y7st/eK
10dyxuH/AN9T/wASLXPHmfEWDwb6EentKYenbyYTVSf3YeV63aPaZyuo30se6jpfh1098qxdDAxf
k0kpzX2p7E+qOf4jOEd/pGXnQ4fp93xmI/31T/EzpHmy5BukkXLG10s34yS9dhDLkepOmGNfQjo7
Chkq86VOhl9ZwSm+yKaT6jjPNe/O9mP8B5b04rRwy4YePrlJ+87R4MvT4NNaSywmFXKq/wCe3uEL
xB6N8BWAjgcBWxtXyVrztJ/UjGLk+q69TOWb2fR5qbSuIaY01LpDHSGLl/a1qNlwj5equxRS7DpJ
p5rl3bv3xUD0e8lYl8MNP1yjH3lrGPr8BvofljqL+q3L+GLfuFMORX8PS8dOMeMku9lYgl+llTx2
kcXLjiKz75sRvPm/Gg/SzKtSjwwuF9dGEveSGf6T8hrSy1NH4NcXXl3yS/ylheJ8xmD8jRWJf1sT
hl3Qrt+4nqs4vxn6jfRNarxUvq4St/MlH/MKmHr8KGnQ+l4/SWDhxxFFd84ly4MOZ8YITHVfH1Zz
+tOT73crFFj6crVxij9ShhY/w4emiYt58/KflBml/I0ZgY8ZYmffKEf8onJlxPmM0N5GjMfLi8ND
vnKX+Ul5MeL8hnQDydIwl9WnXn/DRqS9xcl6fP4/kKWlfJGnIXHwjP8ArbFpejVcf4fJ9xnHh16n
NG+kf0ej9Gw40q0/4q81/lE9Uy4nz/MZofyNEaQl9aphYd7qS/yk9Vx4vy/Ua8G2WlKMvqRrT/gp
Tl7i5cJ0ufx/IqiNGnMXnwm5aVrx+oqUP4KUI+4zjw6dXn9+4hOmvotC6Pj9ari5vvpRX+Ficrl7
M+f6DXRBeJwelKvDCRh/HXpL3C+hhxfh+sEN0IofKdK4KHHE0V2eMjcuXDOHM+MaRPSOt8pxuIn9
atUffJsRnK+fmq1dP/Iho2H1dH0X/FOpP/MiY/q6dT0+ESN6L+g6P42X95isLD+GNWQvKT2b8Z+o
zwSrV01h5fUVWf8ABSnL3DLg6Ptfv3Fc2NuStBAlhWmgKwAwA0EGAGAGAGAGAGrBQkAwAWEYYAYA
YAbAMCjADADaRAKCDCg2FGEAoIFBQtAC0AFRAFAP/9b2uet8Z+VTADQQYAYAYAYAasRRqxQaANBB
gBgBgBgBhAYAYAYAaANWANWKDADQBgBgBhAYAYAaAMANBBgBgBgBliqNWANAGiAwAwA1JBAgAwAw
AwAwAwAwAwA0UGWCDADADADQBgBgBgBgBgBgBgBlgDVgDLBRqwBlgDViAywBhUGgDADADADADADA
DADADADADADLBBqwBqwBqwBlgDQUYAYAYAYAYAYEGgDAgwA1YKNBRoAwA2AYUGBBgBgBgBgBuwBl
gDLAGWAMsAbsAZYqDYUYQGwDADADADADADADADADADADADCgQ1YgNAGAGAGFApIKFEQYAYAYAYAY
AYAYVRsKMAMANgGyINgGAGyqMAMAMANoIFogMKowAWmALChSCBQUKRAKKBUWQCig2iKFhApBQoAU
gBYApMAUALWYAtMihaZQERALTAFphQtMAWgAiIBaYULTAFp2ACIAWmFC0wBYAtMAUmRQsAWmALTA
FgC0wBSdgoWALTuAbAMAFJkUbCDZQbAN3IoUEGAGwo2mAKCDCKNgCrlQbANXAE3IowAwA0UGggwA
wAwgEthRoqDADADADQQJZAaKowA0EGAGAGiAwAS2VRoINAGAGAGAGAG72AFkBsoFJkUKQBu5QLTu
QGygUmRQoIFJhQpMAImAETIoImAETACJhQVMAImAETIoImAETACxYUETACRYUEiwAiZAFRVBEwBa
ZAEQUFTACIAWAKKoUiAUAKiAKCjaAFkBsqhaIgywAkqjQBpoiBLRQaANNACLAGgBLQBoA01cAG0V
ANoAE0ADaCAbQANoIBtAA2gAbRUCGgAbVwATQQCaAByQQCaKATQQCaABNAA2ioBtAAmggQ0ADaKA
bQQDaABtAAmggG0ACaABtBAhoAG0ADaCAbQANooBtBANqwAhoAQ0VANoAQ1YAS0AICBDVgoQ0ECW
gBDQAhoAQ0AIaKLCWgKQ0ECGgAbQAhoAG0AIaABtBANoosIaA0G1YAG1YAQ0ADaCBIAloASBppoC
kNAGioEtBQkIEtAWEkFJaKBIAhoASEWEtBWm0EC0FCwBcQBaIoLEANEKlGiBkaJAGiFB4gDiLChx
FkA4iFDiIGacRYUHiyAcRYUHiwBxEKHESCDxYVk4iwBxFkUHiAHiwoPFgB4sipR4sDI0WFB4sAPF
hQeLIA0WAHiFB4sgzR4sKDRYAeLCgqACIAIiKCoAIgAiACIKCogFlQYRoKQQKAMChaCDYUbQBoAw
A0VkJIoSVBpgCGADYAJgA2ADYQCkAAkgAEkVAGSAASQQAkigDJBACQACSCAMkUAJIIG8kAN5IqBv
JBA3kigBJBA3kgBvJFQN5IIG8kVA3kgALQQBkgAMkABkEAmAIaKAbQAMINNBQkAwqDRAYQGmigSA
eqKn/IndFrbKlWlbnrVn7VF/ynDmvf7GH79R5WOzwDLXAPU3g5guiWgKuOkrSmqlVX+ytWC7Wsvv
HHLzXv6X2cdjyvObqNt5t5tnd4AkA9L+AnRiwtDE46eSbUE3ujBa0n1ZruOGde76PNbo886c0lLT
OKrYmW2rUlLqTd0uxZHaeHjyu7sRRWR3HwFaG+V46pimvJoU7L708l/Kpd5y6ler6Pju79wpfhN0
x89aVxE07xhLxceqHkvvd32msZqOXVy3RQjTkOheC3Q3z1pahFq8ab8bLqhmv5tVdpnK6jt0sd0W
zw56Y+W4+GGT8mhTzX2p+U/VqmcI39Iy3de4cTsdXlEpoXRktM4mlho7as4x6ruzfZtJbprGbuh6
G8Oek44HDYbAU8k3rtLdGC1Yrqzf8Jywj2fSLqSDzMdnhG7EUerOk/8AyI/RqGGWVSpCNN/eqXlU
9Wsu44zzX0M/sYaHlM7PnjAD1T4M6UeiWgq2PmvKmp1M96itWC7Wnb7xxy817+l9nHY8tVasq8nO
TvKTbb4t7Ts8IGEHoTwDaF8ZVr42SyhFU4dcs5dyS/iOXUr2fR8fUck6baa/2g0jiMQneMptQ+7H
yY+pJnTGaefqZd12KsVzHRvBVoT570rRurwo3qy/B5v8ziYzuo79HHdFi8N+mvnDSEcNF+Th4JP7
8/Kfq1V2EwjX0jLd17hxix0eYPtGaPnpWvToQ86pOMF1ydiWrJvwPSPhox8dC6Pw+jqWSk0rf8bp
JJJ9ur3M5YeXt697ZIPMFjs8IywB6t0cv9gejLqebWqQcuevVyj2xja/3WcOa+hPsYfv1HlKx3fP
GWAPSngL0QsJRxGkKmSf0cW90Y+VN9Wz+FnHOvd9Hmt0cE6RaWlp7F1sVL+0m5LkvRXYrLsOs8PH
ll3XYhrFZHTvBHoL550pTlJXhQTqy61lH+Zp9jMZ3Ud+jju/ASPhq03856R8RF3hh4qP4peVL3J8
0TCNdfLd17hyCx0eYS+A0dPTE6FCn59Sfi12tO/8zvyRN6ak2PSfhe0jDQ+Ao6Op5KondfYpRur/
AItV9jOOD29e6mh5eSvSfKSt2p39i7ju8IyuvJh93/M0AesujlJdB9B1MRLKrVcqi+9UerT9Wq7d
ZwvmvoY/Yx2PJ1JuSqN5tx/zROz54TH91L70fZIoPQHgK0Gq0qmNkv3etTh1yUXJ9iVvxM5Z16/o
+PqOX+ETTa6Q46WIjnCSah92M5Ri+1K/WzeM04dXLuuxVNJeev8Ad0v+VcSudFx6MaCfSLTUaNrw
8dKc/uRk5Pv2dbRm3UdcMe7L5jqPhg0/47SGDwMXlTnCpP70pJRT6ld9UjOEd+tl5kHn/Qqti6PH
xsP8SOleTHkZoJXxdBf8dh/iQqY8j1hiUugGhcPhVlVqOFN/em9ao+xayT6jhzX0L9jGQeT9AK2L
ocqsH3SR3rwY8jOj2WNw/wDvqf8AiQpjz8x6L8BOgVgsNW0hUVnUepB/YhnJ9ry/Ccs69n0fHU2P
Pmk9Kz6Q6QniZ7atW9uCbyXYrLsOmtPHb3Xf3iO0w9fE1nxqT/xMsTLkdU6HdHf9oOkVXWV6dCvV
qz/DN6q7ZWy3q5i3UejDHuy+FDjw6af+ccfHCRfkYeOf35pN9y1VydxhF+kZbuvcOW9IFaVFcMPR
9cVL3m48+X6QGx+HliqWBpQV5zpS1Ut7lXqRS9RFvp+/WtPR3hErx6CaApaPpPy6kVSut686rLte
T++c8fNe3qfYx0jzXhstHV+eIw/+Cvf3HV4fT5z9VZoNWoY18MPFd9eivZcUx9fh+sGuiatir/Vo
4iX8NCpL3Crhz8r+QYaApePxmHh9atTXfJItZx5+Yb6WqfKMRVn9apN98mxEvIlumOWMlH6tOhH+
GlCPuJGs+fw/Ib095GFwEf8AunnLvr1V7EhDLifD9aNW8Xol/bxa/kpv/hl9T0+f6DOjnkYfHz4Y
VLtlXox9lyVceL8P1gzoJlpPDS+pU1/4E5e4ZcJ0+YKgbYFs6e5aTxEfqT1P4Eo+4xjw31OaM6Sf
RYTR0P8AunnN/ir1fckWGXE+H60ZhfodDYh/3mLw8eyFOs/8yHqfzfnP1GdCfIq4if1MHin/ABUp
Q/zEp0/0v5Cu6FofKsVRp/Wqwj3ySNVmTdD7pfX+VaSxc/rYis++bJFzvm/GiS6ZrUhgIfVwVP8A
mnUn/mGP6tZ+nwGUfotBVH9fG0l/BSqP/Oh6/JP5vz/QZ0BXi6+Iqf3eCxUl1ulKK/xEyXp/pfyF
NwVD5VVhT+tKMe92N1ygsvhEr/KNMY2X/dRVX8MmvcZx4dOpzfiHPSr6LR2i6e/xFaf8dedvVFCc
1c+J8L+Y1oD6PQ+k5fWeFh3zlL/ILzDHi/IC8F1NT01g77I1Nd/gTl7hlwnS9qCgVpOpJye1u/ea
cq2vvhM+jxdCl/dYLCQ7qMX7zOLt1OflPySNv6Po2vt6Rf8AJQ/5bHr8j+b8/wBBvwY/R4uvV/us
Fi591GS94yTpc/K/kVzZmnJWig0EWNWCtNAGgDADADQQYAYAYAYAYAJsFG0EZpQEYFGAGAGAGyA3
YA2EGFBsKMANogFIA2ALQAuIAVABSA//1/a563xn5VMAMAMANAGBBgBgBhAasFGrFBoAwA0EGAGA
GAGAGEBgBgBgBqwBqwBqxQaAMAMAMIDADADADQBgQaAMAMAMAMsUGrEUasAaYAkrIwAywBqwBlgD
ViKMAMAMAMAMAMAMAMANAGWKDAgwA0AYAYAYAYAYAYAYAYAYAZYA1YAywUasAasEGAGgDADADADA
DADADADADADADAg1YA1YA1YA0FGAGAGAGAGBBgBoIMANWCjVgDdigywBlgDdgDLAGEQYAYAYAYFG
7FBlgDADYBgBgBgBgBgBgBgBgBgBgBgBgBhQYAYUGmiAQQGAGFApIAUQGAGAGAGAGAGAGAGyqMCj
ADYBsiDYBgBgBsqjADADADaCBZFGFBgBtZABAoUggWFG0ALANogFlBiIBYApBQoIFIKFoAUgBYAp
ACkFBEALRALQAtBQsAIgBaYAtEULQAtMAXFgBEwoWALTAFIAWncAWmRQtOwAsAUmALChadwBaYAo
AWmAbAMAN3ChVyINgGFApMihQQYAbCjaYBsINhRsgMuAYAYAaAMKg0AYAYAYQCWwo0VBgBgBgBoI
E3IDRVGAGggwA0QGAGrhQkoMCDQBgBgBhAYAauEGyqNp2AFpkBsoFJkAoKN7CgWQGygUncihQQKT
ChaYAVMKCIgCJgBEwoImAFTACJkUETACJgBEwoKmALTACphQRMAImAFTCgiZALTACphQRABEFC0U
G0QCwDaAFkUbRQLIDZVCkRAoKNBAmxQaCjLBAhoA0FGmggQ0AaANNACQBLVwAbRUA2gATQANoIBt
AA2ggG0ADaABtFQIaABNBANoAE0EAmigE0ACaCAbQAJoqAbQANoAE1cIENFANoIBtWABtAAmggG0
ACaABtAA2ggQ0ADaABtBANoAG0UA2ggG0AIaAENFQIaAENWAENACWrhAhhQhoIENACGgBLRQIaIB
DRRohoAQ0ECGgAbQAhoAG0AIaABtBAhoo0G0BQ2gBDQANqwQIaAEgGmgLCQNEgCWgBIQJaChJUCW
gNEkAlooEgCGgBIRqMApSChYAREApBQSIAaIVmjxAgsQA0SAPEKDxYA4iyKHEWFDiLAlHiwqHEWQ
DiLChxFgB4sKHEWQB4sKwcRYA4iyKDxYAeLCg8WAHiwA8WRWBosAPFhQeLADRZFB4gB4sKDRYEo8
WRUHiwA8WAGQUEQAREUEQAVABEAEQUEQAQINkUbQAtAGBQpBAoKMANsA0AYVAlkAkA0VAgAGwAbA
BMAGwgHJAAJIADJFQAkgAEkEAZIABJFACSCAMkEAJIABJFQAkgBvJFQN5IAbyQQAkioG8kAN5IqB
vJBA3kigbzQQAkgATQQBkgAMkABaCAbAENFANgCSIMsFCbFBoqDRAYQE10c0S9OYyjhl/aVIp/dv
5T7Fdi3TeE7rodx8PGlVTjhsFHJZ1JLkvJh/mOXTj1fSLxB5wOzxA+Gw8sXONOCvKclGK4tuyIsm
x6c8LeIj0d0RQ0fTfn6kOuFJJt9+r3nHDzXu617cdDyy1Y7vANAHqzS3/Ik9F40vNqVKahz1q2c1
2Jy7jhPNfQy+xh+/UeUzs+eENFB6s8HsF0O6P1cdJWnNTqq/Lyaa7Wk1944Zea9/T+xjseVJyc22
3dvNs7vAMRAelvATopYWjicfUyTfi4t7oxWtN9Wce45dSvb9Hx1ujgXSDSr05i62Jl/a1JSXJN5L
sVkdZNPHll3XYhysjtHgP0L8v0hLEyXk4eDa+/PyV6tY5Z16vo+O7v3CueFTTPz1pWs07wpWpR/B
t/m1jWE1GOtlujnZpxF08Huhfn7SeHpNXgpa8/uw8p367W7TOV1HXp491HRfDvpr5TiqOEi8qUHO
X3p7E+pJP8RjCO30jLzocGOryB3gMHPSNWFGmrzqSjGK5ydkFk2PTHhhxkOj2i8Po6k7KerG32KS
Xter6zjh5u3u697ZoeXDs8AwA9XYb/kROjDl5tarTvz162S7Yxa/hOHNfQ9jD9+o8p6p3fPG7AHp
zwK6NhojA4jSNXJSvZ8IU03J9rv/AAnHO78Pd0JqbHnXS+kZaXxFXET86rOU3yu727Nh1k08eV3d
iOKyOyeBPQfzjpCWIkvJw8Lr787xj6tZ9aRzzr09DHd37hBeFbTnz3pSrZ3hR+ij+Hzv5m+yxcZq
M9bLdHODbgLH0Q0J/tDj6GGteM5rW+6s5epMlum8Me66HZfDvppXoYGGxLxs0u2MP83ejnhHq+kZ
eg87WOrxBUYObSSu3sQB6q6WyXQPo7DCRyq1Iqk7fWneVR9XnLtRwnmvoZ/Yx0PKdju+eMsAeo/B
Pg4dGNE19I1lbX1p/gpppLtetbjdHDLzdPf0Z247HmbHYuekKs61R3nUlKUnzk7s7PDfIa2CDt/g
Q0J84YueImrxw6vH7804+xN8mkc869X0fHd37hAeEnTL01piTTvTpuNKHBqLtLvlrda5Fxmox1cu
7Ic3o+VCa4JPtTS97NuAsHRnQj6R4nDYZenUcZPhBWlLuTkyW6bwx7rIO3eGjTSoywuj6eS1o1Jp
bknqwX+LLkjnhHq6+XEHnHC5trdqy9UW/bmdXigyGdOX3o+yXxAPUuN/5150aUPNr1IavPxlXOXb
FXt91HHmvoX+TwHl3F+ZR/3b/wAczu8FG9Jeev8Ad0v+VcSFHpfwSaHjgFi9JVclJuMZPdCK1pvq
vZfhZxzvo93Rx1ujhOmNIy0tpidaWblicuSUrRXYkkdZ4jyZXeXzEFolL5XS4eNh/iRazjyLn4J9
APTmlKTa8ih9LL8L8lfxW7Lmc7qOvRx7r8BdvCnp/wCctMUcLF3hhrX+/Lyn3LVXJ3M4zw6dbLeW
vcOK6ByxVJ8Jp92Z0rzY8gnRmk62Ow8Yq8nWp2X4kSmHM+I9U9KcTDoXgcDo6i/KqVaNPrjGUXUl
2uyf3mcp5fQzvZJPgPJehafjcVRjxqwXfJHevn48htWXyms7elN+tkS+R656FYWHRXCY7SlZWdWr
Wqc9SEpaq7Xe3G6ON8+H0OnO2W/EeXemFeWK0hiJzd5OpK/WsjrHhzvmgHSPKvFcKGG/5UUywy/S
fkOx+C/o587Y3CVpq9PCYZT/ABzqVHBetyX3TnlXo6WO7Pun60Rvhv00tLYmlCLvCk6sV1pxUv5o
tdgwmmevlurHLramjfvYhfyQ/wCWzo4+nzVmi/IweLlxVKHfPW/yCpOL8hvoz5M68/q4av8AzQcP
8wph+lCehsf6ywreyNanJ9UZKT9gvC4cz4it5zfFs05ix9Nc9JYpL0a04r8LcfcZx4bz5vxGdKPI
+Sw+rhaX82tP/MIZ+nwG8b9HovDR+tiMRLsUaMV7GPUvE+N/Qa0SvF6PxsuLoQ75uX+QtMeL8hnQ
ryMVKf8Ad4fEz7qFS3rsTJcOflfyFf0Zh/ldelT+vUjHvaRpzk8h/wBLcR8r0ji6n1sRVffNsThr
O7t+ND/ph5DwlP6mDofzp1P85mLn6fCDVf6HQ1Jf3mMqvshTpr/Oy+p/N+d/KDOi30OH0hV+rhNX
tnWpR9jYph6/D9YG/QOh8o0rg4vZ8opN9UZJv1IZcHT5nxFZxdf5VUnUfpScu93NMUWzp99HiqdL
+6wuFh2qhBv1tmMW+pz8p+QzHfs+hMNH+9xeIn2QhRivayzlb7M+N/QZ0P8AocPpGrujg3HtqVaU
fY2Mkw9fh+sET0Mw3yvSeDp/WxFFPq11cXhMJuz4wRun8R8sxdep9erUl3ybLGcruiydPPo/kNP6
mAofz61T/OTH9XTqenwg1QXiOj9Z76uOpR7IUqj9skPX5H835z8hrwarxWPlW/ucNiqndQmveMjp
c/K/kOeautktppxWL74VmvnnFRWyDhT/AOTdOMPcZx4der7VWM03+z6B0fD+8r4uo+zxcF7GJyt9
mfG/oFdAfoaOk6u6OAqR7alSnH2NjL0+J0/X4Fc2ZtwUkijRUGAXbAG2rBTbQDbQDbAG2ANtBDbA
G2ANsAjADaCjADADADADdiA2EGygwA2FGAGEAoIFBRtACwBaACxACEB//9D21Y9b4r8qmrBQkAwA
wAwAwA0EGAGAGEBgBqwUZYA1YoNAGggwAwAwAwgMAMAMANAGAGrFQasFGWANAGAGEBgBgBgBqwBg
QaAMAMAMAMAB2KDLBBgBoAwAwAwAwAywBlgDVgDLAGWCjViAwAwAwAwAwA0UGWCDADADADQBgBgB
gBgBgBgBgBgBlgDVgDNUA1YA1YA0AYAYAYAYAYAYAYAYAYAYEGgDVgDVgDADQUYAYAYAYEGggwAw
AwAwAwAwA2FGAGAGBRsqDADADADADADADADADADADADADADADCgwAwoMAMAMAEPIyDQApIoFEBgB
gBgBgBgBgBgBsqjAowA2AbIg2AYAYAYgDZVGAGAGACkRAoKMKDADAAizChaCBYUYiAIUGEAQoMAF
ogNhQtBBsKFoAUALQBsAWALQULQAtEARAC0FC0ALAFogFoKFoAWAETAFphQtAC0wBSdgBYAtO5FC
kwBYAtMAWnYKFgC0wDYApMAUAYAYAKTIBQBhQKTCjZEGwDLhRu4Aq4QYAbIowAwqDQBgBgBgBq5F
GrgGioMAMAMANBAlsgNFUYAaCDADQBjZAJKo0EGgDADADCAwA02ECblBoKNp2AFgG07AC0yA2UCk
yKFIA2nYAWAbKBadyA2ALTCgiYARMKCpkARMAImFBEwAqYARMigkWAETACxYUETACRYASLCgiYAV
MigkSgIiAIgoKmAEQULQApACkAbAFkUbKBaIBSKBSAFBRgBhAJaKgSFGNBAhoA0FGmggSAJANNAC
QBDQANoqAUkADaCAbQANoIBtAA2rgA2ggG0UCGgATQQCaABNFQCaABtBAJoAE0ADaKgG0ACaCAbQ
AhooBtBANoAG0ACaCATQANoAG0ECGgAbQANoAG0EA2igG0ECGrgA2gAbQQIaAEtFAgAQ0AJauEAw
oQ1YIEtACGAIaKBLRAhDRRohoAQ0EA2gBDQANoAQ0ADaABtFRSGgNBtAA2rgCGrgCABLQQJChLQR
qEtAUkAS0AJANNACAixpoopBAJaKBIAloASBspACgAhAKQUEQAWIGaPEKg0QAsSKDxADxYAeLChx
FkA4iwqU4iwIPEKHEGQB4sKHEQBxEihxFgZo8WFQ4iAOIkUHiAGiwoPEgDxYVkaIEHiwoPFgB4kU
GiwA8QoPFgKNEKyPEgDxYUGiAFiAERAEQUEiAFiAEiAEiFBEQCgDAoWgg2FG0ECwDAo2AaAMYQJZ
QJIDRUCZAA5AA2ADYANhAOQAGSAASCAEkUAZAAJIIASQQBkUAJIABIIASRQAkggBIIG8igbyQQN5
IoASQQN5IIG8kVA3kgBvJFQAaAAyCAMgAMkABkggGwAbRQDaAEEQYAYwoSUGioNEB2zwH6H+V46p
iWvJoQsvvTyX8ql3nLOvV9Hx3d+4U7wl6X+etKV5p3jCXi49UMn3u77TWM1HPq5booJtxHTPBJob
520rTk1eFBOq+tZR/mafYYzuo79HHd+AkPDRpn5x0l4lPycPBR/E/Kl7Un1Ewnhrr5bvwHIjbzCz
9CtC/P8ApHD4dq8ZTTn92PlS9SaJldR06ePddDrHh5014yrQwcXlCLqS65ZR7kn3mOnHo+kZeg8+
HV4w80fgZaTrU6EPPqTjCPXJ2ROFk2PSnhnx0dB6Nw+jqWSm4q3/ABuklb16vczjh5u3u697ZIPL
Z3eAKQB6u09/yIvRmOH82rUgqb+/VvKp3LWXYjhPNe/L7GGh5SOzwDYB6r8HtNdDNAVcdNWnNTq5
77eTTXa81944Zea+h0/sY7HlepUdaTlJ3bbbfFs7vAEBB6Q8BGh1RhiMfPJfu4t7kvKm/wDD3M5Z
17fo+PNHDOk+mHp/G18U9lSbceUdkV2JJHSTTy55d12IIrA694F9B/OeklWkvIw8XP8AE/Jiva19
0xnfD0dDHd+AZ+F7TXzxpScIu8KCVJdazl/M2uwYTUTrZbvwHMLG3AWbodoT/aHH0MNa8ZTTn9yO
cvUn2kt03hj3XQ7D4d9N3lQwMHlFeNmub8mHctbvRz6cen6Rl6DzydXjBKVKVeShFXlJpJcW9gB6
k8IVWPQzQNLAU35dRRpZb0vKqS7Xk/vHHHzXv6v2MdDyudngGAHqroNTXQfo/Uxs1apUjKrnz8mm
up5P8Rwy819Dp/Yx2PLFSo6rcpO7bu3xbO754QAehvAToO8q+PmsorxUG+LtKb7Fq97OWdez6Pj6
jj/THTj6RY+vib3jKbUPuRyj6kn1nSTTz55d12KyVzHRfBZoL590pSUleFH6WX4fN/mt2XMZXUdu
jj3UWPw26d+cMfHCxfk4eOf352b9Wquu5MI6fSMt3XuHFzo8oe6NwE9KVqdCmrzqTjGPXJ2FWTY9
J+F3HQ6OaLoaNo5a+rH/AJB00tvW9XrzOOHm7e7rXtmh5fOzwDAD1b0aj/sB0dlimrVakHU/FUtG
muxara6zhftV9DD7GOx5eq1HanO+aTz56zffmn2nd4ARwUZ1YLLzkvwvW9iCjvvgM0KnGrjp+g5U
4N81FyfYkl2s5Z16/o+PqOP9NtNfP+Pq4qLerN/R8ox8ldWy5uTTzdTLuuxBtataaX/HPZIrIuPg
x0EukGkYU5K8Irxk+qEouz63ZdpnK6jp0se6i6+HPTfyvEUsJB+TRTc19uSi13Ra72Zwjr9Iy3dD
imL8yl9x/wCOZ0eWg2Kw8sXWhCCvOcaUYpb24RSQW+f4D034ScZHofoSGCpvy6qVPLettSXbsf3j
jj5r3dW9mOh5xSvpK3/dT/nOzxevzEfoXPF0f97D/EhUx5HpjwSaNj0Z0VV0hVVnVvPnqQuortd3
zujjld17ejO2bHnLB4yekcZLEVHec3VqSfPVlJnV45d0NNBq1dPhGb7oSfuLUxHT/Al0f+c9IPEy
XkYaN/xyuo+rWfWkYzunfoY7u/cN9OukPz7p6Ki708NJQj1wetN/xXXUkMZqHUy7svgOY9G1+3Yb
/fU/8SN1ww5nxCui+jZaWx2HoRV3OrBPkr3b7Fd9gtXCbo9EeGzTC0fhKGjKOTqtOS+xDKKfXK38
LOWE9Xs6+WpoecukslUx2Ja2OvVf87OseLPm/EL6T5YupH6urD+CKj7iQz5HqrRFaHQXQHyx/vJU
Kclf67hGMI9V3d8Ls43zXvxvZjv7h5X07UdSjhHJ3k6M5Sb2tyr1c+1WO8eHL0+H60hGK8jR1Bca
+IfZq0UvYyJePnf0aZh1qaNrv62IoJdShWb9sSrOPnP1GaC8ihjZ8MOkuuVakvZcUx9fh+sGdEvJ
xal9SlXn/BRnL3Cphz+P5CL0JhvleKoU/r1YR75JCpjN0J01iPleKrVPr1Zy75Nlhl5olemSti9T
6lHDw/gowi/WmSLnz8p+QTpz6LB4GHGlVqfxVpx/yCLlxP36jdH6LRNX/jmKpL/k3Tqf8ND1T+b8
5+o10XXi4Y2p9TCT/nnCn/nLTD1+AD0IoqtpPCJ7FXpyfVGSk/UhlwdPmfEVvEVXiJym9sm2+13K
xRaOnfk4+UP7unQp/wDJujCPuJi6dTn8PyGab+i0bgIfW+UVP4pqH/OMk5TLifP9/wABmiPodF46
f1p4an3ynP8A5xlvK48X5DPB/wCRpCNTdSpV6j5alGcl60hknT5/H8hS4U3Uaitrdl2mnMW/wiTU
tLYpLZCo6a/5BpQ/ymceHTq80L6R/Q6O0bT3unWqP8daUV6oIk5XLifP8xrQn0OidIz+tLC0++Up
v/lWi3knF+Qzwaq2lsPP+7c6n/JuEp/5SZcHS5FClmbchefCWvF6SlS3UqWHpr8FGCfruZxderz+
H5DNI/s2gcJD+9xWIqfwQpQXvHqX2Z8b+g10F+hp6RqvZHAVY9tScKfskxl+p0/X4CqdHMJ8ux2G
o/XrU4/xTSLWMZuz4h305xXy3SuNqbpYms11a7t6hjwud3b8a1E10zXyfAaKocMNUqf8na037jM9
Vz8SfD9SM6M/QaG0rU3yWFpr8VVzfqgW8xcfZvy/Mc4NuKktEQJKo0EGAGAGAGrAGrBRoAwAwA0E
GAGAGAGwowA3YgN2CDZQYAYAbCjADABSIDaANgCkAKAFoANEAWFH/9H22et8Z+VTQQYAasRRqwBh
QaAMAMANBBgBgBhAYAYAYAasFGrFBqwQaAMAMAMAMIDADADADVgDAg0AZYqjVgDQBhAYAYAYAYAa
sAYEGgDABDANAGAGAGAGAGFBlggywBgBoAwAwAwAwAwAywBqwBlgo1YgMAMAMAMAMANFBlggwAwA
0AYAYAYAYAYAYAYAYAZYA1YA1qgGrAGgDADADADADADADADADAg0AasAasAaCjADADAgwA0EGBRs
AwAwKMAMANlBgQYAYAYAYAYAYAYAYAYAYAYAYAYUGAGAGFBgBhAbCjLAGWAEyQBpIIFEBgBgBgBg
BgBgBgBtBRhVGAGwg2QGwDADADADaAMKowAwA2ggUiA2VRgBgBgAqLACIKFhBsihZQbAFogNlApE
UKCBSChSAFIAWAKQAoAUgBaChaAFogFoAWgoWALTAFpgBERQtAC0wBadgBYAtMKFpgCwBSYAtOxF
CwBaYApMAWgBSYAsKCJ3AMANp2AFJkBsoMAFJkAoAwA3cqhVyA2EGAG7hRu4BsIMAMAMAMANXIo1
cA0VBgBgBgBgBoATciDRVGAGgDAg0QGmwDRVGgg0AYAYAYQGrgCblBoAwAwAwA2nYAWQGygWmQGy
gUmQCgo2nYAWAbKBaZFCkwAiYARMAImRQRMAKmAETCgiYARMigiYAVMAImFBEwAqYARMKCoAIgAi
CgiZAEQUFTACIAIgoUALQBsoFoyDZVC0AKQBtACyKMKDADCAS0EGiqNACWggSFGmggTYA0AJaAEs
AG1YAG0VANoAE0EA2gAbQQDaABtAA2ioBtAA2gAbQQCaABNFQCaABSQQCaABtFANoIBNAA2rBAho
AG0UA2ggG0ACaABNBANoAG0ADaCBDQANoAG0EA2igG0ADaCBDQANoAQ0VAhogENFAgAQ1YAS0ECG
FCGrBAhoAS0ADaAEtFGiGggQ0FCGggG0AIaABtACGgAbQQDaKNQhoChtAA2gBDQAgA00ECQoS0Eb
JaANACWgBABpoAQEajTRQIIBLRQJAEtAWMQGi0ALIBaChSADRAwLEKDxADRIA0QoNEAcRYUHiyAc
RYUo8WBk4iwocRIBxFhQeIA4iyKHEQM0eIVDiIA4iRQeIAaIUHiAHiRWaPECDRCg8QA8QoNEgDxA
DxCg8QMjRIoPEAPFhQVABIgBERQRABUAEiAEiFBEALCDCNBSCBQBsKFoIMCjaANAGBBoqBBFGioN
MAGwAbABsAGwAbCAMgAMkAAkVACSAAyQQAkUAJBACQACQQBkUAZIIG8kAAkioG0kEDeSKAEkEDeS
CBvJFA3kggBJFQN5IADJBAGQAGQAFoAGwgGwAbKAbCDRAYAZYKElBoqD1L0FiuhnR+pjZZTnGdVX
4vyaa6nk/wAR58vNfQ6f2Mdjy3KTm23m3m2dnzwhq5Qem/AxgI6F0fiNIVclJvP7FJNt99+44Z3d
09/QmpaPN+ksfLSlepXn51Scpvrk7neR4bdhiRB6D8BGhdepXxsllFKnB835Uu5KPecupXs+j4+o
5D010z/tBpCviE7xlNqH3Y+TH1JM6YzUefqZd12Ksbcx1/wLaD+c9JePkrww8HL8UvJj72uo5Z3U
enoY7vwEd4XdN/PGlKkU7woJUl1rOX8za7BhNRnrZbvwHL2jo4C6eDvQnz/pOhSavBS15/dh5TT6
7JdpnK6jr08e6jo/h3038pxVLBxeVKGvL709ifUkn+I54R2+kZedDgx1eQSGidHT0viKeHp+dVnG
C7Xa/ZtYvhqTd0PR3hp0jDQ+Aw+jqWSlbL/jdJJJPrdv4TjhN+Xs691JB5hOzwjNoB6u09/yIPRq
OHWVapBU3x16l3U7lrJPkjhPNfQy+xjoeUkju+eFWCD1R4N6Eeh2g6ukKi8qopVM96j5MI9rzX3j
jl5r6HSnZjseXa9aWJnKc3eUm23xbzbOzwgQQeh/AToTyq+PmsorxUG+yU32LV72cs69n0fH1HHe
mOm/9osfXxN7xlNqH3I5R9SXadJNPPnl3XYrRXMdP8EegvnnScJyV4UF419ayj/M0+xmM7qO/Rx3
fgH/AIZ9O/OmkfERd4YeOr+OWcvcnziTCeGuvlu/AchOjzCY6P6Ilp7F0cNHbUmot8FvfYrvsJbp
vHHuuh33w36WjgcPh9HUsk7TkluhDyYLqvf+E5YR6+vdTQ81HZ4htK4B6s0v/wA6+6Nqj5tapDU5
69W7n/Ctaz5I4T7Ve/L+TxHlKx3fPGWAPUHgi0fDo5oyvpKsra+tL/kHTvs63rdeRxzu7p7+jO2b
Hm3SWOnpWtUr1M51Jyk+tu51nh4bdhlYqDtPgS0B8vx0sVJeRh45ffndLuWs+Tsc869X0fHd37hW
fCjp75+0nVcXenS+ih+Hzn2yv2WLjNRz62XdRzyxtxFk6IaCfSPHUcN6MpJz5QWcvUnbnYlum8Me
66HbfDXptXo6Oh5qhKpNLkmoLss3bqOWEerr5eg87zX0UfvS9kTs8QdKDqVpWz1lNpfei2u3MjQ9
NdIWvB70djho5VqkVT/HUu6j7FrJPqOM817sv5PHQ8t115MPuv8AxSO7wBxJfT1P+QnskQHo3wPa
Nh0f0dX0nXyU1Jp/8bp3vbrd+uyOWd34e3oTtmx560ppGemJ1sRU86pV1ny1tZ2XLYupI6x47d+Q
zxfmUvuP/HIFHXfBX0f+dtKRryV6eGpU5/jcEor2y/Cc8rqPR0cd3fuET4XdOvTmk5Uou9Ohamvv
bZvrv5P4UXCajPXy7r8BSab19Ip8cQv8Zr0cvX5jOiOjpaUx+How86VRdls2+xK5bTCbo9G+E/S0
NC4ejoyhknSqSa4U6VOWqu2SX8LOOM35e3q5amv3wPMmhv3sv91X/wCVUztXhx/s/kN6FX0sv9zX
/wCVUyUx/S/kPUXRPBvoH0fnXdlXnTnWz+s4twXYkrrrOV8178J2Yjy9oSTlXcm7vxdeV+apTftO
1eHH+z+Q10eyxMZfUU5/wQcvcKY8jtXgH6O+Oq1dITWVNeLpv7Tzk+xWX4mc869P0fD1HP8ApDpv
/a/Tiqp3pyr06dP7ikorv87rZqTUccsu7L5ih1m8dWbW2c3/ADM25ci+aK0D/tbp6dC16csRUnP/
AHcZNvvXkrm0Yt1HaY92XzHQvDx0hUpUdHU3lBeMqJcXlBdiu7c0Zwjr9Iy9BxPpEtSVGH1cPR/n
iqn+Y3Hly/SDNLfR4XBx406k++rOP+QsW8T9+oyt9Ho2n9vEVf5IU/8AhseqXj5/2GmYBeL0fip/
WqUKff4yf+Qizi/Ia6NrxaxNT6mGqfzuNP8Azlpj6/AZ0NVtIYeX1Kiqf8m/L/yjJMORW6dJ15KK
2yaS62VnkT/TKoqukcU15qrVFHqjJpepEnDWfN+IJ0qWo8NT+phaP86dT/OIufp8J/ZGscvEaLw0
d86+Im+pRpRXrUh6l4nxv6DND/RaPx0/reIp/wAU3P8A5xik4vy/f8BnQlamM8ZupUcRU/hoza9d
i1Onz8r+QrOBwzxlWFJbZzjHvdi1mTYmumeIWM0li5rY69W3VrNL1ExXO+b8Q66XfRQwVL6mDpv/
AJOSnU/zoRrP0+H9I0/odC/73Gf8qqX/AENJ6pxj8/0/pGdDl4qONq/UwVVf8nHCl/nLf1XD1+H9
AieimE+XaQwtL69elHsc1ctZwm7PiGnSDFfL8ZiK395WqS/ik2ImV3RP9OPo3g6X93gqC7Zp1f8A
OTH9W+p6fCf2Rn7nQT/47jl3UqX/AEMJ6/I/m/P9P6RnQL6Kpiq2+lgsTJcnKHi165ly/U6fr8KK
ho3CfL69Kl9ecY/xNIt8OcmxO9P8V8t0tjZ7vlFRLqjJxXqRMeGupfN+Ie9K/wBn0foujv8AEVar
/wCQladvVFCerWfE+H6jXR/6DQ+k6n1vktJfiqOb/wCVYvMMfZvyDfwZ4dYjTODvsjWU31U7z/yj
LhOl7UFGxdd4qpOo9s5OT7Xc053y1F88JP0VbC0N9HA4WD63DXfrmZx/V16vp8IRqivk3RyrLfWx
9OPZTpSk/XNE9fkTxj8/0HNzbirCgS0AJAMANBBgBgBgBqwBqwUaAMAMAMCDQAqwUbsEGwDADADY
UYAYAYAbRAKCDYUYALQBsAIAFiQCwM7f/9L22et8d+VTAgwA0EGAGEBqwUasAaKDADADQQYAYAYQ
GAGAGAGAGrAGrFBqwBoAwAwAwgMAMAMANAGAGBBoAwAyxVGrAGrEBgBgBgBgBqwAiQQJAMAMAMAM
AMAMAMAMAMAMAMAMsVBlgDQBgBgBgBgBgBgBlgDVgDLAGrBRhAYAYAYAaKDLBBgBoAwAwAwAwAwA
wAwAwAwA1qgGtUA1YA0AYAYAYAYAYAYAYAZYINAGrAGrAGgowAwAwAwAwAwA2VBgBgBgBgBgBgBg
BgBgBgBgBgBgBhQYAYFGwDLAGAGAGBRgBgBgBgBoiDAgwAwAwAwAwAwAwKNlUYAbsECiAwAwAwAw
AwA2FGFBgBgApEQKAMKowAwAwA2AFQULQQbChaIDZQKRAKKDaIoUECkFCwg2goWgDaACAG1kALAF
oKFogFooFogFoKFIAIALTIBaYULQAsAWmALTChaAFpgCgAgAqLIoUgAgApMAWALTAFJ2ChYBgBu9
gBSdyA2UGACkyAUAYAYUCkyKFBBgBgBtMKFXCDADVyKNAGgDCoMAMAMAMANACWyINFUYAYAaCDAB
LZAaKo0EGgDADCA03YAS3coNAGAGAGAGAGrkQbKo2nYAWQGygUmQCigUmQCgo2nYAWAbKBaZFC0w
AiYAVMKCJkARMAImFBYsAImAETIoImAFTACRYUFiwAkWAFiwoImAEiwoJEAKmQBEwoIgAkQoIAKQ
AoAUgBQUKQApACkFC0QG0UG2gBIBgBpogElBoAS0ECQo1YIEtAGgBLQAhoAG0EA2igE0ADaCAbQA
NoIBtAA2gAbRUA2gAbQQCaABSQQCaKAbQAJoIBNAA2ioBNAA2ggG0AIaABtFQDaABNAAmggG0ADa
ABtWAENBANoAG0ADaCAbRQDaABtWCBDQANoIEtFAhogENFAhoAQ1YAQ0AJauECABDRQIaIBDQFhL
RRSGgBDQQDaABtWAENAA2gAbQAhoIobRRohoAG0ADasAJaAEgCWrhAkKsasEaIaANACWgBABpoAQ
EaJaAEgCWigSAaCBSChZALQULQASIAaIUGiQBolAaJFBogB4gDiJFDiIUo8QMnEQocRIBxEKDxAH
EQocRIM0eIVDiIAeLIoPEAPEKDxADxIqUaLAyPEKDxYAaLCg8SAPFgB4hQeLIMjRCg8WAGiwoMgA
iACIigiACoAIgAiCgiAFhBsjQUggUgDAoWgg2FGwDADQBorISyKEhBhQDYANgA2ADYANhAKSAAyA
ASQQAkUAJBAGSAASKgBJAAZIIASKAMkEDeSAASQQN5IoG8kEDeSKgbyQA3kioG8kEAJIoASQQAkA
BkggDJAAWgATQQDaAENFANgCQg0QGAGBQ+0Vo6WlsRTw8POqTjFdrtfs2i3Syb8D0P4aNIw0TgcP
o6lkpWy4QppJLtdv4Tl05vy9nXupIPMx2eEEpUnWkoxV5SaSXFvYQHqHwhVF0O0DSwEH5U1GllvS
8qo+15P7xxx819Dq/Yx0PK7Vju+eNAHqxf8AIhdGfq1qlPt163vjF/ynn5r6HsYfv1HlM7vnhLRQ
ep/BrQj0O0HV0hUXlVFKpnvUfJhHtd2vvHDLzdPf0vsY7HluvWliZynN3lJtt8W82zu8O9gREHpP
wF6HjhKWI0hUyT+ji3ujHypvq2dzOWd9Ht+j463RwfpJpiWn8ZWxUv7Sba5R2RXYrI6SaeXLLuux
CFYHa/AfoL5fjp4qS8nDwy+/O6Xq1vUc869X0fHd37hWPClpz590pVad4UvoodUNvfLWfUXGajn1
st0c8sbcRfPBtoH5/wBJ0abV4QfjJ/dhnZ9bsu0zldR16WPdRefDnpz5Zi6eDi/JoR1pffnn6opd
7M4R1+kZbuvcOGnR5RJaH0ZPTOIpYeHnVZxiuV3t7NrJbprGbuh6J8M+k4aGwNDRtHJStdcKdNJR
T63b+E5YTfl7OvdTQ8yHZ4Rm0A9WaX/5190bVFeTWqQUOevVu59y1rPkjhPtV9DL+TxHlM7vnjAD
1J4LcJDonoetpGsrOopVObhBNRXa7243Rxy83T39GduOx5kxmKnj6k6tR3nOTlJ8XJ3Z2eG+QFIA
734DNA+Pr1cdJZUlqQ+9Lzn2LL8Ryzr1/R8fUc26e6e/2j0jWrJ3gpalP7sck115y7TeM04dTLuo
pxpyF+8Gegfn/SdKLV6dN+Nn1Q2LtlZdTMZXUdulj3UW/wAN2nvl2MhhIvyaEby+/PP1Rt3smEdP
pGW7r3DiR0eUPdG4CelK1OhTV51JKMetuxL4WTY9I+FrHQ6N6Lo6Nou2uox5+Lp2vfrer15nLCbr
3da9s0PMJ2eAYAeq9BxXg86OyrvKtUjr89epZQXYrNrkzhftV9DH+Tx2PKrblm9p2fPGgD0Z4D9C
Rw1OvpGrkv3cG90V5U31bFfkzlnXt+j468jjentNvpHpCriX/ayko8otase5WudJNPNll3XYr68q
k+Ulb8Sd/YisDpngw0F886VpyavTowjUl2RSiu9p9SZjK6jv0sd34CX8M2n/AJzxTw0XeGH1U/vy
Tcu5aq60yYRrr5buvcOOV/Nh91/4pHR5qJfR2j56VxviKfn1Jziut3RNtSbuh6F8KuNp9HNF09G0
ctaMVz1KbinfrbXXmcsfNezrXtmh5j82l96St+FZ/wCJHZ4QTFryKX3H/jmCj1P0fcegmgpY2StV
qUoTs/rOEYU49WxvhdnG+a+hj9jHY8zYhPEaQknm5V365nZ4bz8wDRs/GYynL/jsZfzXJUnI7R4C
+j3jatXHzXk014um/tPOT7FZfiZjOvV9Hx9RQ+kvSD/aXSmIxCd6ap1oU/uKnKMe9u/WzUmo455d
1t+P5CnaJWrKpL6tKp/NHU/zGq54i2eDHQa0/pBUpK8FCTn93JSXanbtM5XTp0se6jq/hf6Q69R4
KD8mjQlUqW+tO1OK7FJv8SMYx6Otl6fcPP2hlqOrP6tGp/MtT/MdK8eP6BXR+k51Z6qu/E1lZb3K
nKC9ckWmP6UeqcXSj4P9BrCp2rSo1Vdb6ni5VJvqVmk/uo4+1X0L9jHX74HlTo15OLpS+pLX/gTn
7jrXgx5A+jtJV8bh4vY61NPq1lcVMZ5nxHo3wL6HWCw9fStZWdZyUX9iLvJrrll+E5530e3oY6mx
556X6RlpbSGJrSd9arO33U7RXYkl2HWeHjzu7QjpT5OLnD+7UKf/ACbhGH+UQz5GdIl4t0Kf1MPS
/nXjP85ImX6T+yM0qvFYPCQ+tGrU/iqOH/OMsW8T9/vgjUvotGL/AI5iX/yipr/56PU9Pn+/zab0
V9FgsZP60aVL+Kop/wDOMlMeL8v3/Aa6KrxdWrU/u8NiH2ypygvXJFph+l/IN+ieHWK0hhYPY69O
/VrK/qFTCeZ8RDYyu8XUnUe2cnJ9ruVm3Yn+mvk4+rD+71KX/JqEaf8AlJi31ORvpD9FhsDS4YeU
31zq1H/hURDLifD9aEpeI0Q/+O4tf8oqb/8Ano9T+b8/0/pG+jH0NHHVfq4VxXXUqU4eyTFMPX4f
qBdB6CraTwut5sa0Jy6oPWfqRbwnT5nxFXr1XiJynLbJtvrbuVjkWrp6tTHzp7qVOjS6vF0oQfrT
M4t9Tn8PyGaa+h0ZgKf1niKv8U1T/wCcZZyuXE+f7/gM0N9BovH1PrvD0l+Kbqf84yXkx8S/L9/w
GvB4tTSVKpupKrV6vFU5T/yly4OlyKUouTstppyFz8IztpSvBbKWpS/5NQjT/wApnHh16nIzTn0G
idH0/ryxNV9s401/yrYnJlxPn+/4DfRpfJ9HaSrb/FUaS/5CVYyfqgyUw4vy/MNPB5hlitL4NPYq
8Jvqg9d+pFy4TpzzPiKnjsQ8ZVnVe2cpSfa7moxbsXLwiLxNfDUN9HBYaD63TVR+uZnH9XTqek+6
DSXyfo8+NbHrtVKk/fUHr8jjH5/p/SNeDZeIxdbEf3GDxVTt8VKK9ckMjp8790v5DnlOi68lCO2T
SXWzTk1F58KlVVNM4pR2QnGmuqnCMP8AKZx4der7VILpv9l0Do+n/e1sVVfY4U0/U+4Tky9mfGjm
7RpxUkAwoENAGgDADADADQQYAYAYAJsFGAGgDABSCDYBgBuwUYAYAYAYAbSIBQQbCjADaAFoA2gB
YAWJFSiFGX//0/bZ63x35VMAMAMAMCDQQYAYQGBRqwBqxQaAMANBBgBgBgBhAYAYAYAYAasAasUG
rAGgDADCAwAwAwAwA0AYAYEGgDADADVgoywBoAwA0wlCbFQZYA1YAyxAZYKNWAMANAGAGAGAGAGA
GAGAGAGAGWKgywBgBoAwAwAwAwAwAwA1YAywBlgo1YgMAMANAGWKgwA0AYAYAYAYAYAYAYAYAZa4
BrVANaoBqwBoAwAwAwAwAwAwINAGrAGrAGAGgowA2UGBBgBgBgBgBgBgBgBgBgBgBgUZYA3YoMsA
bsAZYAywBlgDdgDLEBlgDLAGWAMsAZYAywBpoASEGAGAGAGAGAGBRsqjADaQQKIDADADADADADYU
YUGAGAGACyINhRhQYAYAYAbAFxCgqCDYUKiQCig3EgFlBgAtEBtBQtBAoKFIAUALTANgC0AKQUEQ
AtEApMAWFC0ALTAFpgBERQtACkwBayACACkFC0QC0UCkwBZFC07gCkwBYAtMAUFC07gCk7ACwDAD
ABadyA2AYUG07ACiA2AYAbTKBRAbAMAMuRRsA0AYVBgBgBgBgBgAlsIE3IowoMAMANBBgAlsijRQ
aCDQBgBhAabAElBoAwAwAwAy4QaIDVwDEygUFG07AC0yA2UC0yA2VQpMiBRVCk7EAoA2mFBEwAiY
ARMAImRQVMAImAETCgiYAVMgCJhQRMAKmFBUAETACJhQVABEAFTCgiIAiCgiACoAIgoWgBQBtACw
o2gBYAoKFIiDZVBCAS0AJKDADTRAJKDQAloIEhRlggQ0AaAEtAA2gAbVyoBtAAmggG0ADaABtBAN
oAG0ADaKgG0ACkggE0ACaKgG0ACaCATQANoAE0VANoAG0EA2rgCGigG0EAmgAbQAJoIBtAA2gAbQ
AhoIBtAA2gAbRUA2gAbQQDaABtBAloAQ0UCGgBDQAlq4AgAQ1YAQ1cIEACGgBLQAhoDRDRQIaABt
BAhoAG0AIaABtACGgAbRUagbQFIaABtACABLVwBIBpq4QI2AaaApDQBoAS0AIANNAWEBFJaAEgCW
igSAKiALIBYApBQRABohQaIAaIAWJFB4gBogDiJFB4gKcRCsnEQA8SKHEQBxEKHEQoPEgzTiIVB4
gDiIUHiQB4hQaIAeIEo8SKyPEANEKDxADxIoNEAPEKDxAyPEig0QA8QAqCgqACIgCIKCoAIgAiAC
IKCIA2QG0ALAMChSCBQUYAbANAGFQJZAJANFQIYANgA2ADYANhAOQACSAAyQQAkUAJIIAyAASRUA
JIABJAAZBAGSKAEkEDeSCBvJFA3kggbyRUAJIAbyRUDeSCAEkAN5IqAEkABkEAZIAE0ABaCAbABs
AQygQAaCDRAYAdm8CmhPl+OliZLycPDL787perW9Rzzr1fR8d3fuFZ8KGm/nvSlVp3hS+ij+Db/N
rdhrCajHVy7qOeHRwHSvBPoP550pTlJXhQXjZdcfN/mafUmc87qO/Rx3fgJTw0ac+ctIKhF3hh46
v4peVL/KutGcI118t3XuHIDo8wtPQjQX+0OkKGHavBy1p/cj5Uu9K3WyZXUdOnj3UdU8O2nPG1aO
Bi8oLxk1zllFdiu+qRjpx6PpGXoPPx0eMSGidGz0xiKeHp+dUnGK7Xa/ZtYvhrGbuh6L8NGkYaGw
GH0bRyUrXX/G6SSSfW7fws44e97OvdTQ8wnd4RuEHUaSV28kgD1X0ukugXR2GDi7VakVSy+tPyqr
6vOXajzzzX0M/sY6HlI7vnhVgg9W9ForoD0dli5K1WpF1V96do013ara5s4XzX0MPsY7HlSUnN3e
be1nd88asFHpvwLaLhojBYjSVbJSuk+FOmryfa7/AMJxzu/D3dCamx5401pSemsTVxM/OqzlLqu8
l2LJHWTTx5Xd2IwrI7j4DtA/LMXUxkl5NCNo/fnl6o3v1o5516vo+O7v3CleErT3+0Gk604u9Om/
Fw6oZNrk3d9prGajn1cu6ihmnEX7wZ6A/wBoNJ0oSV6dN+Mn1Q2Ltdl1MzldR26WPdRcvDhp75dj
IYOL8mhG8vvzz9Ubd7M4R1+kZbuvcOI6p0eQSWh9Fz0xiKWHp+dUnGK5Xe3qW1ktaxm7oeivDHpK
GhMBQ0bRyU7XXCnTtZPrdv4WcsJvy9vXvbNDzKdngGAHqvE/8676Oavm16kbc/GVdvbFX/hOHtV9
C/yeI8qHd88YAenfBHo6HR3RtbSVfLXUpX/43Tvs63frsjjnd3T39Gds2POOlNIT0tXqYip59Scp
Ptd7dS2I7Tw8Vu/IYBkdt8COgPl2Mni5LyKEbR+/PL1K/ejnnXq+j47u/cKl4TdP/wC0Gkqsou9O
l9FDqjtfbK76rGsZqOfVy7qOfmnEWzoPoD/aTSFHDtXhra1T7kc337OtomV06dPHuuh1Tw56f8ZU
o4CDygvGTXN5RXYrv8SOfTj0fSMvQefzq8YLQoSxM404K8pNKKW9t2SCzyPUfTitHoJoKngab+kq
RVK633zqy6ndr8SOOPmvf1PsY6HmDB/vYfej7Ts8EGR/dS+9H2SAPU/g7wUOieiZ4+rlKrGM/wAK
iowj2u7X3kcMvNfQ6U7cdjzBicVPH+Nq1Hec6ilJ8W9Zs7aeC3Yb1/Nh91/4pFQdy8DnR75Zjq2N
mvJouUYffle/dG/8SOWdevoY7u/cKR4QekH+0ekMRUi704RVOn92Mlmut3faaxmnLq5d1ookv3Uf
vS9kTbiLf0U0A+kuMwmHt5Di5VPuRnNy79i5tGLdOmGPdZB0vw46f1pUdH09kV4yaXF5QXYru3NG
MI7/AEjL0HG456RX/Nx/nOjzevzDHQ1N1KyUVeWpUaS4qEmvWWpiPUmlacfB/oD5MnatKlKN1t15
RbnLs2J/dOM+1Xvv2MdDy1o7yYV5cKXtnCPvO1eCDNH/ALrEP/jS/wCVtMhPX9+sHojwO6JhoDAV
tKV/JU07PhTp3bfa79eqjlnd+Hs6GPbNjhmM0rPTU8bi6nnVUuy9SEkupKNlyR14eW5b3f3yIvRv
k0MS+NOMe11YP2RZak9f36jpfgT0N85Y+dScb06VNO/CevFx/wALfYYzrt0Md0SfhN6RfO2OxFOD
vTwmHlBffnOEJv8Am1X90mM011ct2/dByLQK1J1J7o0K380HBeuSOlebH9KH3QfR8tJ6QpUoefLX
1b8VCTXrRMmunN0elummkafRijgdF0MlKpT1lv8AFUmpSvzlbt8o4zz5e7O9up+9DyTgqD0hXhDa
6k4rtk7e87vnSbB9O4j5bi69VenVqS75NiLld0Oulfk4ypD+71aX/JuKh/lEXPkb6R/RuhT+phqX
868b/nJDP9J/ZGtKLxOCwkPrKrV/in4v/nEIXifP9/wGL6HRj/47iY/8oqb/APnpfU9Pn+/zaZoX
6HC42pxpU6a651YS9kGhTHi/v1GdEV4vEup/dUa9TtjSnq/zWJTDn5X8hFaCwfzhi6FH+8q04fxS
SNVnGboTp3F/OOLr1v7yrOf8Um/eIZXdEp0y+jxMaX91Qw8O1Uoa38zZI1nz8p+Q3pf6HR+Cp/W8
fV/imqf/ADiEMuJ8/wB/wGsAvk+i8VP+8rYemupKpOX+GI9ScX4z9RnQv6KvVrf3WFxEl1unKEfX
JDIw/S/kILQuC+ccVQo7fGVYQ/ikl7y2sYzdB+lOM+ccfia26depJdTk2hIud3b8RKdMl4p4Sj/d
4OjdcHUvV/5yExXP0+E/sjVT9n0LFPbWxkn1qlTS9tVl9V/m/P8AT+kZ0O+ghjq26GDqK/OrKFK3
87JTD1+H9Ah+iuC+cdIYWjt169OL6nJX9Rq8M4TdnxDfpFjPnHGYivt8ZWqT/ik2JEyu78xPdN14
lYKj/d4Kjdc6mtVf+MmLefp8J/ZGUf2bQVRrbWxsI9apU5N+uoh6/I/m/P8AT+ka8Hv0OJrYj+4w
mJqLr8VKC9ckTI6fPwl/IUjD4d4qcacdspKK627G3KC2+EmusRpfF6uyFV011U0oL/CZx4dOrzQX
pF+zaI0bS2Ofyms196ooL1U8hOVy4nzGdEf2XAaUxG9YenSX/IWtC/qixfQw4vw/UQfQfBfOOlMH
S3SxFK/Vrpv1XLlwz05uz4iL6S4z5yx2Jr/3lapP+KTfvE8M5XdvxbWrp5+zYfRmHWyGBjU7a1Sc
/Y0yY+vxdOp6T7vzSOcGnFSWgBIBooE2ANAGAGAGAGAGggwAwAwA1YKNAG0AKAMAMAMAMAMANpEA
oINhRgBgApACgBSAFoAJEipRUijL/9T27Y9T4z8qmrAGFUaAMAMAMCDQQYAYQGAGrBRlgDVig0AY
AaCDADADCAwAwAwAwAwA1YATYoMANAGAGEBgBgBgBgBoAwAwINAGAGAGWChLQAkIMAMAMAMAMKgw
A0AZYA1YAywBliKNWANAGAGAGAGAGAGAGAGAGFBlgg0AYAYAYAYAYAYAYAYAasAZYKNWIDADQBli
oMAMANAGAGAGAGAGAGAGAGrAGtUA1YA0AYAYAYAYAYEGgDADVgDLAGWKDLAGWAMsAZYAywBuxAZY
AywBuwUZYAyxQYAbAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMABhBgBgBgBgBgUbKo2AbsRBsAwAwAw
AwAwA2FGFBgBgBgBtBAogNhRhQYAYAYAbQApBQVBAoKNxAFgGEAQoMAFIihQQKQUKQApACwDaAFg
G0ALAFoKFogFlAtEApBQtABEQC0wBaYULAFp3AFxYApBQRMAUmALAFJgC07EULAFJgCwBaYApOwU
LANp2AFp3AMAMAFJkAoAwoNgCk7kBsAwAy4ApMAUAYAYAYAYAYAYAYAaAEtgGgDADADADQQYAJbI
o0UGgg0AYAYQCWwBJQYAYAYAZcINEBq4BoqjQBgApMIFBRsAWncgNlAtMgFFUbTIgUVQpOxAKAFJ
hQRMAImAFTCgiZAETACJhQROwAVMAImRQWLACxACRYUFiwAkQoLEAImAEiwoKmAETIAkWFBYgBIs
KCIAUgDaACEUbRQLANhQtEQbKoWiA2AaauAJKDQBpogE7Cg0AaaCBAUYECGgDQAhoAG0ADaKgG0A
CaCAbQANoIBtAA2rgA2ioBtAA2gATQQCaABNFQCaABSQQDaABNFANoIBtAA2ggG0AIaKATQQDaAB
NAAmggG0AIaABtACGggG0ADaCAbRQDaABtBAhq4ANhAhoAS0UCGAIaAENXAEACGrACWggQAIaAEt
AWEMCkNFANoAQ0EA2gAbVwBDQANoAQ0BQ2io0G0AIaABtACQBLVwBIBpoIsIasBpoAS0AJAEtACA
DTQGiAgS0AJAEtFApEApACgBaChaACxCg0QA0SANEKDRADRAHESKDxAU4iFZOIgB4kUOIgDiIUHi
AOIkVmnEQqDxADxYAeJFB4gB4hQeIEo0WRWR4sAPEKDxYAaJFB4sAPFhQeLAyNFkAaIUGiwA8SKC
ooCIgCIKCxACRACRACRCgiAFEBsKFBkbDQ2ggWAYFGwDQBgQaZQIIDRUCZAA5AA5AA5AA2ADYQBk
gAEkEAZIoASAASQQBkEAJIoAyQACSCAMigBIIG8kAAkioG8kEDeSKBvJBA3kggBJFACSCBvJFQAk
gAEkEAmABkgATABMIBsAGygQ0QGig0AaIg9TdE4roL0eni5ZVakXVV/rTtGmurzX2s4XzX0MPsY7
HluUnNtvNvad3zwNoqj094KMFDozoqtpGsra+tP8FNOy629bryOGfm6e7oztmx5qx+MnpGrOtUd5
1JSlJ85O7O2nht2GgQejfAdoZYenX0hUyX7uLe5Lypvq83PkzlnXt+j4+o4d0o0y+kONrYp/2k24
8orKK7EkjrJp5c8u67FfKwO3+A/QPy3GTxcl5NCNo/fnl6o370cupXq+j47u/cKd4TNPfP8ApOtN
O8Kb8VDqhk32yu+01jNRz6uXdRQGrm3EdH8FGgPnzSlNyV6dH6WX4fNX8VuxMxndR36OPdRO+G3T
3zlj44aLvDDxs/vys5erVXWmTCeGuvlu69w4yjo8wsnRPQb6R46jhVsnNa3KKzk+5PtM26awx7ro
dr8Omm1SjQ0fTyS+kmluSvGC/wATt1HPCPX9Iy9B5zOrxBxhMLPG1IUqavOclGK4tuyQWTY9PeEv
FQ6HaFpaOpPyqiVPrjGznLtdk/vM44+a93VvZjoeWTs8AwA9XYD/AJ130cdTza9SOtz8ZVyj2xVr
/dZw9qvoT+TxHlO1zu+eN2APTvgg0bDo9o6vpKtkppu//G6d9nW79dkcc/Ph7+hO2bHnLSukZ6Xr
1MRU8+pOUn2u9upbEdZNPFbu7DArI7p4D+j/AMrxNTGzXk0Vqw+/Lb3Rv/EjnnXr+j47uxRPCLp/
/aLSVWpF3pwfi6f3Y5XXW7y7TWM1HHq5d1FGNOQvvg10B/tDpKlCSvTpvxk+qOxdrsupmcrqO3Sx
7qLn4b9P/LcXDBwfk0I3l9+efqjbvZnCOv0jLd17hxA6PKH+i9HT0vXp4en59Saiu12v1La+RLdL
Md+B6O8LmkIdHdG0dG0MtdRjb/jdO23rduuzOWHm7e3rXtmh5isdnhGWAPVmEX/LuOjrm/JxFSN+
fjKmztirX+6zh7Ve+fyeI8qbTu8A1YA9K+BjQ8NE4SvpOt5Kkmot7qcM5Pta/lOOd34e3oY6mxwL
T+lp6exVXFT21Jt24LcuxWXYdZ4eTLLuuxEWKyOteBzo987aQ8fNXp4Za343lBe2X4TnnXo6GO7v
3Bt4XNP/AD3pGVOLvTw68Wvvem+/L8KLhNROtl3X4DmeHl4qcZPYmn3M24QWPo5oCenMTHCLbOrF
Sa3RSk5PsSbM26bxx7rr7x3Hwv6ZjgY4XRtHyU3Cckt0Iu0F1XTf4Uc8J6vX18tag83xj9FL70fZ
I6vCMrRvGn93/NIA9XY5LwfaDlCL1a9RTz3+MqJyf8KWX3Ucfar6F/k8R5Roq0JvdZLtbT9iZ2fP
GSX0UfvS9kQD0x4JtEQ0Pgp6Sr+T9G0m91OLlOT7W/5Tlndvd0Zqbo4VpzHy07pWdWptnXS6kmop
diVjpJqPJle6/MQuj6njMRrvatef8KcvcWszkdE8DmgnpXSSrNfR4eLk/vNOMV7X+ExnXboY7vwE
r4VOkPzxjMRQg708NR1F991Keu/8vYyYzTXWy3fhP1g5JhF4uhXlxUId8lL/ACHR54JLo9oqemU8
PT8+rWo0+pPXk31LVu+SJWsZvx98Hf8AwuYyHR/RVPAYd6qk4Qa3+Lim13uKvxz4nLHzXs617ZqD
zfS8nB1PtVaVuyNS/tR1eH0/f3jKK1cHVf1qtJLqUajftiD0+f8AZHpXotRj4ONASxdRWrVI+Ms9
8pZU49mTa3Xkcr9qvdh/J47Hm7D1ZTw2Jqyd5TlTg29rcnKo/XTOrxTihGjPo8Pip8acILrlUjL2
QYJxf36jsvgK6O+Nq1dITXk014unf6zzk+xWX4jGden6Pj6in9IOkf8AtLpbEYpO9KlRrRp8oqnK
MWuuUtbtNSajlln3W37qKV0W8nG0p/3cnV/5Npz/AMpqueHIY6Gwny/FUaX95VhH+KSRKmM3QPSe
J+ccRVq7XUqSl/E2/eWJfNEh0syx1aG6nLxa6qaUF/hEaz5G+kv0cqFL+7w1H+ePjX65khn+k/sj
NKrxOCwdP63jqv8AFPxf/OIQviT5/v8AgMh9Bouf/HcTBdlKEm/+Vq9RfU9Pn+/zaZoL6HD42rwo
xguudWH+VSFMfEvw/UZ0NWpjYVf7mFWr/wAmqcpr1pEp0+RX8BhHjq1Okts5xivxNI0xJsSfSvFL
HY/E1F5sq1TV+7rO3qsSNZ3dvxDrpcvEzw9H+6wtFdTnHxr9dRiLn+k/sjMb+zaKw8N9WvXqPqjG
nCPr1x6l4nxozQa+T4HH1d7hSor8dRTfqpsUx4vy/P8AoGuga1NI0qj2UVUrPl4qEqn+UZHT5FRh
TdeSis5Sdl1s05i09PainpPERjmqc/FLqpJU1/hJjw6dTmhfSNfJ8Do+jv8AFVar/wCQlWSX8sIk
hl4k/fqM0X+y6IxlR/2tXD0l2a9SX+GJbyTi/IZ4PfosfGtuoUq1Z8vF0pSXrsTI6fPw3+QpNOm6
slGObbSXWzbmLj4RZqWlcRGOylKNJdVKKp/5TGPDp1eaFaeXybRWj6WzXeIrNfemqaf/ACjYnJlx
Pn+/4DOjH7No/SVff4qlRX/IWrFv1QZb6GPiW/D8ww6AYNY7S2Dg9nj4SfVB6z9SYy4TpzdnxFa0
pi3pCvVrPbUnKb/E2/eWeGLdi3+EH6CeDw/9zgcOmuEpp1X/AIyY/q6dTxqfdP7I1hf2Po/XktuI
xtKn2Uqcpv1zQ9fkcY/GjXgvXidJLEPZh6Nes/wUpNeuwy4Olzv3S/kOb2uacW3QvCr9FpSdBebh
6VCiv+QdKKfruYx4durz8Nfkkc4OjirCAQ0AaANFQasAasFGgDADADADADQQYAYAYAasFCgDADAD
ADZAbsEGwDYUYAYAbQAtAGFAtEApABIkVmjICP/V9vnrfGflU0AYRBqwUasAYVRoAwAwINAGBBhA
YAYAYAasFGrAGrFBgBoIMAMAMIDADADADADQBlgg1YoNWCjLAGgDCAwAwAwAwA0AYAYEGgDGADAM
AMAMAMAMAMAMAMAMAMKgwAwA0AZYAywBqwBliKNWAMANAGAGAGAGAGAGAGWKgwA0AYAYAYAYAYAY
AYAZYA1YAywUasQGAGioMANAGAGAGAGAGAGAGAGrBBrVANWANBRgBgBgBgBoIMAMCDAo3YAwAwAw
KMAMAMANlBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBhQYEGACZIASQGAGAGBRsKNlBuxEGwDADAD
ADADADYUYAYUGAGAGACiIFAGBRhQYAYAYAbChSIgJEoFhRiIAhQYALRAbKDaIoUECkFCwg2FC0Ab
AFoA2ALQAuIULQAtEApACwoWgBaYAtMAWiKFpgC07ACwBaAFJhQsAWmAKAFp3AFJkULAFp3AFJgC
0ALTAFBRsAUmAbAMANp2AFEBsAwoFJkAoAwAwA2mAKvcA2AYAYAYAaANawAm4BgBgBgBgBoIMAEt
kUaKDQBoIMAMIBLZQaANAGAGAGiINXANXKDQUYAYAYEGAG0wBdwDadgoWmAbTAFogFFUbTIgWVRt
MgFAC0woKmAETACJhQVMgCJgBEwoImAFTACpkUFTACJhQVMAImAETCgqACJgBUwoImQBUwoImAEQ
UFQAtAGygWjKjZQLQAoKFIiBRVC0QGygwA0QCWig0AZYgENWKDQBpoAQAYECGgDTABtAA2rAA2io
BNAA2rBANqwANoIBtAA2gAbRUA2gATQQCaABNFQCaABtAAmggE0ADaKgG0ADaCAbVgAbQAOSKgG0
ACaABtBAJoAG0AIaAENBANoAE0ADaKgQ0ADaABtBAhoAQECGgoQ0VAloAG1YAS0AIYAhqwAloIEN
ACGgBDQGiGgBDRQDaAENBANoAG0AIaABtACGgNQNoqKQ0ADaAENACQDTVwBFrAGgjRDQFaAEtACQ
BLVwBAFjTVwikAGmgBIBoAXEAUFCwBSACxCgsQA8SANEKCxADRADxChxEgU4iFZHiAOIkUOIgDiI
UHiAOIkVmjxAg8WFDiIAeJFB4gB4hQaJBKPEKyPEAPEKDRADxIA8QoNEAPEKlGiBB4sig0QA0WFB
ogBIgBEQBUFBEAEiAEQUEQAsIMI0FIIFAGwoWggwKNoA0AYEGioEkUJKg0wAbABsAGwAbABsIBSA
ASQQBkAAkigBIIASKAMkEAJAAZIIAyKAEkEAJIAbyRUDeSCBvJFA3kggBJADeSKgBJBACSKBvJBA
CSABSCALQAGSAByCAbABsAQwDTQQJKonui+hX0hxtHDLZOa1uUVnJ9iTJbpvDHuuh2rw4aaVCFDR
9PJfvJJbkvJgv8WXJHLCer0/SMvQedTq8QfaN0fPStanQp5zqSjFdbdv9RbpqTY9GeFzHw6PaMoa
No5a+rG3/G6aW3rer12Zxw83b29a9s0PMR3eEKp03VajFXbdklvbCD1N0vmugfR+GDg7VakVSy3u
XlVX1bV2o88819DP7GOh5WO754S0VR6s0Uv+Xd9HHWfk16kdfn4yplD+FWuuTOF+1Xvn8niPKTzO
7540QHqPwV4KHRTRFbSVZWdRSnz1IXUV1t3txujjn5unv6M7cdjzJj8ZPSNWdao7zqSlKT5yd2d4
8Nuw0CD0b4C9BKCr6QqZJLxcG/4pv/Cr9Zxzvo9v0fH1HGel+nH0kx1bE+jOT1OUFlH1JX5nSTTy
55d12K2Vgdh8C/R/510g8RJXp4aOt+OWUffLrSOedenoY7u/cIzwtdIPnzSc4xd6dBeKj1rzn33X
UkXCajPWy7r8BzE24C59AOj/APtLpGjRavTT16n3I5tPryj2mcrp16ePdR0vw5af+UV6WBg/JpLX
n96Xmrsjn+IxhHf6Rl6Dgp1eMP8ARej56Wr08PT8+pNRXW3a/VvYt0sm/A9H+FrSEOjejKOjaGWu
ox5+Lp22827deZxw83b3da9s0PMJ2eAYAeran/OuOjtvNxFSNufjau3tiv8ACcPar6H9t4jykd3z
xgB6f8E+jodGNGVtJV8vGJy5+Lp3tbm3fr8k453d09/RnbNjzhpPHz0tXqYip59STk+tu/dwOvDx
W7DKwQd08CHR75XiamNmvJorVh9+SzfZH/EjnnXq+j47uxQ/CJ0g/wBo9I1akXenB+Lp/djvXW7y
7TWM05dXLuoo5pyF58HXR7/aPSNKnJXpwfjKn3Y7n1u0e0zldOvSx7qL14bukHyvE08FB+TRWtP7
8lkuyP8AiZnCOv0jLd0OGnR5A80fgZ6TrQoU1edSSjFc27BqTY9J+E/HQ6J6JpaNoOzqJQ56kLOT
65O1+N2ccfNe3rXtx0PMB2eAYAeqej0F4OtASxM1atUj4yz+vPKnHsVm1u8o43zX0Mf5PHY8sTm6
rcpO7bu297Z2eAJCD0l4HtBLDyxOkauUbyhBvYknecvYr8pHLOvd0MeaOQ9J9OvpJpBYl7JyWquE
VNqK7kr87m5NPNnl3XYqcf3UvvR9kjTmOkeDPo78/wCPoOSvSoR8ZPhlN6q7XbLekzGV079LHuvw
E74XekXzlj1hYO8MPCd+c5RbfcrLk7kwjfXy3de4caj+6l96PskdHlEho7R09LVKOGp+fVnZfiaj
d9Vm3yI1JvwPQ3hV0jHo3o2joyhtqKMOfi4W285Oy5+UcsfPl7Ote2ag8+xaeOclsVVy7IybfqR1
eP1+YZaNWrKUtyp1PXFxXraKkHpnovRXg70DPFzX01SPjGn9aWVOPrV+F5HG/ar3YfyeOx5qjVlV
o1qkneU5wUm9r1teTffFHV4QiHkYWV/Sqwt+GMr/AOJA9B3rwH6Ei6dTGz9GbjG/FRV5dik12s55
16/o+PqOaeEDpC+ktR10/IdapGH3IRgovtvJ9bZvGacOpl3fiKhXWpg6S3yq1X2WppevWNOfp+Iu
vQbo5/tJUwtCS+j8bVq1f93BU0r9bvHtMZXTr08e7Xz/AEF98O2mddUMJB+TGUpTX2lGOr6pPvM4
R2+kZeg4dNeKwMf+OV5X/wCQcI2/5WM6PL6fP9/mC4ahKeDcIq8q2IhGKW1uEZZLtqRKTj439/mP
SHSqa8HPR+OFpP6WaVLWX1ppupLu1rcPJOM817c/5PHQ816L+iw2KnxhCmuuVSMvZCR1eKcUb0Cv
FrEVfqYef/KRql/zkFMfX4f0DXRdamJVT+6hVqdsKcpL1pLrFMOQ36OYZYvG0IS811Ya33dZX9Vy
0xm6GFepLSNaUtsqk2+2T/MM3yJPpZNVMdX1c4xqShH7sPIj6khGs+QvpR9HUo0f7rD0V2ygqkl3
zaEM/wBIM0svEYLB0vrKrW/jn4v2UkSGXiT5/v8AgNU18n0XN/32JguylCTa76ke5F9T0+f7/Npv
o/8AQUMZW+rh9RddSpCP+HXFMfX4BPQuKWPo1Hspa1Z/8gYup/lGR0+f36eRWqFGWLqRgs5Tkkut
uxWNbE90yrrEaRxLj5sasoR+7DyI+pIkazvmgvSleIp4Oh/d4WMn11ZSq37px7EIufp8P6Rk/wBm
0PFb6+Lb61Rppe2qx6n83438v6xnRhfJ6OOr/UwzguurOFP/AAuQph6/ANOhWFWM0lhYy83x0JS+
7F60vUmXJOnN2CAx+JeOqzqy2zlKT65O5YxbsWfp39Di40N1ChQpdsacXL+ZyM4unU5+En5DNIL5
JofCw31q9eq+qKhTj61MTkvjGfGjOi37LhdIYj6uHjSXXVqQX+FSLTDi37v1DHoRglj9J4Sm/Nda
Dl92L1pepMZJ05uz4iB0pjHpHEVa721Kkpv8Tb95YzbsWrp79BVw2H30MHh4tcJSj42XrmzOLfU9
J7pP7I1/xHoJ7niMau2NGn7L1fUPU/m/G/lP6Rng9XiMRXxO/D4TEVF95wdOPrmi5HT8XfulFHwm
GeMqQpR86clFdbdjTnrYtfhJxCxOl8Vq+bCp4tdVJKmv8JnHh06vm0H6QL5JofR1HY6ksTXkuuSp
xfdTYnJl7M+Y10M/ZMHpPE/VwqpLrr1IR9il2XGXoYeJb935isdFNH/OmkcLQ3VK9KL6nJX9Rbwx
hN2fFSumeP8AnTSWLrbVOvVa6tZ29VhJ4M7u34rFYaKwpJQYQCGrAGgDRQYEGAGrBQkAwAwAwAwA
0EGAGAGwowAwA2kQCggwqjZAYAYAYALQBsAwAIAKiAEiRWBQD//W9vnrfHflUwAwINAGEQYFGrAG
rFBoKMAMCDQBgQYQGAGAGAGAGgo1YA1YoNBBgBgBhAYAYAYAYAYAaAMCDQBlig1YKNAGEBgBgBgB
gBoAwIBgGgDADADADADADADADADADADADADADADCoMANAGAGWANWAMsAasRRgBoAwAwAwAwAwAwA
wqDLAGgDADADADADADADADLAGrBRqwBqwBgQYAaAMAMAMAMAMAMAMsECWgBIUYAYAYAYAYAYAYAY
AYAYAYAbKDADADADADADADADADADADADADADADADADCoMAMAMAMCjLXABkBgQYFGwo2UGyINgGAG
AGAGAGAGwowAwoMAMAMANoIFEQbDQwAwoMAMANgGwoUiIFIoFhRsAWgDYAqJAKKDCKFhBtBQtBBs
KFIAWAbQAsA2gBaCgiAFIgFlAtMgFIKFoAIQCkygWmRQsAWmALTChYQLQUKIBaKBSdgBYAtO5FCk
wBaAFJgCwBaYBsKMAFJkQKKowA2AKTIDYBhQbvYAUmQGwDADABSYAoAwAS5ACQDADADADADADQQY
AJbIo0UGAGgg0AYAJbChIQYAYAYAauRAm5QYFGgDADAg0AYAYQGyg2mALQUbTsALAFJgCiAUVQpM
gFFApMgFIAImFBEwAqYARMigiYAVMAImFBUwAiZFBYsAKmAFiwoImAEiwoJEALFgBYhQVMgCJhQR
MAImAFiwoIgBRQKRFCgBSAFoAUgBQUKiQCig2AaAMIBDRQaAMAENWANAGmgBABgQIasAJaABtAAm
ioBtAA2gAbQQDaABtBANqwANoAG0VAJoAG0EAmgATRUAmgATQQCaABtAA2ioBtAA2ggG0ADaABtF
QCaABtAAmggG0AIaABtAA2ggG0ADaCBDRQDaABtBANqwAhoIENACWgBDQAhooENWAENACWrgCGrA
CGggS1cAQ0BYQ0BSGgAbRQDaCBDQANqwAhqwANoAQ0BQ2gNBtFQIaABtWAEtXAEgGmrgCGrAWNBG
iWgBIBpoAQAJauAIA001cIEAGmgBIApACkFCwBaACIKCxADRIA0QoNEANEANEKHESCU4iFQeIA4i
FDiJAHiFDiIAeLIrNOIgQeIUHiAHiRQ4iAGiFB4sCUeJFZHiwA0WFB4gB4sANFkUHiwA0QqUaLII
PEKDRYAeIUGQARABEQBEFBUALQAVBQRACwg2RQpACkAYFC0EGwo2AYwDQBoqBLIDQBoqAYANgA2A
DYANhAOSAASAASRUAZIABJBACSAAyKgDJAAJIIAyQACSKgBJADeSCAEkUDeSCBvJFQAkgBvJFQAk
ggbyQACSKgBJAAZIIAyQAKSABMAE0ECGgAbKBJEGNAHoHwH6CUXWx9TJRXi4N/xTfsV+bOXUr2/R
8fUch6YacfSPHVsT6MpWh9yOUfUrvnc6YzTzZ5d12Kyacx2vwJ6A+XYueLkvJoRtH788vUr96OWd
er6Pju79wqPhL09/tBpKrKLvTp/Rw6o7X2u76mjWM1HPq5d1FAsbch07wS6A+etJQqSV6eHXjJfe
XmLvz/CzGd1Hfo47vwDzwy6f+ddIeIi7ww8dX8bzl7o9cSYTwvXy3de4ciNvMLf0E0B/tLpCjQav
C+tU+5HN9/m9bM5XUdOnj3XQ6d4c9P8AjqtLAQeVNeMmvtSyiuxXf4jPTj0fSMvQef7HV5BJ6E0V
PTmJpYan51Wajfhfa+xXb6iXwuM7roeh/DLpWGhMDQ0ZQyU1G64U6dlFdrt/CzjhN+Xs691NDzId
nhCqdGVeSjFXlJpJLe3sRVHqnphUj4P9AQwUHarUiqV1vcs6surauV0eefar35/yeOh5UO754wA9
W9G4LwedHpYqStWqR8ZZ/XnZU12LVbW7yjhftV9DD+Tx2PKs5Oo3Ju7bu2zu+fsasAem/A5omGg8
DX0nX8lTTs+FOndyfa7/AMKOOd34e7oY9s2PPWm9Kz03iauJqedUm5dSexdisl1HaTTx5XuuxFhk
dz8CHR75ZiamNmvJorVh9+Sz7o/4kc869f0fHd37hRvCP0h/2j0jVqRd6cH4un92O/td32msZqOX
Vy7qKKacR0HwZdHv9odJU4yV6dL6SfC0di7XZdVzOV1HbpY91Fs8NvSH5fi4YOD8igry+/LP1K3a
2jOEdevlu69w4mdHlEroTRM9OYmlhqfnVJqN+C3vsV2+SJbprGbuh6F8MOlYaEwNDRlDJSSuuFOn
ZRXa7fws5YTfl7OvlqaHmg7PANpa2S2gHqnHNeDfo+qayxFSOrz8ZU85/hV7P7KOHtV9C/yeI8qn
d88YAenfBZo+HRbRdbSVdWdROXPxcL2S5yd+vyTjn5unv6M7ZsecdJ6QnpavUxFR3nUk5Ptd7dS2
Lkdp4eK3fkMAyO4eBLo78txM8bNeTRWrD78ln3R/xI5516/o+O7v3CleEfpF/tHpGpOLvTp/R0+G
rHa+13fU0axmo5dXLuoohpxFy6A9Hv8AabSFKi1emnr1PuRza7XaPaZyunXp491HSPDf0h8fWp4C
D8mmtep95ryV2LP8RjCO/wBIy9BwU6vGHODwk8dUhSpq85yUYri27ILJseo/CFiodENDLBUXadSO
plvV06ku1ys/vHDHzXv6t7MdDzLSynRW9at+2Ta9TR2eENo/upfej7JBB6k6C4aPQvQrxlVJVKkd
fPfdtUo9utf8TOOXmvodOdmOx5lq4qWNq1a8neUteTvvc3b/ADXO2ng3vyGq8mk+clbsTv7UEHef
Av0d8fUePmvJpQcKf3m5az7I5fiOedezoY+ooPTDTr6R6ZdTbThVjTgvsxlb1u8u01JqOOeXdkKX
o53nJv8Au6t+2EjVcoLj4Nuj/wDtHjHRkvo9VSn92M4ya7bW7TGV069LHuo6P4atPKvFYKDypSpy
n1yjNpdiSf4kZwjt18vQcIktTCq3p1Xf8EVb/Gzq8noDfJp4ijQowV51Kk3FLfrakF64sLoejume
Ij4PtBwwVJ/S1I+LTW++dWXra5ay4HGea9ud+rx0PNmkfIpYeP8Axtya5uc/conV4aN6U8inh4b1
Su+uU5yXqcRC+g9N+DzCUuimiFpCurPxLk/uKUpxS5y1l1+ScsvNe/pTtx39w85dKtJVNKTp1ar+
knCU59c6k5Ls1dVLkkdZHizuww0n9FQw0P8AjcpvrlOS/wAMYhL6Ds3gn6NfOE8PXmr06CqVlzqT
l4uPd4py5O3E55V6ejhvX3fv9BD+GLpCtNVYQg/Ip1KsVz1dWN/4tdc0kawmmevlscya8Ro//e1/
+VUP+hptw9Pn+X9YzCfQ4GvPfOpSprmvLnL1xj3kJx+A3of6Ghiqn/GowXXOpH/KpimPqN9G14up
Uq/3VCtLtcHCL/ilEUw/SgfRWkp46g5ZxhNVJfdp+XL1RYphyImhSlpKtGG2dSaXbJ/mXhnkP+k+
IWMxtecfNdWaj91O0fUkIud8hx0r+irQo/3NCjDt1FKX80pCLn+kG9Mfs+DwdLjGrWfXOep7KSfV
YkMuJ+/3wNU18m0XN762JhHspQk2u+pHuQ9SeJ8/3+bTOjn0FLGV/qYdwXXVnGH+Fy7i0x9fgB9C
6SnpChKWcacvGy6qSdR+qIyOnyK29bFz4znLvbZWORY+m1RT0hXjHONOSpLqpJU16okxb6nP79PA
V0kXybDYGhwoSqS66tSTX8qgIZcT4DMP+y6Iqy318TTh2UoSlL1zh3D1J4x+NGdDV4ieJxH9zha0
k+Epx8VH11EKYet+6/2BBaA0f864yhh/72rCH8Uki3wzjN3QX0nx/wA647EV1sqVqkl1OTt6hDO7
t+Il+mX7PHB4f+6wlNtfaquVZ9vlokaz9J939IymvkmhJvY8Ri4x640abb9dVdw9TjH438v6xroJ
+z1sRif+afCV5r70o+Lj65ouR0/f7pf7AqmjcE9JV6dCO2pOMF1yaXvLfDnJsTnTzGLH6UxU4+b4
6UY/dg9WPqSJjw31Lu0PelC+SYDRuH3+KqV3/wAhajS/lhEkXPxJ++Rro/8AseitI1tjn4ihF/fm
6kl3U8+sXkx4vyn7/ANPB3hFjNLYRS82NVVJdVO9R+qJcuDpTdgqWPxTx9WpVltqTlJ9cncrnbsX
Pwifs9XC4bfh8Fh4SXCUo+Nl65kxdOr6fdJ/ZGsN+w9H60t+JxlOn1xo05TfrnEepxj8aEeC6Pit
JwxD83DUq9d/8g6UmvXYZcHS537t/kObt62bNOLbQAhqwBooMauQAwDADADCg0EGAGrBRoA0AYAY
AYAaCDaCjdgBQQYAbIowAwAwAwAUkAKAMKDaIBYAqIEokQMioij/1/b563x35VMAMAMAMCDQBhEG
AGgo1YAwqjQBgQZYA0AYRBgBgBgBgBgBoKNWANWKg0AYAYQGAGAGAGAGAGAGrAGBBoAyxQasFGrE
BgBgBgBgAloINWAM1QDWqAasAYAaAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMKgwA0AYAYAZYA1YAyw
BliKNWAMANAGAGAGAGWKgwA0AYAYAYAYAYAYAYAZYA1YA1YA1YAwA0AYAYAYAYAYAZYINWAE2ANB
RgBgBgBgBgBsoMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMsUG7AGWAMAMAMCjADADABEkECSA2FG
yg2RBsAwAwAwAwAwA2FGAGFBgBgBgBsINkBsA2FGFBgBgBgBsA2RQoINlARAGwoVEAUAbRALKDAB
aIo2EG0FCwg2goWgDYAQAwAWALTChaAFJkAtACwoWmALTAFIAIiKFpgClkALACJgCkFC0AKTAFgC
0wBSdiKFgCkwBYApMAUgoXcINhRgBtMiBdwowoMAFJkAoAwAwoFJkAoAwAwA2nYA1e4BgBgBgBgB
gBoAwINNgCbhRgBoAwINAGACWyKNFQaAMAMANNkQJuVRoAwAwAwINAGEBq5QaANpgCgDaYAsKNp2
AFgCkwoURAoqhSZAKKBSdyAWmAFTCgiYARMKCpkARMAKgoKmAETIAqYUFTACJhQVABEwAiYUFQAV
MKCpgBEQBEwoKmAEQUFQAsA2gBYUKQAtAG0ALCjaAFgG0FGAGggwgEtFUJCDABLQAkA01cAQAYAI
asECGgAckACaKgG0ADaCAbVwAbQQCaAENAA2ggE0UA2gATQQCaKgE0ACaAByQQCaABtFAJoIBtAC
GggG0ADaABNFQDaABNAA2ggG0QCGgAbRQDaCAbQANoIENFANoIBtACGgAbVgBLRUCGiAQ0AJaKBF
gBDQAlq4AMAS1YIENACGBohoAQ0UA2gAbQQIaABtACGgAbQAhoDUDaAobRUCGgBABpq4AhqwBoAS
1YDRIFaaCBABpoAQAJauAhAGmmrhAgA00AbKBSIoWgBaAFIKDRADRIA0QAqCgyADRAHESKlHiBDi
IUOIhQeJAOIhQ4iAGiFZpxEgg8WFB4sAcRIoPEAPEANEKHESDA0QoPEAPEKDRADxIoNEAPEKUaIG
Rosig8QA0QA0QoKgAiIAiCgqAFoAKgAiCgiANkBtACwDAoUggUFGAGwDQBgQJZQJZAaKgQwAbABs
AGwAbCAcgAMkAAkEAJIoAyQQAkgAMkEAZIoASQAGSCAEkUAJBACSCBvJFA3kggbyRQAkggBJBA3k
igBJBA3kioASQAGSAAtBAKSAAyAByCAbAEMAQECqdN1pKMVeTaSS3tgHqLpVUXQHQMcJB2q1I+Lu
vrSzqS9qXC6OE+1X0M/5PHQ8sNHoeAYAeqKH/OuOj2t5tepG/PxtTZ2xX+FnD2q9/wDbeI8q7Ts+
eMAPUnQLDx6D6DqY+qvLqRdWz3rZTj23uvvHHLzX0OnOzHY8v4nESxc5VJu85tyk+Lbu2d3hvkAD
I9L+BrRMNDYKvpOv5Kkmk3up085Pta/lOGd34e7oY6mx5907paencVVxM/OqTcrcFuXYrLsOsmnj
yy7rsRNjTI734Dejvjq1XHzXk014um/tSV5PsWX4jl1L6PZ9Hx9RzLp90g/2m0jVrp3pp6lP7kck
+3OXabxmo4dTLuoppXIdY8D3R3560iq0lenhlrv7+yC77y/CYzuno6GO78Bnhh6RfPWkXRg708Mt
Rff2zffaP4RhNQ6+W78Byixt5xb+gvR7/abSFLDtXhfWqfcjm+/zetozldOnTx7rodT8OXSDxlSl
o+D8mC8ZUS+s1aK7Fd/iRjCPR9Iy9BwA6vGH+itHT0vXp4ennOpJRXa9vUtr5E4ak34HpDwsaRh0
Z0ZR0ZQy10o8/F07Xvzbt1+UcsJu7e3rXtmoPMB2eAbS1skAerMZ/wA626PKmvJxFSOrz8bU85/h
V7fdRw9qvoX+TxHlOx3eAbsAeovBpgYdDtEVdI11aVROpz1I5Qj+J3a46yOGV3Xv6U7MdjzTj8ZP
SVWdao7zqScpPm3dnZ4bdhqEHf8AwIdH1KdXSFReTBeLpt8XnN9isu1nLOvX9Hx9Ry3px0gfSbH1
cQn5F9Wn9yOS7/OfNs6YzTz9TLuuxUjTmOleCro78/aRhKSvSofSS4XXmrvz5pMxndPR0cO6/ATH
hl6RfOmNWFg/o8OrPnOWcu5WXJpkwjXXy3de4ceOjzCZ6PaGn0gxVLCw21JJN8Ftk+xXfYS3TeOP
ddDvXhk0xDROEo6MoeSpJOSW6nDKK7Wv5TlhN+Xr6+WpoebDs8QVGLm0krt7EAeqdIyXg10AqUcs
RUjq5bfGVFeT/Cr2f2UcPar33+TxHlWx3fPGWID034K9Gw6L6NraTxGTqJy5+LheyXOTv1+Sccru
6e7oztmx500tpGppivUxFTz6knJ9u7qWxcjtPDx3LfkR9isjtfgW6OfL8XLGTXkUFaPOcl7lftaZ
yzr1dDHd37hX/CX0h/2gxtZxf0dGUaUOqOtrPtld9SXAuM0x1c+6ijJWqp8IJrrULr2GnEWHoT0d
fSbFQw/oOcZVHwhFScu/YubRMrp06ePddDrHhh6QJVcPo6lkoyjOol3Qj2K7tziYwjv18vQefaC8
mf3V/iidXjBadCWIjCEFeUptJLa29VJBeR6g6STXQXQtPA0mlWqpUk19aX7yXrdnubRxnmvfn9jH
Q81UqirYmdRf8cmutKUkdXh9Q2watCs/sJd84+65Ug9HeDDR8OiOiqukq+TqJz56kb6qXOTba43i
ccvNe3ozsm6OAaZ0jU0rHx9R+XVrVZy7oW7FdpHWTTx5Xf4hhjPIo0Y7nGU+1ycfZBBKO0eCro18
4YqniKi8jC0Y251KjlOPdGV+T1TnlXq6OG7v3QVLwt6cemdJSgnenRjGELbHdKUn2t26kjWE059b
LdFF02tWtq/UhTg+uMIqXrTNxxyFiwWgZdI9KQwUd2pTm+EaUFGb/ldudkZ3qOkx7rodW8NWno4G
jR0XQtFWUppboRyhHvV/woxhPV6OvlrwOE9IPJxEof3ahTfXTgoP1pnSPJlyN6fg/lHi1tpwp07f
ajCMZfzXEMuR6fx2K/5dvoCK83EOnGCX/HZrP+HN9nM4+1Xvt+rx/fI8v6dep4ik9sKEL/8AIRur
/nO0eDL9P6RvS30NDC0/+Nym1znOX+WMBC+gzGrxOCw8N851avY9WC9cJd7BePxGrfJ9Hf77Eeqj
D/ob6uQPT5/l/WN6P+gwWJqfXdKj2Nuo/wDlWu9AnF+X7/gM6P8A0McTW/u8PNLrqtUrd02+pMVc
fX4f0DXRKOpjKdV7KKnW/wCTUXUXrikKmHIi9E4J6UxNKhvq1IQ/iaXvLfCSboXp7GrSeLrVlsqV
JyXU5Nr1CGV3RIdL/osT4ndQpUqXbCEVP+bWYi58/DQzTf7PhMHR3+LqVn11JuK/lpxfaSGXEWNU
18l0VN76+JjHsowbfrqx7kPU4nxv5f1qzo3+z0sZiPqYdwX3qso07fwyn3Fpj637gHobh419IYfW
82E1Ul92mteXqixkdPkV2vUljKkpvOc5Nvm2ysXyLL04ko4+pSWygoUF/wAgYRpv1xbJi31Ofh4/
AZp9fJcDgaG9wq15LnUnqL+WnF9ohlxPx/f4DNHfsmisVU31qtGiupa1SXrjDvF5J4l+X9kZ0FXi
MW8Ruw9GtW7Y05an8ziMjp8790oqeDwssbVhSj505RiuuTsjVYk2LD06xMcXpLEuHmRqOnH7tPyI
+qKJjw11L5ocdJf2TBaPw+/xVStLrq1Gl/LCJIuXiSDNEL5HonG1djqzoUI98qsv8Ee8epPEvyn6
hHg7pr5zo1ZLyaGvXl1UYSqe2KLlwdPn4efwFLqTdeTk85Sd3zbK5i6eEX6HHvDrZhqVGguunTip
fzaxMXXqc692oMxy+RaDw8N+IxVWr+GlGNNeuUyeqXxj8bRroJ+zfLcU8vE4OrqvhKralHt8tlyX
p+N37r/YFO0TgHpTE0sOttWpCC/FJL3lrnJsTnhBxy0jpXF1F5vjpxj92D1I+pImPDXUu7fiH/Sf
9j0VozD7HKNevJf7ypqRfdT9YnLWXiSfGjXQ79jwOlMVvWGhQXXXqRT/AJYy7LjL0TDxLfu/Mc1a
NOTZJUGEAhqwBooNNEAgAwAwAwAwoNBBgBqwBqwUaAMAMANoAUAbIDADADADADABSQAoAwoMAFpE
BsAWiKyWiiCogP/Q9w2PU+M/KpqwBoqjADADADAg1YAwiDADAo1YA1YAwoNBRgQYAaCDCAwAwAwA
wAwA0FGrBBqxQaAMAMIDADADADADADADQBgQaAMsAasFGWANAGmAaCDADADADADLAGrAGaoBrVAN
WAMsAYAaAMAMAMAMAMAMAMAMAMAMAMAMAMKgwAwA0AYAYAZYA1YAywBqxFGAGgDADADCgywQaAMA
MAMAMAMAMAMANWANWANWAMANAGAGAGAGAGBBqwBqwAkKMANgGFBgBgBgBgBgBgBgBgBgBgBgBlgD
YUYAYAYUGAGAGAGAGAGAGAGAGAGAGNXABkBsAUEGAGAGAGAGAGAGwowAwAwoMAMANpBBsgNhBgUb
CjCgwAwAwA2FCkRBsoMAFxAFhQqIAoAxEAQoMAFIijZUCiKFBAoKFIIFBQtAGwBSAFBQRACkQCyg
UiAWgoWALQAtMKFkAtAC0wBSdgAgApMKFgCkwBWwAIswDaZFCwBaYApAC0AbvYKFphBsKMANpgCr
kQbKowAUmEGyKNgGAG0ygVcgNgGAGAGAGAGAGAGgg0AauFGgDADADQQaAMAEtkUaKg0AYAYAabIg
SVRoAwAwINAGAGrkBooNBRgQYAKTAFACkwBQUKTAFACkwBaANhQtMgNlAtMgCJhQRMAKmAFTIoIm
AFTACJhQVMAKmRQSLACxACxYUEiwAkQoLFgBUAETCgqZAEQUFRQETIAqYUEQBtABAo2gBYAoKFoI
NoKFgG0AKIBNiqNBBgAloihJUGACWgBIBpq4AgAwAQ0EA2gATVgAbRUA2gAbQQDaABNBAhoAG1cA
G0VAJoAE0EAmgATRUA2gATQQCaABtAAmioBtACGggG0ADaABSQQDaKATRADaKAbQAhoiAbRQDaCA
bQANoAG0VAhoAG0EA2rgCABDVgBLQQIaAENACWigQAIaAENXAEACGrBAloBCGgNBtACGigG0ADaC
BDQAhq4ANq4ANoAQ0BoNooobQQJaAEWANACGgDQAloI2SFGmggQ0AaaAEACWrgahLVgBLVwgQAYU
C0QC0FC0AKQASIUGiAGiQBohQaIAWIAeJFSnEQIcRCg8QBxEihxEKDxYAeIGacRIqDxADxCg8SAP
EKDxADxCg8QMDxIoPEANEKDRADxIoNEANEKDxYGRokAeLCg0QA8QoKgAiIAiCgiACRACRACxCgiI
BRQbIoUVkbI0NoIFgGBRsA0AYEGioEEUaKg1IAHIAHIAHIAGwAbCAMgAEgAMioASQAGSCAEkUAZI
IASQAGSCAEigBJBACSAG8kVACSCBvJFACSCBvJAAJIqBvJBACSAG8kVAGSABSCAMgAMkADauEA2A
DYAhlB1LwR9HvnnSCrSV6eHWu/vegu/yvwnPO6d+jhu/AK8L3SH540g6MXenh1qL77zm++0fwjCa
Ovlu/AcpNvOL14Oejv8AtFpGnCSvTp/SVOFo7F2uy6mzOV1HbpY91Fz8NnSH5biYYKD8mitaf35L
3Rt/EzPTjr18t3Q4edXlFh6J6CfSTG0cMtk5eW+EFnJ9ydudjNum8Me66HZ/Dbp1YeFHRtLJWU5p
bksoR9rtyic8J6vT9Iy9B52OrxB7ozR09LV6eHpq86klFdrtfqW18hvTUm/A9H+FbSEOi+i6OjKG
XjEo8/FwtdvnJ26/KOOE3dvb1r2zUHl87vAF04Oq1GKu27JLe2QHqjpDNeDro/HDRdq9SPi7r688
6j7FdJ7vJOE+1X0Mv5PHQ8pWPQ8A0EHqzotSj4OtATxdRWrVI+Ms/rSypx9ja3Xkee/ar6GH8njs
eVqlWVaTlJ3lJttva29rO754ywB6a8D+iYaAwFbSlfJTUrPhThm2utp9eqjjnd+Hu6GPbN0eetN6
WnpzE1cTU86pNytwW5dSVkuo6yaePLLuuxFFZHefAf0d+U16mPmvJpLUp/fkvKfZHL8Ryzr1/R8d
+RzzwhdIv9ptIVasXenF6lP7sd/a7y7TeM1HHq5d1FJNOQ6X4Kejnz/pGEpK9Kh9JLg2vNXa8+aT
MZ3Tv0cO6/ATfhm6RfOmNWFg708OrPnOWcu5WXJ3M4Rvr5buvcOOnR5RPdGNBy6R4ylhY+nLynwi
s5PsV+0l8N4Y910O4eGrTccDRo6Mo+SmlKaW6EcoR6rpv8KOeE9Xr6+WvA84nZ4QWhQlipxpwV5S
ajFLe27JBZ5HqLpfWj4PtBQwVN/S1I+Lut7lnUl62lwujhPtV78/5PHQ8snd4BgB6m6GYePQDQc8
bVX0tSPjLPffKlH1p8tZnDLzXvw+xjseYcRXli5yqTd5zblJ8W3ds7PDbsBsEHofwKaAjh4VdJVb
JJOEG9yWc5exX5SOWd9Hs+j4+o470u08+kuNq4l+bKVoLhBZRXdm+bZ0k082eXdditlcx1DwTdHP
nzSEas1elh7TlwcvQXfn1RZjK6ejo491+AdeGHpF87475PB3p4dOPXN+c+zKPWmMIvXy3de4clNv
MJvo5oWfSLF0sLDbUkk3wis5PsV2S3TeGPddDunhk01DRWGo6MoeSpKLklupwygu1q/4TnhPV6+v
lqaHnA6vCNxi5tJK7eSQUeq8TH/l3Ogo0YtLEVfJT/47U85/hWx/ZXE4819C/wAnj948wVanjY1J
LfNPv1jq8AJ/af8AIP8A5xgHorwUaOh0d0bV0jiMtZSknvVOPD7zWzfaJyy817ejO2bo4PpjSc9M
Y2riKnnycpPk4xyS5K1lyR0nh5Mru7EJH93L70fZIrA7F4Iujfzpio4qa+jw8brg6kpSS7kr8mom
Mq9PQw3d+4RvhD6R/Pulkou9LDPVj+Dypvtat1JFxmonVz7svgOa4LyY1Zb1Ty7ZRi/U2acILH0R
0DLpHUjho5KpVhrPhCKk5vsVu1olum8Me7x94654adNRwNCjo2jaMWlKcVuhHKEeq+f4UYwj09fL
XgcDx61YUY71Tz/FKUl6mjo8dG9J03KpGnFXtCmklxcU2v4mxCj1PpeougGh1Spf8UVFGnBra6kk
o3/DFZP7K4nGea+hl/J4jy7iKa0pjnCL8mpW1Yvk5WXqOzwXzfmNUraYxybyjVrXfJSln6mODm/M
eh/BJodYelX0tiPJlXctVvdBO8n2v/CuJyzvo9nRx/nX1HCMZpGXS3SfjquytWjdfVhdK3ZH2HXW
o8tvffmIjCxemsZFT/tqq1n96Wb9Y4Znm/MdG8GmhH0t0tLFVF9FSm60uDlJtwXfn1RaM5XUdulj
3ZbBvC90gfSDSEcHSd4UHqK2+pK2t3ZR5NPiMJpetl3XXuHMukNRVsXW1M4qbjH7sfJj6kjUcMuQ
TpN5GKnT/ulCl/yaioP1xbEM+RvpF9FOlR/uqNOPU5R8ZJdkpyQhl+g3pn6CjhaO9UnOXXUlJr+T
UEMvQZjV8nwFCG+pOrVfOPk049zjPvC3gapL5No6b31q8IrqpRcpLvnB9gPT5jehv2fDYut/xuNK
P3qk0/8ADCaFMeKM6KrxVeVfdQpVan4lBqH87iKYc/AMOj2BWkcZQpS82VSKlyjfyn2K7LUxm6Gm
k8Y9KYirWfnVakp9sm37xPDNu6Jfpj5GMnSWyhGFHtpQUH3tN9pMWs+fh4G9P/s2GwdDeqUqsvvV
Zu38kYFi5cRqNRXyTRUnvxGJS/DRg2+y9VdqJ6pxPjfy/rGujP7NSxmI+ph5Qj96tJU/8MpvsLVx
9b935+A36HYWOL0hh4z8yNRTn92n5cvVFjJnDkQOMxEsdVnVlnKpJyfXJ3Kl8iydOX4vGyoLZh4U
6HbTgoy/mUn2kxa6nPw8DNML5Ho3BUdjqOtXkvvSVKP/ACrdusTky8SfO/p+g1oT9j0djq+xz8Th
4v78vGS9VLPrF5MfEvyn7/AI6BUl840qsl5FDXry6qMXU9sUi5cHT5+Hn8BUZSliZtvOUn3tlc+R
bfCC1HSE6MfNw8KdBf8AIKEYP+ZNmcXTqc/DwN6V/YtEYOlvrVa9eXUtWlH/AAT7x6rfGM+d/Qb6
Kr5JhNIYn6uHVGPXWnFf4VMUw8S37vzET0N0f86aSwtF+bKtDW+6neXqTLlwzhN2fERmnsf87Yuv
iP72rOf8Um/eWeGcru7Fm6cfssMDhVl4nB03JcJ1nKrL/GjOLp1PSfd+fkawH7BoPFVN+IxNGiuq
mpVJetw9Q9SeMb99n9kD8GtJLSdKtJeRh41K8uqlCU160hlwnS5+HkUKrN1pOUs2223zZtzovfhN
/Z8bDC7sLh6FDtjTTl/NKV+ZnF16vOvdINP+r+j3CWKxvfChT/4VT1E9TjH438hzZm3BqENBVJKg
wgENWANFAlogEgGAGAGAGAGAGioMANWANWCjQBtEAsAwAwAwAwAwAUkAKAMKDADaIBZAYaGaIZVC
0UBEQH//0fcZ63xn5VNWIDQBqwBhQaCjADADAg1YAwiDADADADQUZYA0UGgowINBBhAYAYAYAYAY
AYAasAasUGrAGgDADCAwAwAwAwAwA0AYEGAGgDABLQAkAwAwAwAwAwAwAwAwAwAwAwAyxQasAZYA
1YAywBqxAaAMAMAMAMAMAMAMAMAMAMAMAMKgwA0AYAYAYAZYA1YAyxAasFGAGgDADLFQYAaAMAMA
MAMAMAMANWANaoBqwBoAwAwAwAwAwINAGrAGWAMsAZYoMsAZYKM1QDLAGWAMsFGAGAGAGAGAGFBg
BgBgBgBgBgBgBgBgBgBgBgBgBgAloiDYBgBgBgBgBgBgBsKMAMAMKDADADdggURBgBgUbCjADCgw
AwA2AbRFCggwoMAFJ2ACBRuIAsAwgCFBgApEUbKg2RQtBBsKFIAWAbiALANp2AFgCkFC0ALRAKQA
sKFp3AFIAWiAIgoUgBYAsAWmFCgBaYAogFplApOwAsAWmRQpACwBSYAoA2FCkwgUFGAGwDdyIFBR
hQbuAKTIg2FGAGACrhAoKMAMAMANBBgBq4AkKMAMANAGBBoAwAS2RRoqDQBgBgAlsiDRVGgDADAg
0AYQCWyg0FGBBgBoqDCA2FCkwBQUKTCBQULTAFACkyKFFQbRFCwBSdgBaYAVMKCpgBEwoKmQBEwA
qCgqYAVMgCJhQVMAImFBUAETACphQVMAImFBYgBEQBYhQWIASLCgsQBRQLRlRtFARAGwoWiINlUE
IDaKBZAYAJYUaKg0AJaIDRQaAEtACQDTVwBABpq4ANoIBtAA2ioBtAAmgAbQQIaABNBAhoAG0ACk
ioBSQAOSCATQAJoqATQAJoIBtAAmgAbRUA2gBDQQDaABtAAmggE0ADaABtFQDaAENEANooBtBANo
AG0EA2igQ0EA2gBDQAhq4AhqwAhoIEtACGgBDRQIAENWAEtACGrgCAgQ0BqENAA2gBDRQDaAENBA
NoAQ0ADaABtAUhoDQbRUCGgBLQAhoA0AJaAEgWNNBGiQoS0ECADTQAiwBpq4GiGrACWrhAmwAsAW
goUALQAuIUGiAGRAFiFBogBogBohUpxEghxEKDxAHESKDxADxChxECUeJFZHiAOIhQeLADxZFB4g
B4hQeIGB4kUGiAGiwoPFgBokAeLCg0QA0WFZHiyANFhQeLADRYAaIUEiQBEAEQUEQARABEFBEQBC
oMI0FoINgGBQtBBsKNoAwA0AaKyEsihIQYygGwAbABsAEwBDAAyQQBkgAEkVAGSAASCAMkAAkVAG
SAAyCAEkABkVA3kgBvJFQAkgAEkEDeSKgBJAAJIqBvJBA3kgAEkVACQAKSCAMkACkgATAByQQDYA
hlB6j6NUo+DzQUsVUVq1SPjLP60sqcezJtbvKOF+1X0MP5PHY8uVakq0nKTvKTbbe9vazs+fQMIP
T3g0wEOiGiaukq6s6ic+epHzEucndrjeJxy83T39KdmO6PNukcbPSladeo7zqScpdbdztPDxW7DE
qD0f4GNCR0bh62k63kppxi3uhDOcuptW/CzjnfR7ehjqbHC+kumpdIsXVxUv7STaXCKyiuxJI6Sa
eTPLuuxBFYHd/Aj0d+U16mPmvJpLUp/fkvKfZHL8Ryzr2fR8fUc88IXSL/abSFWrF3pxepT+7Hf2
u8u06YzUcepl3UUk05Dqvgg6OfPWkFWmr08MlN8Nf0F33l+E553Tv0MN34BXhg6R/POkHQg708Mn
BfffnvvtH8Iwmjr5bvwHJjbzi49Aujn+0+kKVBq9NPXqfcjm125R7SZXUdenj3UdL8OXSLx1Wno+
m/JprXqJfWa8ldiz/EjHTnq7/SMvQefzq8YmNB6Knp3E0sNT86pJR6lvfUldvkjNumsce66Hofwv
aVh0ewFHRdDLXUU1wpwta/W0s99mcsJvy9vXvbNQeZDs8AJSpSrSUYq8pNJJb29iAPVHSGpHwb6A
jhoO1epHUut8551Jdiuk93knCfar6GX8njoeUzu+eFJBR6p6G4ePg+0HPG1V9LUj4yz33ypR9afL
WfA4X7Ve/CfV47Hl7EYiWLnKpN3nNuUm97bu2dtPBbsBKg9H+BfQcdH0K2k63kppxg3uhHOcu9W/
CzjnfR7uhjqbHDuk+nJdI8ZVxUvTl5K4RWUV2K3adZNPJnl3XYgSsDsXga6OfOmNeKmvo8OrrnOX
m9yu+Tsc869XQw3d+4RPhV6R/P8ApGUYu9Kh9HHg2vOfa8uaSLhNM9bLuvwHNDbiLh0G6OPpPj6V
Br6NPWqfcjt78o9bM5XTfTx7rodQ8NvSFTnS0fTfkwtOolxatFdiu+1HPCO/0jL0HAjs8YeaPwM9
J1YUaavOpJRiubdgsmx6U8ImNh0L0RT0dQflVI+L56qzqS/E3Z/efA4Y+a9/VvZjqDy+d3gGWAPV
GgaUfBvoKWImrV6kdez+vPKEexWut3lHC/ar34/yeOx5bq1JV5OcneUm229rb2s7vAB2APRngZ0F
HAUK2k63kppxg3uhHOcu9W/C+Jxzvo9vQx15HE+lGnJdJMZVxUtk5eSuEVlFd23ndnSTTy55d12K
/Y0wOqeCTo38949Vpq9LD2m+Dn6C7/K/Cc87p6Ojhu/APPCl0j+edJwoQd6WHko9c21rvsyj2PiM
ZqL1st3XuHKErU3zkrdid/ajbzCydH9CT6QY75NDJt6t/qxTUZPsjft5kvh0xx7rodk8MGmY6Kwt
HReHyUlFyit1OOUI9rX8vM54Tfl6evlqag8/z/eVZLdret6vvOrxgGo3TiltlJ9tkre194B6qk14
OdCQh5teerHLb42ptf4Vd/h5nD2q+h/beI8uYabnKpUe1Qk3+Lyf81zu+fAmktWhN73OC7LSb9aX
qAPRvgl0ZDQmj56QxFop68lLhTVtbvcPUuJxz8vb0Z2zdHDOmGmJ6dxXj6nnSinbgpXnFdkZJdh0
k08ud7qI7HUHiMV4lbU4Uu2KUPcVm8jpfgz0AukmlJ4uS+hozdTrk29Rdnndi4mMrqO/Sx7rv3A/
hC6S/POlo04O9LB6zXBzgnOfrio9nMYzUXq57y+A5ToZalV1P7uE534NRer/ADapuvPiJfoPoeen
MbGjDa4zu/q3Wrrfhck+wlumunjujv8A4RtMU+j2DWj6GSVCTkuFNLxcO1zknf7L4nPGbezq5ds1
939A81aF+jlVq7qdGo+2a8Wu5zTOteHH9P6BvQa1J1Ku6nSqPtktSL/ilEUxHpvQOCXg40HOrJJV
3CVSV/7xryYvqyT534nG/ar34z6vEeZdAVHPFxrTd3T16zb3unF1M+tq3WztXgx5Aej9FYjF0lPO
CmpT+7HypepMUx5AcHRlprFQhJ+VWqpN85yzfrHCTzRrSld6WxVSpFZ1aknFfelkvcIW7ocdJ5qW
Mqxi7xptUovjGklTXqihFz5C+kv0VWnR/uaNOHVJx15r+OUhDL9BvTP7Ph8LR4U5VZfeqSdv5IwY
i5eJBrEL5Lo6nHfWrTm/u04qMX3yqLsB6fMZo/8AZcBiam+pKlRXVd1Jd2pG/WCeJf394zoyvEPE
Yj+5w9Rr71S1KPanUuuq4ph7/u/oDfopho4nHUVPzIz15/cp+XL+WLLUw80RNapPSdZy2zqTb65S
fxY4ZvkTHTGop46rCLvGk40Y8LUoqmrdercYtZ8/v0BOkf7NQweH+rQ8ZL71aTmv5NQRcvSfd+bT
VvkeieDxGJ/loQ9jdXvjyJ6pxPjfy/rGdGF8lpYzE/3eHlCP3qzVP/DKb7C1cfW/d+fgNOiGDjjs
fh4T8xVFKf3IeXL+VMVnCbohNI4uWka1StLzqk5TfXJtv2lS3YsfTn6HFrD7sNSpUfxQgtf+dyJi
11Ode7QzSS+RaKwtLfXq1q76o2pQ9cZ94nmrfEnzv6DOjf7Hg8fid/ioUY9daav/ACQmKmPiW/L8
Qz6EYKON0lhoz8yNRTn92n5cvVFlyvg6c3YK/pDGS0hWqVpedUnKb65Nt+0utMW7Fp6er5PiKWF/
5psNRpP72rrz/mnIzi6dTnXukGVf2DQkFslisVKXXChBRX81R9w9TjH438v6xnQVfJZ4nF/80+Er
Si/tzXio+ud+wU6fjd90v9gVDRmBek69KhHzqs4wXXJpe81XOTYnun2NWkNKYqcfMVVwj92n5EfV
FEx4a6l3aH3ST9h0Zo7DbHONbESX+8nqQf8ADT9ZJy1l4knxv7/AJ6J/sOB0lit6oQoR6681f+WM
hfQw8S37tfiIHofoz540jhaFrqdaCl93WTl6rlt0xhN2QNOlOkvnnHYjE7VVrVJLqcnb1WLJoyu6
LH01XyLB6Mwn1MM6z68RNy/wqPZYk9W8/Ek+78xzeSNOLUIApDQBoqDGrkAMAwoE2AE2IDADADAD
ADADADRUGAGrAGrBQtEBgBgBgBgApIAUAYUGAGAC0iA2BnbaAhYULQAQgP/S9xnrfGflUwAwgNWA
MANWANWANFUYAYAYEGrEBgBgQYAYAYAasFGWANFBoA0AYRBgBgBgBgBgBgBgBqwBqxQasAaAMIDA
DADADADADADQBgQJYAkAwA0AYAYAYAYAYAYAYAYAYAYAYAYAYAYAYUGWCDVgDVgDLBRqxAZYAwA0
AYAYAYAYAYAYAYAYAYUGBBgBoAwAwAwAywBqwBqxFGAGgDCgwINAGAGAGAGAGAGAGrAGrAGgDQBg
BgBgBgQYAYFGAGAGAGAGAGAGAGAGwDCgwIMAMAMAMAMAMAMAMAMAMAMANBRgBgBsA1YA00AJAMAM
AMAMAMANhRgBgBhQYAYAKsRBsIMAMCjYUYAYAYUGAGAG0ALRAYAYUGAGABVmFCogCwDCAWUGwDaI
oUVBtEUKQApACkAKANoAIAYALQApBQsAWiAUUC0RQpACwBaIBaKoWQC0AKTAFgC0wBSChaYApMgF
lApMAURQtO4ApMAWALTAFBRgAq4QbANhRgAq5EGwo2UGACkyINhRsAwA2mAKuEGAGACbgGgowAwA
wA0AaCDADABNwo0AaCDADADTYAkA0AYAYEGgDVwDQUaAMCDRUGAGEBhFGFBtAC0wDYULTCDYULTu
QCigUmQCiqFJkAsoFJkAVMKCJgBUwAqZFBEwAqYARMKCxACpkUFiwAkQAqYUEiwAqCgqYARMKCpg
BUQBEFBUwAiCgqYAQAUgoUALQAoAWiA2VQtEBsoFogFFBogEtBRooNBBpoihJQaCBLQBoA01cARa
wAhoAG0EA2gAbRUA2gATQQDaABtBANoAQ1YAG0VAJoAE0EAmgATRUAmgATQANoIBNAA2ioBtACGg
AbQQDaABNAAmggG0ADaABtBANoAQ0ADaKgG0ADaABtBAhooBtBANqwAhoAS1cAQ0AIaCBLRQIaIB
DRQIaAEACGgBDVwBIQIasBoNoAQ0ADaKBDQANoIBtWAENAA2gAbQGoQ0BQ2ioEBRpoIEtACQDTQA
gDTTVwikgCWgBABpoAQ0AjQGiGrAGggwAWgoWgBaAFRCgsQAyIA0QoLEAMgA0QqU4iQQeIUOIsAP
EKHESAPEKDxAlHiFZOIkAeIUHiAHiRQ4iwA0QoPEDI8SKg0QA8QA0QoPEgDRCg0WAHiFSjRIIPEK
DRADRCg8QAiIAiACIKCIAIgAgAVBQsINkUKQApAGBQpBAoKMANsA0AYVAlkAkA0VAgAGwAbABMAQ
wAUkEAZAAJIqAMkAAkggDJAAZIoASCAMkAAkEAZIoASQQN5IIASRQN5IIASRQAkggbyQQAkigbyQ
QAkioANAAZIAFJBAGSAAtACGEA2AW/oF0d/2lx9Ok1enF69T7sd3a7R7TOV069PDuo6B4bOkXyit
TwEH5NJa9T7zXkrsWf4jPTnq7dfL0HCTq8gn+i+gpdJMZSw0dk5eU+EVnJ92znZGbdN4Y910O1eG
fTkcDRo6Mo5KylNLdCOUI96v+FHLCer09fLXgedDs8Qf6L0bPTFenh6avOpJRXbvfJbXyFumsZvw
PRnhQ0jT6KaLpaMoOzqRUOfi4W1m+cnZPjeRxwm7t7ure2aHmI7vAF0qMq8lCKvKTSSW1t5JEND1
J0jqx8HGgY4Wm0q1SPi7rfKedSXYrpPd5Jwn2q9+X8njoeVju+eNNFUeq9B014NdAyxE0lXqR17P
brzyhHsVrrlI4X7VfQx/k8R5VqVHVk5Sd222297Z3fPAyIPUHgs0ZT6KaMq6TxCs6kXLn4uF7Jc5
O9uPknHO7unv6M7ZujzfpbSU9M16mIqvy6knJ9u7qWxcjtPDxW7uxGlQehvAf0dUfG6Sq5RinCm3
3zl2Kyv9449S+j2fR8fUcm6a9IX0nx1XEeg3q01whHKPftfNs6YzTzdTLuuxVCuY674HOjfzxj/l
E1enhrS65vzF2Zy60uJjO6enoYbu/cG3hb6R/PukHSg70sPeEeDl6b7/ACfwjCaidbLuvwHLrGnA
XHoJ0cfSjH06DV6aevU+5Hb35R62ZyunTp491HTfDd0iVSpT0fTfk07TqJfWa8ldiz/EuBnCerv9
Iy9BwI6vGJHROjKmma9PD0ledSSiu3e+S2vkLdNYzd0PRvhR0lT6KaMpaMw7s6kVHn4uPnN85PLn
5Rxx83b29W9s1B5iOzwjaWtktoUeq5W8GGgbbMTNdvjai/yr/DzOHtV7/wC28R5VeebOz542Aem/
Bfo2n0U0ZV0niFZ1IuXPxcdiXOTzXHyTjl5unu6M7ZujzrpbSVTTNepiKmc6knJ9u5clsXI7SaeK
3uuxHlQd08CnRv5TWnj6i8ml5FP77Wb7Fl+Lkcs69fQx35FC8IPSP/abH1KsXelDyKf3Y7+13fU0
bxmnLq5d1FINOIvvg46N/wC0uPhGSvSp/SVOFlsXa7LqvwMZXTt0sO6i5eGnpJ8txEMDB+RR8qfO
clkuxeuTRnCOvXy3dDiB1eQSWiNF1NNYinh6Xn1JKK5X2t8ks3yRLdNYzd0PRHhQ0nT6K6NpaMw+
TqRUeapx2t85PLn5Ryxm7t7ete2ag8ynZ4Bu1wD1To+mvBloJ1JJLETWtZ/3k15MfwrauUuJwv2q
+hP5PEeYcPJ1KqnJ3d9Zt7cs2zs8EoxU3UhCK2ucku6IB6J8EuhoaPpYjStbKMtdQb3U4u8pdrVv
wvics76Pb0cdeRxrpFpuXSHH/KZ+lJNLhG94rsja/O7Okmnlyy7rsVmmtWE3xtHvz/ylcx1TwV9G
vnrGU6019Fh14x8HNyaivVf8PMxldPR0cN34AnhT6SfPOkPEQf0eGUkv95a8n2NKPWnxGM0vWz3d
e4cto+RSqS4uMex3l/lRt5xN6D0LPT1TD4SGUqs5Sb4QyTl2asv0yW6axx7tQdp8LemIaGwlHRWH
y11G6W6nHKK7Wv5XxOeE35evr5amoOFTpxxGN1HnBVFH8EXq/wCFHR4/UB0dOVfEOq85LXqfiScl
/NYUl3R6VwtH/l2egZTtbEOOs/8Aezsl/Dlf7r4nH2q90n1eI8zYKTjTr1W83FRT3605K/fFTOzw
wZhPosPXn9bUp/xPXv8A8o7doJx+/wB+g7z4GtCR0Xh62k69oqScYye6nHOcuptW/C+Jzzvo9fQx
1Njk/STTs9PvE4uWXjqsIQXCnBN6vZ9G3zzNyaefLLu3feK9RXiMHUlvqVIQXOMU5SXf4srHoOk+
CPo189VJ1Jr6OE4a3CSjeer/ABKm2t6TMZXTv0cNie8LPSb5b47D035FJwpPg5yfjJ/w6kY8m3xJ
jG+tnvwONaOXiMNiavGMKS65y1v8NOS7TpXlnFGtDLxEMRW+rScY9dRqDX8Lm+wVcfX4DOj30U6l
bdRo1JdTkvFwfZKcWKmP6DOjEUsXCo9lLWqv/kFFzt26tu0Uw5DTQ+E+dMVSpSeU6kVJ8m/KfYrt
ipjN0Cx9eWmcTOol5VapJpc5yvb1gt3Q86UVVUxlWMXeFNqlF8Y0kqcX2qKYi58gnSX6CVHD/wBz
Qpxf3p3qy7VKbT6hFy933f0jNKL5LgsLR3z8ZXl+OXi437Kd1ylzELxPx/f4DKX7Joyct9evGK+7
SjrS9c4dwOJ8aM0B+zUcXiPq0fFx+9Wah/g1xTH1v3fmEdD6S+W06kleNHWrS6qUXUt26qXaKYc/
Dz+AgsPQnpOtGCznVmkucpO3tZeGNbEp0txMcXjqzh5kZ6kPuU0oR9UUI1nd1Yc9J/2WGEw393h4
ykvtVm6v+GUF2CLn6T7vz8qya+RaJS2SxOIb/DRjZdjlUfbHkT1TifG/l/WNdGF8lpYzEv8As8O4
R+9Wap/4XN9gq4et+78wy6I4GOkcfh6c/M8YpT+5Hyp/yplrOE3RD6UxstJ16teXnVZym+uTb95Z
4S3YsfTj9nxFPC/801ClSf3lHWn/ADykTFrqc690g1jF8h0PQhvxGIqVX92lFU4+uVQc1b4x+NGd
E/2SjjsV/d4Z04/eryVP/C5vsFMPG7935iH6LaM+eMfh6D82dWCl9295eq5bdM4TdDbpBpJ6Zxlf
E/3tWc11OTaXcJNJld3Yn+mi+SQweEWXicLCUlwnWbqy9UorsJi3n41Pu/PyNYL9g0LiKm/E4inS
X3aSdSXrcBeSeMfjQjwd01T0hHESXk4WnVxEv+QUHKP82qhkdPnfu8ikPWxEt7lJ9rbNOQuvhIkq
WPeGjnHC0qWHX/IOCUv5tYmLr1Ode7wN4tfN+gaMPSxWKnU/BRioL+acu7kT1L4x+N/Ia8Hf7LXx
GM/5pcJXqJ/blHxcPXNDI6fjz7pRQsLhpYypGlDOU5KK627I25a2Lj4TcRGtpWvCHmUXGjHkqMVT
9sWZx4dOrz+/Qc+kjTkoYRpoKENWANFQJaIBJQYAYAJaANWIDQBgBgBgBgBgBoqDADYUYQGAG0gB
VgDYBhQYAYAKSIJsoCMKIVEihQAREAsA/9P3Get8Z+VTADADADCKNWCDADQBlgDRQaCjADADLBBo
gMCDADADADADVgo1YA1YoMsAaCDCAwAwAwAwAwAwAwA0AasAasUGWIDQBgBgBgBgBgBoATYAywBq
wBlgDVgDADAgwA0AYAYAYAYAYAYAYAYAYAYAYAYAYAZYoMsEGAGrAGrAGWANWCjLEBoAwAwAwAwA
wAwAwAwqDADQBgBgBgBgBlgDViKNWANAGFQYAaAMAMAMAMAMAMtcATYA0AaAMAMAMAMAMAMAMAMA
MANgGFBgQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYUGAGACGrEUaAMAMAMANhRgBgBhQYAbSC
BRAYEGAGBRsKMAMAMKDADADYBtEAoAwoMAMAMAFxCgiAFgGEAtAGyg2RQoINgG0FCwg2FC0AbAFo
A2AKiAKAFoKFoAUgBaIBQULQAtMAUiKCIAWgBQAsAUmFCwgUgoWQCkygUAEQBtMihYAtMAUgBSAN
gGwo2mECiA2VRgApMiDYBsKMKDdwBREGBRsAwA3cINBRgBgBgBoAwINAGAGrgGgo0AaCDADADG7A
CADQBgBgQaANNgCQowAwINFQYQGBRq5AabKDSYAsA2mALTANhQtMIFBQtO4BsAWmQCiqFJkApFAR
MgCphQVMAKmFBEyAKmAEQUFTACoigiYAVMAKmFBEAFTACxYUETACxYUFTACJkUFiwAiYAWIUFQAp
BQsAUgBaAFIAUFCokAooFogFFUYAaIg00AJKo0EGmiASVRoIEtBRoINNXAEWABtBANoAG0ADaKgF
JAA2ggG0ADaCAbQANoAG0VAJoAE0EAmgATRUAmgAbQQCaABtAA2ioBtACGggG0ACaABSQQDaABNA
CGgAbQQIaABtFANoIBtAA2gAbRUCGggG0AIAENWAENXAEACWgBDQQIYAhooENACQAbVgBLQAgIsI
aAobQAhooBtACGggG0ADaAENAA2gAbQGw2gBLQQJsVRoIENEAkoNNXIBJRtpq4QIAEtACWgBLQAh
oCxoCkNWANIAIAKQAsAXEAJEKDIgCxCg0QA0QAsQqUeJBDiIUOIgB4hQeLIA8QoPECU4iFZHiQB4
hQ4iAHiRQeLADxCg8WBkaLIIPFhQaIAeLCg0WAGiyKDxADRYVKNECDxZAGiwoPEANEKCoAIiAIgo
IgAiACIAIgAiChRAbQAoA2FG0ECwDAo2AaAMYQaZQIZAaKgSwAcgAbABsAGwAcggDJAAJAAZFQAk
ABkEAJFAGQQBkAAkggDIoASQQAkgBvIqAEkEDeSKAEkEDeSAASRUAJIIG8kAAkioAyQAFoIBSAAs
AGwAbCD0v4ONHw6H6Kq6Rrq0qkdfnqLzEucnmuN4nHK7unv6U7JujzfpLHz0rWqV6rvOpJyl1t+z
hyO08PDbu7DAqD0f4HtCQ0Rha2lK/kqSkot7qcM5Pta/l5nHO78Pd0MdTY4V0j01PpDi6uKntqSb
S4RWUV2KyOkmnkyy7rsQhXMd78CfRzxk6mkKi8mF4U2+LXlS7Fl2vgcs76PZ9Hx9RzPp30i/2nx9
SunemnqU/uR2Ptzl2m8Zpw6mfddimm3Mdf8AA50a+dsa8VNfR4ezXOb83uzlyaXE553T09DDd37h
G+FjpJ8/aQlTg70sPenHg5em+/LqihhNM9bLuvwHMDbzi/8Ag26Nf7S6QhGSvSpfSVODSeUe12XV
fgZyunbpYd1Fw8NnST5diYYGm/Io+VPnOS2di9cmjOEdevnu69w4cdXlFg6LaBl0lxlLCx2Tl5T4
RWcn3bOdkTK6bwx7rodu8NGno6OoUdF0PJTUZTS3QjlCPer/AIVxOOE9Xq6+Wpoebzs8Id4HBT0l
VhRpq86klGK5t2Q4WTY9N+EDGw6CaGp6OoO06kfFp79XbUl+Ju34nwOOPm7e/q3sx0PLVjs+eNqN
wD1dh4rwX6B1nliZq/PxtRZL8K2/dfE4e1X0J/J4/f8AqPKkpObu829rOzwDRUHp/wAGWjafRDRd
XSeIVnUi58/Fx81LnJ5rjeJxyu7p7+lOybo836U0jU0vXqYiq7zqScn27lyWxcjtJp4rd+QwCD0D
4EujicqmkaqtGCcKbfG3ly7FlfnLgcs76PZ0MfUcu6c9In0ox9Sun9Gnq0/uR2d+cnzZvGaefqZ9
1FSsVzHUPBP0Z+fceqs1elh7TlwcvQXfn1RaMZXTv0ce6/APfDD0k+d8b8mg708PePXN+d3ZR5NP
iTCaXr57uvcORnR5hYuimgJdJcZSw0b2k7zfCCzk+7ZzshbpvDHuuh2nwzaejgaNLRdC0VaMppbo
RyhH1X7FxOWE9Xr6+WvA86nZ4gfDYaeMnGnTWtOclGKW9t2SCybHp/pXiI+DvQkMHSf01SPi01tb
edSfrsuF48DhPtV7s79XjoeW7HZ4BlgD1F0LwkOgGhp46svpKkfGNPa75U4dt78tZ8Djl9qvf059
XjseZsZip4+pOrUd5zk5SfFt3Z2eC3YbBB6B8C/R1U1U0lVsoxThTb75y91/vHLO+j2/R8fUco6a
dIX0nx1TEehfVprhCOzv2vm2bk083Uy7rsVY05jpHgu6Nf7QY+Mpq9KhapPg2vNj2vPmkzGV079H
DuvwE14Y+kvzpi1hIP6PD+dzqPb3Ky5PWJhG+vnu69w5LhfOf3Z/4WdHmgm9A6LnpnE4bD09s5Xf
Jaz1pdiV+wlum8ZuyDufhX0tDo5gKWjMP5Oukmlupw485O3XaXE5Yzfl6+tl2zUHnl+TUl9mLi+y
Or7Tq8QBb6NJelJ+pK3tZUHqrCRj4N9DKUklXlFNrf4xx2fhSvbfqvicPar6M/k8R5WhNyjOUndu
yvvbbv7md3zgup5FGC3uUpdaySfepesij0j4Kuj8dGUHpCtlemo0290PPm+2Ta/DzOWVe7o46mxx
LS2mpdINJzxUneOu5xX2Kd2l/DHvzOkmo8mWXddiA0d5LqVPq05fz+R/mv2FrEHS/A/0eWl8VOrN
Xp0lG64y1lKPrjnyy3mM7p36GO6JDwt9JfnOcsPB/R0qigrb5RV6nc3BdaYwjXXz34HJZrxOFit9
So2+qCSi++Uu428/oJfRWhqmmXhcHT86vOc2+Eco3f3dSbJbpqY92p7x2nwsaYp9HMBS0Xh/J14p
Nb1Tjln95rbvtLic8Zvy9XWy7ZqDgGkPoaFCn9mVR9c3b/DCL7Tq8dG9IrxNGhS+zKo1zm7f4Ywf
aCj0pouK8GOgnUmrV5LW1XvqzVox/Ckrr7LZyv2q90/k8R5u0rVl4ijGTbnUdStJva3OWrn/AAX/
ABczq8V4/iEYr9nwdGG+pKdV84ryI9zjPvCXxBk/2bAxW+tWcn92lG0X2ucu4HE+Y3RXybA1Jb61
WMF92mtaa75U32BeINaNXybC4mrvkoUY9c5a7fdTaf3uYJxf3++BmgP2dV6/93Rkl96paku203Jf
dFMfHn7v6BnRZamKjVeyhGVZ9dOLlFdskl2iphz8Ax0NgfnXFUqUnlOcVJ8E35TfUrsUxm6B6UxU
tL4mpVSzq1JSS+88kvYhwW7okOlk0sXOlF3jRUaK4fRRUG+1pvtEXPn4BXSFfJqeFw++FFTl96s3
U/wOC7BDL0n3fmNYj9j0bThvxFaVR/dpLUh65VO4F8T40b0R+yYLF198lToR65y15W/DTaf3uYpj
4l/D9/gE9D14nFfKHsw9OpW/FCL1P53FCmHO/cITRWAlpbEUqEfOq1IwX4mkWsybug66TY5aTxte
tDzJVJan3FlFdkUkIZ3dah/0s/Zfk2F/uMPDWX26t6su3y0n1WEaz9J7p/SMrL5DomEfSxOIlJ/c
ox1Y/wA1SXcPVOJ8b+X9YzouvkdHGYr+7w7px+9Wap/4XN9hKuHrfu/MR3RPR8dJ4+hSn5jqJz+5
Hyp/ypltZwm6IvS+PlpXEVcRLbVqSm/xNv3lk0lu/IsXTf8AZq1HCf8ANNh6VN/fa8ZP+abXYTFv
qePHug1V/q/Q0I7JYrEyl1woR1V/NUl3DmnGPxv5DOhX7I8VjHl8nw1TVfCdW1KPb5bfYMjDxu+6
f0CtaF0a9L4qjh47atSEP4mlc1axjN3QkOmOkVpbSGIrR8x1JKH3I+TH+VIkmlzu7RJ9Kl8hwWj8
LvVGVeXXXll/JGHeSNZ+JJ92/wARrQH9X6Lx+J2Op4rDQf35eMmv4afrF5MfEt+EDDoFgI6Q0nho
z8yNRVJ/dprXlfsiy5XwnTm7BXdK46WlK9WvLzqs5TfXJt+8vDFuxbenv7G8HgtnyfCUtZcJ1b1Z
f413GcXTqeNT3T+ka0avm7QeLq78TiKNBdVNOrL16l+wepPGN++yfqG3g2wsa+laE5/u6LlXnyVG
Lqe2KXaXLhOlPP8AH8BScbiZY6pOrPzpycpdcndmnO3YZtBAFoDbQQaChDVgDQQIasAaKDADADAD
TQAmwBogMAMAMAMAMKDQBu1yAUogCgDCgwCbYA2wCbb2kELIDCgwoFoyoUigWALIg//U9yWPU+M/
KpooMAMAMAMAMIo1YIMANBBlgo1YA0VRgBgBhEGgDAgwAwAwAwAwA1YKNWANWKDQBhEGAGAGAGAG
AGAGAGgDADAg1YA1YKNWAMAMAMANBBoAwAwAwAywBlgDVgoywBqwBlgDVgDAgwA0AYAYAYAYAYAY
AYAYAYAYAYAYAZYoMCDQBgBlgDVgDVgowgMANAGAGAGAGAGAGFQYAaAMAMAMAMANWAMsQGrBRqxU
GgDADADADADADABNgg1YKNAGAGAGAGAGwDCgwIMAMAMAMAMAMAMAMAMAMAMAMAMCjADADLAG7AGW
KDADADADAowATJBAggMAMANhRgBgBhQYAKsEGyIMAMANhRgUYAYAYAYUGAGAG0ALIDADCgwAwA2A
bWQUEQAQAwAWiA2UGEULQQbKDZFCggUFCkECgo2gBYBiACACkwoWgBaIDZVCyAWgBSACEApBQsAW
gBSYAsAWgoUgBaAFIgFlApMAUALTuRQpACwBSYAoAwA2FG0wgUQGygwKN3Ig2AbCjYBhQKuRBsA2
FGAGAGAGgDAg0AYAYAJuFGAGgDQQYAYAY8gBDzANAGAGBBoATcA0FGBBoIMAMANXIo02UGgDRUGA
G07EULAFJgCkwBQUKTuAKTsALANphQtMIFBQpMgCJgBYsKCJgBUwAqZFBEwAqYAVMKCJgBUyKCRY
AWLACphQVMAKmFBEwAqYUFTACIgCoKCoAIgoKmAEQULAFIAWgDaAFhQpACgBSIBaKo2QGigywQJa
IBJVGgg00AJCjQQJaANAGmrgA2gAbQQDaABtWABtFQCaABtBANoAG0EA2rgA2gATRUApIAE0EAmg
ATRUA2gATQQDaABNBAhooBtACGggE0ADaABNBAJoAG0ADaKBDREA2gAbRQDaCBDQANoIBtFAhoIE
NXABgCGrACWgBAAhoAS0ECGUCGgBDQAgAQ1YAQ0AJauEaDaAENAA2igG0ADaAENBANq4Ahq4ANoC
wNoDRDKBNiIEtBRoqBLRAIKDTVyCwko0S1cIEgCWgBLQAloAS0BokASlYAWAKQAoKCIIFRCgyIAy
ACxCg0QA0QMjRIocRCg8WAHiAHiRQ4iAHiFQeLAycRIoPEAPEKDxChxEgDxADRCs0eJBBohQeIAa
IUGiAHiRQaIAaICjxCsjRIA8QoNEAPEKCogCIAIgoIgAkQAkQAkQAkQoWAbIoUVkbI0NoIFgGBRs
A0AYEGioEEUaKg1IAHIAHIAGwAbABsIAyAAyQACRUAZIADIIASQAGRUAJAAZBACSKAMggBJADeSK
gBJBA3kAAkVA3mgAEkVACQQN5AAJIqAMkABkgATQQBkgAbALF0R6PvpNjaeHXmt3m+EFnL4Lm0Zt
03hj3XQ6v4ZtPqjGlo2jkklOoluSyhH32+6Ywnq9HXy9B57Z1eMSugtET09iaeGp+dUklfgt77Fd
9hLdLjj3XQ774WdLw6PYGlovD+TrxSaW6nDJfxNbd9pcTlhN+Xt62XbNQeaju8Ic4PBz0hUhRpq8
5yUYri27IlWTY9M9OMXDoFoangKL+kqR8WmttttSfbe3LW5HDH7Ve7qXsx1B5bO754VGLm7JXb2I
A9UVLeC/QNlZYma/5SzX+Vd+rzOHtV9H+28fv/UeU27nofPGiA9TdCsJDwfaFqY6uvpakfGNPbnl
Th23vy1nwOGX2q9/Tn1eOx5hxmLnj6k6tR3nOTlJ8W3dnd4LdhsAelPA/oSGg8HW0piPJUoy1W91
OGcn2tfyricc7vw93Qx1N0cD6R6an0ixdXFT21JXS4R2RXYrI7SaePLLuuxCBgd48CXRn5VWnpCo
vIpXhTv9dryn2J2/FyOWdev6PhvyKB4ROk3+1GkKlSLvSh5FP7sd/a7vqaW43jNOPVz7qKQVyHT/
AAUdGf8AaDHxqTV6OHtOXBy9CPfn1RaMZXT0dHDuvwEn4ZOk3ztjFhab+jw90+dR+d3ZR5PW4jCL
1893XuHHjo8ws/Q/o9LpPjaWGXmt3m+EFnJ+5c2iW6dMMe66HYvDT0hjhoUtGUbJJKdRLdFZQj77
conPCer09fLXgedzq8YeaPwFTSdWFGkrzqSUYrm3Ym1k2PTHT7HQ6C6Hp6PoO06kfFp79XbUl+Ju
34nwOOPmvd1b2Y6Hl47PnjAD1VoymvBjoJ1ZpLETWtZ7fGTXkx/Ctq5Se84+1X0J/J4jyxUqOrJy
k7ybbbe1t7zu+eEhR6V8E2hodHsDV0piPJ14tpvdThm3+JrZvsuJxzu/D3dHHtm6OBae0xPT+Kq4
mp51STduC2Jdisuw6yaeTLLuuxEWKwO2eBnoz8vxMsbUXkUMoc6jX+VZ9bTOWderoY7u/cKr4Suk
v+0mPm4O9Gl9HT4O22Xa/VY1jNOfVz7qOf2NOIuvQDoz/tPjoUpK9KHl1furd2uy7W9xnK6denh3
UdB8NHST5RVho+m/Jp2nUt9ZryV2J3/FyM4R26+W/A4VY6PIH+i9G1NL16eHpK86klFdu98ltfIX
wsx34Ho3wjaRp9DdF09G4d2lUjqc9RefJ85N253lwOOM3dvd1b2TUHmKx2eAbsAeptDUY+DPQkq9
RJYia1mnvqSVoR/Ctq5SZxv2q+hjPq8R5drVZYiTnN3lJttva282ztp4ASj5s/ur/FEA9E+CXQEd
HUZ6Sr2jHU1YN7oJa05d+XUnxOWd9Ht6OOvI450p01LpRi3Wlkqknqr6sL6sV3Ru+LbOkmnmzy7q
K6566qT+s0u963uKwOm+C7oz894yFSa+iw8VOS3Obb1F6lLqikYyunfo4bvwDrwrdJvnfGSoU3en
houPJzk1Gb7L6q4NPiMYvWz3de4clfk0/vSd/wAKy/xM28wntF6Fnp/FUMHT2yjFN8Ivy5PsUn3G
b4bmPddDvvhK07HQtGlo+h5L1XOSW6FNNxT+9JJc0mt5zxm3s6uXb4HmzBrxcKs/sqKfOTWXbFSO
rwwLpwcMO7balRRXNRTbXfKIPQelKKXgw0HrOyxM1frqzWS/Clnx1XxOPtV7v7bx/fI82aRk1ClB
vPVc5X2603e/bFQZ2eGjWlfo3Tp/UpxXbLy33OTXYIZD0d4N9AR0TCpj6/kqFNUoX9GNNfSy7ZqX
c+Jyyu3t6WOvNHC+m+k59IdJVp5vy9SCvfKPkpLrav1s6SajydTLuohtLx+U4qVOn5VnGlC29QSh
HvSRYmXmjpPQfo4ukul5Ta1sPhXHPdLxa1Ka7dW74pNbzFuo7dPDuy+AzwwdJXpnGLB0nenQdnbf
Ue3u83k9YYTR1893XuHNukEl8pnBZqlq0lz8WlC/a1ftNxwy5GdIl4uv4lbKMY0u2CtPvnrPtEXI
Zp/6GVOh/c0oRf3pfSTXZKbXYIZDemf2enh6H1aSnL71V69/4NRdgiZeNDekP2bCYelvnr1pfiep
FPsg2uUuYL4kGTXyXR6W+vWb/DSjZdjc5dseQXifGjWBXyTBYirvqyhRj1X8ZPu1IJ/eBOBvo/8A
s0cRiP7ujKMfvVfo126spS/CKY+N37v6AnorTXyuFSSvGipVpcPok5pdrSj2imHPwEZo/Bz0xiad
K/lVakY35ydrvvuOGZO6gnSDHLSWLrVY+ZKb1FwgsorsSSEXK7okOln0FaGG/wCaelCm/vW16n88
pCLn7vcNaVXyLA4WhvqOpXl+J+Lhfsg2uUuYnkviT8RmC/YtG16m+vUhRj92P0k/WqfePUnifH+s
a6JL5NUrYr/mnoVJp/bkvFw7pTT7BTDx590/oEToDR3zvi6NB7KlSKk+Eb+U+xXZazjN3QRp7SHz
viq2I3VKkpJcE3kuxWQngyu60l+mH7LUo4T/AJp6FODX25Lxk/5ptdgjWfu90/pGYlfINE0oelia
8qj+5SWpH+aVTuHqXxPjRrov+x0cZi99Og6cfv13qf4Nd9hKYet+78xGdFNGrS2OoUZeZKonP7kf
Km/4Uy26Zwm6I/TWkXpfE1sRLbVqSn/E27dmwsmkyu7sWDpr+yTw+D/5psPTjJfbqfSz9c7dhMW8
/Gp7p/SMivm7QzeyWLxKXXChG7/mqL+Ec04x+N/L+sZ0D/Za9XGPZhcPVqr77WpD+aafYMjp+/3S
in4LBy0hVhRh51ScYR65Oy9prbnJsWPp7i44vSVdU/3dOSpQ+7SSpq38N+0zjw31LuhzpxfN2isF
h9kq0quJmuTapw9UJNdYnmrl4knz/QZ0P/YcNpDGfUw/io/eryUMvw64ph4lv3fmK30a0V8943D4
b+9qwi+ptXfYrs1axjN3QN0x0p89aQxOIXmzqy1fup2j6kiY+Fzu7aJrpX/V+j9HYTe6U8RPm60r
R/kgu8kaz8ST5/iNdEf6vwGksZv8THDw668vKt+CMu8Uw8S37tfiOcG3IIaCAUkBqENAUkINNBQg
IMAEPIA0UGAGAGAGAGrACbAGiAwAwAwAwAIUZYBGAGAGAGAGyKFJWIDZUGFBtIihZAKRQLQAoiD/
1fc56nx35VNWCDVgDVig0AYAYAYFGEBqwQYAaCDAoywBqwBoqjADADViIMAMCDADADADADADVgo1
YA1YoNBBhAYAYAYAYAYAYAYAYAaAMCDQBqwUZYASEGgDADADADADADADADADADADADLAGrAGaoBr
VANWAMANAGAGAGAGAGAGAGAGAGAGAGAGAGWKgwA0AYAasAZYA1YKMIDQBgBgBgBgBhUGAGgDADAD
ADADLAGrEUJsAYVBoAwAwAwAwAwINWAE2ANBRsAwoMCDADADADADAowAwAwAwAywBlgDYBgUYAYA
YAYUGAGAGAGAGAGAGAGAGAAthEGAGwowAwAwoNhBsgNhBgBgUbAMCjADADADCgwAwAwAWiA2AYAY
UGAGAGwDAoJFgBQDABSIBRQYAKRFGyoFEUKQQbChSAFgGABADABaAFIKFgCkQCygUiAUFCwBaAFo
ihaAFJgCwBazAFJhQsIFIKFgCkwBQAtO4ApOxFCwBSYAoAVcKFBBgBsKNpgGyIN3ANlUbuAbIg2A
bCjADdyoFEBgUYAYEGgDADADVwDQUYAaCDQBgBgBjdgBDdwDQBgBgBoIEtgGgowINFQYQGBQm4Bo
AwA0VBgBhAYAKTChQApMAUmAKWQULAFJ2AFACkwoWgg2RQRMAImAFTCgiYAVMKCxZAETACphQVMA
ImQBUwoKmAFiwoKmAFiFBIgBYgBIhQZMAIiKCpgBUwoImAFQAsKFIAWgBQULQQbQULAFIgFooNoi
jLAGigwAS0RAkqjAgS0AJCjQQJaCjQQJauADaABtBANoAG0VAJoAG0ADaCAbQANoIBtAA2ioBNAA
mggE0ACaKgE0ACaAByQQCaABtBAhooBtAA2ggE0ADaABNBANoAG0AIaABtBANooBtBANoAG0ECGg
AbRQIasECGgBDAEACGgBDQQJChDQQIaKBDAENACWrgAwBLVgLCGgihtAA2gBDRQDYANoAQ0ADaCB
DQANoDUDaApJQaCBDRAaKBLRAIKDGrgaIasBWmggQ0AaaAENACQBLQGiQDaAFoAUgBYULiAFiAFR
AGiFBYgSjICDRIoPEAPEKHEQA8SKDxAHEQqDxAyPEig8QBxEKDxIA8QoPEAPEKlGiBkeJFBogB4h
QaIAeJAGiFBogB4hWRogB4kUGiAGiAGiFBIkASIARBQVAC0AFQAtBQQIMI0FoINgGBQRBBgUbQBg
BoA0VkJZFCQg0ygQwAbABsAGwAbABSQQAkABkioASAAyCAMgAEioAyQACQAFoIAyKAEkEDeQQAki
gBJBA3kigBJBA3kEAJIoG8kEAJIIAyRQBkgATQQBaABAHpDwZ6Lh0W0dV0liMnOLlzVOOxLnJ58/
JOOV3dPd0p2zdHnrTOlKmmsRUxFXz6knJ8uCXJKyXJHWTTxZXu8iJZpkeh/A7oCOj6NXSlfyVaUY
N7oRznL1W7HxOGd9Ht6GOvNHGOlWn5dJcZUxMtknaC4QWUV3bed2dZNPJnl3XYrjRpkdz8C3Rn5V
Wnj6i8ileNO/12s32J2/FyOXUvo9fQw35FD8IfSX/afHzqRd6UPIp/dW/td31WW41jNRy6ufdRRj
TiOreCPoz8947x81elh7SfBz9Bdnndi4mM7p6Ohhu79wzwudJvnvHeIg70sPeK4Ofpvs83sfEYTS
dfPuuvcOT2OjgLt4PujP+1GPhSkr0oeXV+6t3a7Lqbe4xldOvSx7qOg+GzpL8oqw0fTfk0rTqW+s
15K7Fn+LkYwnq7dfP0HBTq8gnOjeg59I8XSwtPbOWb4RWcn2K79RLdNYY910O8eGDTcNCYSlorD+
TrRjrJbqcMorta/lfE5YTfl6+vlqag81WO7xBxg8JPH1IUaa1pzkoxXFt2QWTY9P9M8XDwd6Fhga
L+lqR8WmtrvnUn67LhrLgcMftV7s79XjoeVTs+eFxzAPV2i6UfBfoJ1ppLETWs099Sa8mP4VtXKT
OF+1X0Z/J4jytVqyrScpO8pNtt7W3tZ3fPAwg9OeCzRFPoro6rpTE+S6kXJcVTjstzk8+fknHO78
Pf0ce2bo88aa0rU07iamJqedUk5Pkty6krJckdZNPHld3YjbBkd68CvRrxtSekaq8mneFO/1mvKl
2LLtfA5Z16/o+HqOddPukv8AtTj51ov6KPkU/ux39ru+2243jNOHUz7qKWbch0zwWdGP9ocfGc1e
jQtOfBv0Y9rz6kzGd079HDuvwEv4Y+k3zri1hKb+jw/nc6j2/wAPm8nrEwmm+vlu69w46dHmFg6L
6Bn0lxlLDR2TflPhFZyfds52RLdN4Y910O3eGHT0NGYelovD+SmouaW6EcoR7Wr/AIVxOWE9Xq6+
WpqDznY6vED4bDyxc404LWnNqMUt7bskCTY9QdJMRDwcaFjhaTXjqi1E1tcpZ1J9m7heJxn2q+hn
/J46Hlo7vnjAD1D0JwUOgOh6mOrq1SpHxjT222U4dt78nLkcMvtV7+nOzHY8047Gz0jVnWqO85yc
pPm3dnZ4bdhoVB6A8DHRxQ8ZpKtlGKcKbf8APLsXk3+8cs76PZ0MfUcr6bdI30ox1Sv6F9WmuEI7
O/a+bN4zTh1Mu67FTNOQ6R4L+jP+0OOjKavRoWnPg36Me159SZjK6d+jh3X4Cc8MXSX50xSwlN3p
0PO51Ht/hWXJ6xMJprr57uvcOOWOjzCw9HtCz0/VjhqfnVKkVfhG0nJ9SSv2GbdN4zu8DvHhU0tT
6P4CGjcP5OtGMWltVNbL/e1WudnxOWM35evrZds1B53S1Zr7MLrr1db2s7PGAqDdNJZuUnl1JW9r
CD1NGEfBroZyyVeUdvGq42XYkl3czh7VfQ/tvEeWpTcoOUndylt6k7370d3zwt0nWlTpra1FfxO6
9pAeifBhomnoyjX0tX8mM9fUb9GlF3b7bW6oq205ZX0e3o46+0OKac05PT9XE4yf9pKMIr6sb3S7
FBJ8W7nSTTy5Zd26ISf0WHit85uT6oq0X3ua7Cseg6t4M+jHztiqVSa+iw0VUktzqTd4fyqMn1Jb
zGVejpYbvwDPwq9IZdIMesJSd4UXqJLfUeUu5+T2PiMZpOtl3XXuHP6tOOksZqJ+Q5qCfCEbRT7I
q5tx5okej+jpdKtJwgllUqucluUU9aXqyXYiXxGsJ3Ud88Imno6IhRwFLh42ov8AjdJOSi/vyjbn
nxOWMezq5a8DzboRuNfxz/slKrfnFXjfrlqrtO1eHHkb0BFxr+N/uoyqL70V5HfPVXaKYj03onCR
8G2hZTlZV3BzlffUayj1LKP+pxv2q9+M+rxHmXQcnPEqvPyvF61aTed3BOSv96Vl2nWvDjfIFoGm
q2KhKecYN1J33qmnNrttbrZaYzyE6Ko/OmKgqrvGU9ao/srypvuTYqSboTCM+kGLSeU69XN8HOWb
6lccHtX4hOlK70vipyprKpO0I8r2guxWQ4Ld0F6SVFPFTjF3hStSi+KppQT7bX7RFy5BOkf0FSnh
/wC4pQg/vPy5rsnKS7BDP3e4b0x+y4fDYfeoOrJfaqvL+SMH2iGXiSDK6+R6Ppx9KvVlUf3aa1If
zSqdxDifEawC+R4HEVd9WUKMeq/jJ92rBPlILPEv4DfRr9mdfEv+xozcfv1Po49qctZfdLUx8efd
P6A26M4OOMxlJT/dxevU+5TTnP1RYqYeaI2tUqaYxDltqVqjfXKb+LHCc0SnS2tGrjKkIO9Olq0Y
fdpJQT7bX7RGs+QTpEvkdDCYXfCl42f36z1v8CpiGXjU/fkZH9g0W36WJr2/BRjd9jlNdsB6nE+N
/IZ0YXyOGKxf91QlGP3630a7oynL8Iph43fu/PwI/ovo+OlMbRpT8xzTn9yPlT/lTLUwm6qO0tjp
aWxFXES86rOU3+J3sJ4Zt3dqnumv7NXhhFswtGnSf37a1T+eUiYt9T3e6DMYvm/RNGn6WJrTqv7l
NeLh/M6hfUvifGjXRb9ioYzF76dDxUPv13qf4Nd9hKYeN37vzEV0W0YtMY6hQl5kqi1+UFnN9kU2
at0zhN0MtPaSemcVWxL/ALWpKfUm20uxZCTSZXd2LB0z/Y1hcF/zT4eGsuFSrerL/El2Exbz8anu
n9I1hl83aGrT9LFYiFNfcorXl/NKHcOacY/G/kE+D+CpY35TJXjhaVSu+uEXqfzuKGR0+d+7yKXG
E8VNJXlObtzbbNOfIt/hDqx+Xyw8HeGFhTw8f+QUVGX82s+0zi6dTn4eAvGf1ZoShT9LF4idV/cp
Lxcf5pT7hzS+MfjRnQD9iqYjHP8A5JcNVnF/8cmvFQ9c7rqGR0/Hn3T+gUjBYSWkKsKMM5VJRjHr
k7L2mq5ybFq8IuLjidJ1o0/3dFxoQ+7Riqf+VvtJjw31L5/h+AcaT/qzQWFpeliq9Wu/u00qUOy+
u0ScrfGM++7/AEHOmjbkBtBAKQFIINEtFAkIEtBQkqDTVyAQUGAGAGAGAGAGAGrBAmwUaIDADAAi
AywojADADADZFCkiA2VBhQYALRlRsqBSChaAFEQf/9b3Oet8Z+VTCKMANBBqwBqwBooMAMAMCjCA
0EGAGggwAwAywUasAaKowAyxEGgDAgwAwAwAwAwAwA1YKNWANWKg0QGAGAGAGAGAGAGAGAGgDADA
gSwoSAZYAwIMAMANAGAGAGAGAGAGAGAGAGAGAGAGAGWANaoBrVANWAMANAGAGAGAGAGAGAGAGAGA
GAGAGFBgQaAMAMANWAMsAasFGEBoAwAwAwoMCDADQBgBgBgBlgDVgBNgDADQBgBgBgBgBqwQZYAy
wBlgoywBqxQZYAwKMAMAMAMAMAMAMAMAMAMKDADADADADADADADADADADADABMkQCQDADADCg2kE
CiAwIMAMCjYUYAYAYAYAYUGAGAGAG0ALIDADADCgwAwA2FGACosAOAYAbRFCyoMAFIijZUG0RQpA
CkAbQAtAGwBUQBQBtACwBaChSAFogNlULIBaYAtACyAUiqFkAtZgCkwoWECkwoUALTAFEAQoNp2A
FgCkyKFAC0wDYBsKFXCDYBsAwKFXIg2AbKowAVciDYBgUbAN3ANhBgBgBgBq4UaAMANAGBBoAwAw
A03YASAaAMAMAMCBDYBoKMCDQQYAZcKEhRoINFQYAYAYRRpsINXAFACkwoUAKTAFgCk7BQoAUmAL
ANphQsIFJkUFTACRYAVMKCJgBUyKCpgBEwAqYUFTACpkUFiwAqYAVBQRMAKmFBUwAiYUGRAFTACR
CgsWAEiwoKgAqCjaAFoAUFC0EGwoIAbQAtEApBQsAS0AaKDQBpoiBJVGgBLQQJCjQQJaCjQQIaAB
tAA2ggG0ACaKgG0ADaCAbVwAbQQDaABtAAmioBNAAmggFJAAmioBNAA2ggE0ADaKAbQQIaABtBAO
SABNAApIIBtAA2gBDQANoAG0EA2igG0EA2gAbQQIaKAbQQIaAENACWrgCAAbVgBLQQIChDQAloqB
AAhoAQ1cAQAIasBohqwQDaABtACGigG0ADaAENBANoAG0BSGrAaIaAElBoIENEBooEtEAkosaeZB
oh5FBpoIEACWgBLQAkCwhoCtoAWgBSAFBQtEASJQGiQBohQWIGRogBYkUOIgB4hQeIAeIUOIkAeI
VKPEDJxEig8QA8QocRIA8QoNEAPEKlGiBkeJFBogB4gBohQeIAaJFB4gBohWRokAeIUGiAGiAGiR
QVFAtEAVBQRABEAEACBQsINkUKQApAGBQtBBsKMANsA0AaKg0yASAaKgGAIYANgAmAIYQCkABkAA
kVAGQAGQQAkABkioASAAyQQBkABkigBJBA3kgAEkVA3kggBJFA3kggBJBACSKAEkEAJIoASQQBkg
ALQQCkgCxdEej0uk2Mp4dX1L61R8ILb37FzaM5XTphj3XQ6n4YukKw8KejaOUUlKolsSXmR99vum
MJ6vR18vQefZHV4hKaC0NPpBiaeGp+dUla/BbW+xXZLdNY4910O9eFXTNPo5gaWi8N5OvFJpbVTj
lnzk1t32lxOWE35ezrZds1B5rOzwhzgcFPSNWFGkrznJRiubdgSbHpjppjYeD/Q8MDQf0tSLpp7+
NSfbey4OS4HHH7Ve/qX6vHQ8tnd4AqEHUaSV28kkFHqibj4LdB2yWJmu+rNeyKXbq8zz+1Xv/tvH
7x5VlJzbbzb2s7vnhIQepeheCh4PtDzx1dfS1Iqo09ueVOHbe74OT4HDL7VfQ6c+rx3R5ix2MnpG
rOtVetOpJyk+bd2d48Nuw1Kg9J+CHQcNB4SrpXEeTrRlqt7qcc5Pta7oricM7vw93Rx7Zujg/SXT
k+keLq4qe2cslwisorsVu3M6yaePPLuuxBFYHd/Ap0Y+VVp6QqLyKV407/XazfYnbrfI5Z30ez6P
hvyKD4Rek/8AtRj51Iu9Gn5FLhqrf+J3fVZbjeM049XPuoohtyHT/BR0X/2gx6qTV6OHtOXBy9CP
fn1Jrec87p36OHdfgJbwx9KPnbGLCU3elh7p86j87u83k9biTCaa6+e7r3Djh0eUWjod0dl0oxtP
DK+q3eo1ugvOfuXNozldOnTw7rodj8M/SGOFp09F0LKKUZVEt0V5kfVe3KJzwnq9PXz14Hng6vGH
mjsBU0rWhQpK86klGK5v3ceRFk2PS3T3H0+geiKej8O7TqR8Wnv1f7SXW27fiy2HLGbr3dS9mOoP
Lp3fPCkrhR6p0dTj4L9COrNJYiau099Sa8mPVFbVyk95wv2q+hP5PH7x5Zq1ZVpOUm3KTbbe1t7W
d3gCLBB6W8FWhqfRrA1dKYnydeLab2qnHPLnJrZvtHicc7vw93Rx7ZujgWn9Mz6QYqpiannVJXtw
WxLsVkdJNPHll3XYiCsjt3gZ6MfLa8sdUXkUfJhffNrN/hXrae45516uhhu7FR8I/Sf/AGmx0nB3
o0vIp8Gltl2v1WNYzTn1c+6igG3EXnwe9Gf9p8dCElejT8up91bI/ieXVd7jOV07dLDuovfhm6S/
KqsMBSfkUrSqW3zayXYn3vkYwjr18/QcMsdHkElojRVTTWIp4el59SSiuXFvklm+SFumsZ3XQ9Ee
EnSlPoho2no3DO0qkdTmqa85vnJ5c7yOOPm7ezq5dk1B5msdnhG0rgHqbAU4+DDQjqTS+UTV2nvq
TXkx6orauUnvOPtV9CfyWP3jy5VqSrycpNuUm229rb2s7PnhAB6R8EmhIaJwk9JYi0U1PVb3U1bW
l2uPcuZxzu/D3dDHU3RxfpJpqp0mxE8Q9tWpaKe6MUlBdzz4vM6SaeXO912IWclLxklsbsu13XqR
WR1HwWdGPnjGRr1Felhoxlyc5XlFdl7vmlxMZXTv0cN34AXhT6TfPWKnSpu9KhamuDk3ecuxxUV1
N7xjNHWy7r8By+cHLUgtrztzk/hY28+hZ+iWhX0k0hGlDzfKbf1YrJNdWVuwlunTDHuo7D4W9Mw0
TgoaOoWipaqkluhHYl2pX5W4nPGPT1stTQ8+YheLo04/W1p971Uv5W+06vHQ4xOGliK1PDwV5JQg
l9qWbX8UmgtnoPU9edLwf6OUV+8m3131bv8AghGy46qW848vf/bcHlnR9aVStLETd3BSqN/a9F/x
uJ2eCe8D0b9FGrV+rTcV1z8i38Lk11BIO+eCrQsOjuCq6UxPk68W03upxzb/ABNbN6UbbTlld+Hs
6OPbN0ce0xpqemnicbU86vKNOK4RT1rL7qjBP73M6SaeXLLe77xC0F8nwtSe+rKNNc4x8ufr8WVm
cDqvge6NLSUp4movIhOKXNx8q38WpL8Nt5jOvT0MN+RnhT6UfObqU6b+jjPxMbbJONp1X2S8Wl1P
iMYdbPY5Xhv2XCVZ76so0lzjHy59zVPvNvNPEG8Evk2Fr1d89WlHtevJrqUUnymCeINaLXyahiK+
/VVKL+1Uvf8AkjNdpKsGaD/Z1WxH93Sko/eqfRrtSlKS+6WmPvGdG14qs672UISq/ijlD+dwXaKY
+/3AOgMLHF4qmqmdOLc6n3IJzl6kxUx80ApU6mnsUk39JXq5vnOWb9dxwT7V+I3pzFrSWKqTh5jl
aC+xHyYLsikhDLzQ76UPxWIVBbMPCNL8UV5ffNzfaIufPwCtOL5LQw2G3xpurP71azX8ipkhl41P
35Gqq+Q6OhH0sRVc39yktWPY5Sn/AAheJ8Rmif2LB4rEb5KNCHXN60n/AAwcX94VJ4lvyGdEoqji
HiXsw1Odb8UVan/O4ItMOd+4Q+iNHvS+JpUL51Jxi3wTeb7FmxfCSboJ0g0gtK4qrWjlGU3qrhFZ
RXZFJCGV3RI9LV8lnRwi2YejCMvvy+kn2qUnH8Ii5+73QZiv6v0ZSp+liasqsvuU704fzOp3D1L4
nxGaAXyHC4zFb1TVCH3qzs/5Iz7xTHxLfl+IadEMHHGY6l4z93Tbq1PuUk5y71G3aWmE3VQuNxE9
KVp1ZZzqzcnzlJ39rHDFu1WHpvJUsUsNHOOFpwofigvL/nc2TFvqc693gb0gvm/RWHpelias68vu
w+jp+vxjL6l8T4+f0Gui37DQxmM306PioffrvUy/BrvsJTDxu/d+Yh+jGi1prG0MO/NnUjrcoLOT
7Ips1bpnCbug36Q6TemsXWxL/tKkpJcE3kuxWQk0ZXd2J7pj+w08Hgv7nDxnNcKlb6SV+qLguwmL
WfjU90/PyNaO/q3Q+JreliatOhH7sPpanr8WhfNJ4xv3+P1AOgGGjV0hTq1Fenh1KvPqoxc/W0l2
jJOnPPw8io4qvPG1JVJ5znJyfNt3Zpi+RcvCF+zYmng1swlClRf37a9R/wAUpLsM4unU517oMpf1
XoOb2SxmJjFc6dCOs/55x7hzTjH438gLwc0Yxx6xM1eGEp1MRL/kHFuP82qhkdLnfu8ii1ZyxMnJ
5yk7vi2zTkLz4SWsNi6eDWzB4elQ/Eo603/FKVzOLr1ede6SDnZtyA2ADaCAIGowgpDKDQQJaChJ
UGmiKE2ANFQYAYAYAYAYAYAasECbBRogFxAzWyiMAMIDdgoUkAbCDCgwA2iKFkBsqBSChSAFkB//
1/c563xn5VMAMCjCAwA0EGBBqwUasUGgDADAowgNBBgBoIMAMAMCjLAGrAGiqMIg1YAwAwIMAMAM
AMAMAMANAGWAE6oBqwBgBgBgBgBgBgBgBgAloA1YA1YAywBgBgBgBoAywBgQYAaAMAMAMAMAMAMA
MAMAMAMAMAMAMsAa1QDWqAasAYAaAMAMAMAMAMAMAMAMAMAMAMsVBgBoAwAwA1YAywUasQGgDADA
DADCoNAGAGAGAGAGWAEtACQDADADADADADADADADADADADADADADLAGrFBlgDLAGWKDLAGWAMsAZ
YAwA0FGAGAGAGAGAGAGAGAGPMAGQGAGACrBBsIMAMAMCjYUYAYAYAYAYUGAGAGAGAC0iA2AYAYAY
UGAGwDAowA2AHQBsAxEUEKgwA2RQoqDaIo2gBYQbChSCBQUbQAsAwAIAbQULAFIgFlApEUKQAQAU
gBaIoWgBSYAsAWgDaCggQKTChQAtMAUAKTAFBQtO5AbACIAwA2FCrhBsAwA2FCkyIMAN3ANlUbuR
BsA2AYFGwDdwgy4UaAMANAGBBoAwAwAwA02AJANAGAGAGBAlsASFGAGgyMANNhRoKNBBoqDADCAy
4UJbCBIBhQKTIBQUKTAFgCkwBQULTANgC0wBQApMAWFC0yAKmAETCgqYAVBQRMgCpgBYhQWIAVEU
ETADJgBYsKCRYAWLCgsWAFQARMKDIgCIKCpgBUFBEwAqYAsKFoAUAKQAoKFoAUgBaIBQULQBgAlo
A0AaKDTRECbFUaANNBAgKNBAloKNBANqwANoIBtAAmrAA2ioBNACGggG0ADaCAbQAJooBNBAJoIB
SQAJoIBNFANoAE0EA2gAbRQDaCBDQANoIBNAAmgATQQDaAENWABtACGggG0ADaKgG0ADaCAbQAho
oENBAgAQ1YAQ0AIAENWAENBAloAQ0AIaKBDAENWAEtACGrgWBtBFIaABtAA2igG0AIaABtACGggG
0AIaA1AwK00AIaANFQJaIBJQJaIBNijUaauBSGrACWggSAJaAEtACQNNWAFIAWgBSChYAuIAaJAG
iFSixAg0QAsSKDxADxChxEAPEig8QA8QqUeIGTiJFB4gDiIUGiwA8QoPEgDxCpRogZHiRQaIAeIA
aIUHiAGiRQaLADxCsjRZAHiAFiwoPEANFhQVEARABEFBEAEQARABEALQUKIBSAFAGBQpBAoKMANg
GgDGECWUCWQGioEMAGwAbABsAQwAUggDIADIABIqAMgAEggDIIAyKAMgAEggDIoAyQQN5AAJFQN5
IIASQACSKgbyQACSKgBJBACQACSKgDJAAZIAE0EHo/oHo6n0L0ZU0hiFadSOu+Op6EVzk3ftXA4Z
Xd093TnZN0edtK6RqaYr1K9V3nUk5Pt3Lkti5HaTTxW7ojGVkeifBNoKGhcLV0piPJ1ovVb3U45y
l2tdy5nHO78Pd0cdTdHDek2nZ9JMXUxM8td+SvqxWUV2Lbxd2dZNPJnl3XYgCsDvXgZ6Mqcp6Sqq
0YXjTvxt5UuxZX5vgcs76PZ0MPUc36e9Jn0px06qf0UfIpL7K39ru+2243jNPP1M+6imGnIdd8EP
Rb54xfyqor0sPZrnU9FdnnderxMZ3T1dDDd37gw8K3Sj5/xrpU3ejh7wjwcvSl3qy5K+8YTSdbPu
vwHLzbzi++Dnov8A7UY6MZq9Gl5dTg0tkfxPLqvwMZXTt0sO6i5+GjpR8srRwFJ+RR8qpbfNrJfh
T721uM4R0+kZ78Dhp1eQWDor0fn0mxlPDQyUneT+rFZyfds52RLdOmGPddDtvhh0/DROGpaKw/kp
xi5pbqccox7Wr9SXE54Tfl6uvlqag83nV4g80fo+ppStChSV51JKMVzfu48ETelk2PTPTnH0/B/o
ino/Du1SpFwT32/tJ9bvbrllsOOP2q93Uv1eOoPLJ3fPG1Bzdlm2FHqzDRj4KtBuUrfKZq/XVmsl
1RW3jqvicPar6E/ksfv/AFHlapUdaTlJtybu29rb3nd88JsAen/Btoqn0M0ZU0niVaVSOvzVNeal
zk8+d48Dhld3T39Kdk3R5z0xpSppvEVMTVd51JOT5cEuSWS5I6yaeHK912I4rI9AeBfo0o6+k6yS
jFOFNv8Anl2Lyb/e4HPO+j2dDD1HL+nPSV9KsdUr3+jXk01wgtnfnJ82bxmnDqZd12Kgacx1PwT9
F/n7GqtUV6OHtJ8HP0V35vqtvOed09HRw7r8A68LvSf55xnyam70sPdcnP0n2eb1p8RhNHXz3de4
clNvMLN0Q6Oy6UYynhlfVbvUfCC2v3Lm0S3Tphj3XQ7D4Y+kMcHSp6LoWStGVRLYorzI+q9uUeJz
wnq9PXy14g882Ozxh1gcHPSNWFGktac5KMVzbsRZNj0x0wxkPB5oeGCoP6WpFwTW3POpP12XBtcD
jPtV7s79XjoeXju8A3YgPUnRjCQ8G+h54usvpqiU2ntcnlTh2Xz4XlwON+1X0MJ9XjseZMViZ46p
KrUetOcnKT4tu7OrwXyAFQehfA/0ejgaVTSle0VaSpt7FFefL1W7HxOWd9Ht6GOvI4/0u6QS6T4y
piXfVbtBcILYve+bZuTTzZ5d12K0acx1LwUdF/nzGePqK9HD2k+Dn6K/zPqtvOeV09HRw7r8Abwt
dJ/nrGfJ6bvSw948nP0n2eaup8S4xetnu69w5ObecWDovoGfSXF08NDZJ+U/qxWcn3bOdkS3TeGP
ddDuXhU07DRGGhozD2ivFpzS3QXkxj2vPqjzOWM35errZamoPP0PJlDjCOt25yXuudXjCKVCVdQp
wV51JWSW/Yo+u6APT+la0fBrodwptKvPKL41JbX+FbOUUcZ9qvfl/J4jy7NOUYR2uTb73b3es7vA
CaydSUlsinZ9WUfXYgPQ/gy0RT6K6PqaTxOTqR1lxVNbEucnnz8k5ZefD29Kds3Rw7pLpWpput42
p59RubW2zk/JS5KChY6SaeTPLuDWdGNfFKDzhBqMmvq01aT7Umyp6jp/gl6OvTWMnpCsrwpSbXB1
JZ/y3vybiYzunfo4912GHhC6T/PuIrSg70aKVGnbfKTvOXaouPVbiMZpOrn3X4eBzmC8RhpPfUmo
r7sFrSXa3B9htw9BZ+ivRyXSCdHCq6VWbqVHwpw8lPru5xXNozbp0wx7vA6T4YekEcDSp6MoeTG0
ZTS2KKyhH1XtyjxM4R36+WvA4jpH6CnRo71HxkvvVLNfyKB0eWguOoSk6GFgm5KMXZb51fK77OEe
tAs9B6L0riI+DHQsaMGvlElqprfUlnKXVHd1RRyn2q9tv1WI84aZ+hVKj9SmnL71Ty32pNRf3TpH
iyGtL/s8aND6lNSl96p5ffquEXziWGXuG9K/s1KhQ3qHjJfeq2a/kUPWIZDNIfsuGoUd8tatL8T1
Yp/hjrL74S+IMxC+SYKnD0q03Uf3YXhD1+M9RF4nxGQ/Y8DJ+lXqKK+5TV32OUo9sGF4nxG9H/sm
Er1t89WjH8T15tdSiovlMJPEGaA/ZVXxP91Saj9+p5Ee1Jykvulpj48hHRmkniY1ZK8KClWlwfi1
rJP70rR7SUw5+AZaNwktNYqFOTzqzWtJ7rvypPqV2y8JJ3Ua0xjfnbE1KsVZTm9SPCOyMexWQhld
0P8ApVJU8QsOvNw8I0e2Pnvtm5vtJFz517hvTS+RYbDYZbdV15/eq21f5Iwa+8xFy8ST5jKf7Bo2
UvSxNVRX3KS1pdjlKPbAHE+P6DOjn7HTxOL/ALqk4Q+/W8hdqi5yX3S1MPG7+/IZdGMDHHYynGp+
6i3Uqfcppzn6k0KYTdEbjMTU0xXnUlnUqzcmuMpO/tY4Zt3RM9MpqOKdCDvDDQjQXXTVpPtnrPtG
LWfPw8Belv6vwGFw/pVXPET/ABPUprui5L74MvEk+Y1odfN+AxeJ9KpqYeH4nr1H/DBJ/fBj4lvy
AehdCNTGwq1Fenh1KvPqpLWt2tKPaWmHPw8tK5UdTSNVvzqlSV+blJ+9srHIsfTirFYx0IO8MNCF
CP8AyDVpPtlrPtJi31Ode7wF6TXzdorDUPSxFSeIl92P0dP2VH2icl8Sff5/QZ0V/YKGMxu+nR8V
D79d6mXVDXZKYeN37vzEJ0a0V8942hh35s6kVJ8I7ZPsimzVumcJu6A+kmlPnvGV8TuqVJOK4Rv5
K7FZCTRle67E50u/YMPgsFvp0fGz+/XevZ9UNREjWfjU+78xrQv9WaLxmJ2SrSp4aD5N+MqeqMV+
IXzTHxLff4/UMOg2j46R0jQVT93CXjanDUpJzlfsjbtGV8J05uivaVx8tK4iriJ+dVnKb65Nv3mt
MW7otvTtfIFhMCsvk2GhrrhUq/Sz/wAUV2GcXTqeNT3T+kZoj+q9DYzEeliKlPDQe+0fpanZlBPr
F5MfGN+/x+ojegGjo6R0nh41P3cJeNqcNSknOV+yNu0uV8J05uit6Y0hLS2Iq4ifnVakpvrk2/eW
eGLd3Yi5IqBDQAhq4ABgWEhlpphQkA0wBABoqDCA1YKE2ANFQYAYAYAYAYAYAasEGJWCpWwMtkUb
SAFAGBBhQYAbIoUiA2VBsKFkApFAsgP/0PdFj1vjPyqaAMAMAMCjCAwA0EGAGBAmwUaKDADAowgN
BBgBoIMAMAMAMAMsFGrAGgDLAGgDAgwAwAwAwAwAwAwAwA1YA1YA1YA0AYAYAYAYAaAMCDADADAD
VgDLBRqwBlgDVgDADADQBlgDAgwAwA0AYAYAYAYAYAYAYAYAYAYAYAZYA1YAyxQasAasAZYgNAGA
GAGAGAGAGAGAGAGWKDQQYAYAYAasAZYKNEBoAwAwqDADQBgBgBgBlgBOqAasAaAMAMAMAMAMAMAM
AMAMAMANlBgQYAYAYAYAYAYAYAYAYAYAaCjLAGWKDLAGrAGWAMCjQBgAhkBlgDdgg2EGAGAGBRsK
MAMAMAMAMKDADADADABSQAogMAMAMKDADADYBgUYAbSADRAFAG0RQsqDCAUgoUEGwo2gBQBtAC0g
DYAqwAoA3YKFIINhQtACkALRAKQAsKFIAWgBaIBSChYAtACkwoUEC0woUALTAFEApMoFAC07gG07
EUEANpgCwgwKNgG0wBQBgBsA2mQGwDYBu4UYUCrkQYAbANhRgBoAwINAGAGAGAGXAEtgGgDQBgBg
BgQJbAEhRgBgQaCDTYUaCjQQaKgwAwijTYAlu4QaKDADADABSZAKChaYAoAUmAKChaYAoAUmAKQU
LTCBaYUETIAsWFBUwAiYAVMKCpkAVMALFhQWLACRZFBYsAKmFBUwAqYAVMKCoALFhQWIAREUFiUB
UyAJEKCpgBQoUgBaANoAWFCogCgBaIBRVC0QGygwA00QCQDRQY0QCGgDRQaaCBAUYECGgoS0EA2g
AbQQCaABtFQDaABNAA2ggQ0ADkggE0ACaKgE0ACaCATQAJoqAbQAJoAHJBANoAG0EA2igG0ADaCA
TQAJoAG0ECGgAbQAhoAE0VANoAQ0EA2gAbQQIaKAbQQIaAENACGrACWgBDVwAYAloIEtACGgoQ0V
AhoAQwBDQAhoDQbQQIauADaABtFANoAQ0ADaAENBANoAQ1cDZABpoAQ0AaKgS0QCSg1YgENWKNNN
XIKQ1YoEtBAmwAloAS0AhIGikALAFIgFlULRAFiAGiFZFiAGQUFRAGiAHiFDiIAeIUHiQDiIVmjx
Ag8SKDxAHEQoNEAPEig8QA8QqUaIGR4kAaIUGiAHiFBogB4kUGiAHiBkaIUGiQBohQaIAaIUGQAR
EARBQRABEAEiAEiAEiFCgDaIBRUGyNBSCBQBgUbANAGBBoqBBFGioEyAByAByAByAEMAGwgDIABI
ADIqAEgAMggBIoBSCAEgAMggDJAAZFQN5IABJFQN5IABJBA3kVACSAAyCBvJFACSCAEggDJFAGQB
b+gvRr/abGRhJfRQ8up1LYu15dV3uMZXTp08O6i6eF/pKq846PpPyKdpVLfWt5MexZ9bXAzhPV26
+foOGs6vIJ/or0fn0mxlPDRyTd5v6sF5z9y5tGbdN4Y910Ow+F3pBDRlCnovD2inGLmluhHzY9tr
9SXE54Tfl6evlrxB50Z2eISOh9FVNN4inhqSvOpJJcuLfJK7fJC3TWM7roeiPCLpWn0M0ZT0bhna
VSOpzUF58nzk8ud5cDjjN3b29W9k1B5kOzwA2Hw08XONOmnKc2oxS2tt2SBrY9Q6Zrw8GGhY0KTX
yionFNb5yXlz6orZ+FHCfar35X6rHQ8rPM9DwDW0A9U6Dw0PBhoWWIqpfKKiUmntc5LyIdm/h5TP
PftV9DGfV47HlzE4ieMnKpUetObcpN723ds7vBbsACD014MdD0+iWjqmlMV5LqQ1lxVNbEucnnz8
k45Xd093Rx7Jujzzp3S9TT+JqYmr51STduC3JckrJdR2k08eWXddiIsVkegvAv0ZUNfSdeyjFONJ
vZ9ufZ5t/vHHO+j2dDD1HLOnXSZ9KsdOur+LXk0lwgtnfnJ83Y3jNOHUy7qKcach13wQdFfnvGfK
aivRw7T5Op6K7POfUuJzzuno6GG7v3AHhb6VfP2N8RTd6OHvFcHP0n/lXVfeXCaTrZ91+A5YjTgL
p0C6MPpVjoUWvoo+XVf2Vu628u2+4zldOnTw7qOleGjpOm4aNou0YWlVtsvbyI9iztzjwMYR36+f
oOBHZ4xK6E0RU09iaeGpefUkl1Le3ySu3yRLdNY4910PRHhL0tT6IaNp6Mw2UqkNXmqa85vnJ5c/
KOWM3dvd1b2TUHmQ7PACUqTrSUYpuTaSS2tvYiA9T1pR8FmhFFW+Uzy66s1m+aiu/VXE4+1X0L/J
Y/f+o8ryk5ttu7ebZ2fOGgD074PNF0+hOi6mksSrTqR1+agvMiucm787x4HHLzdPodKdk3R500tp
OppqvUxFV3nUk5PlwS5JZLkjtJp4sru7EcVkd78DPRlOU9JVlaMLxpX428qXYsr85cDlnfR7Ohh6
jnHTvpK+lONnWT+ij5FJfZW/tefbbcaxmnDqZ91FONOQ6P4Mei/+0WNUpq9Ghac+Dfox7Xm+SZjK
6d+jh3X4Ce8MHSj5zxKwdN/R0H5XOo9v8Ky63ImEb6+e7r3DjZ0eYTfRzQk+kWKp4antm839WKzk
+xd7yFumsce66HdPCtpuGgMHT0XhvJ1orWS3U45Jfia7UnfacsJvy9fWy7ZqDzgdniBKVKVeShFN
yk0kltbexAHqLFzj4L9CqEWvlE8k+NWSzfVFbOpLecPar33+TxHlqUnJ3ebZ3eAZYIPS/gz0NDor
gKmksQrSqRuuKprzUucnnz8k4ZXfh7+lj2zdHCtOaTqacr1sRN3lVqZfdWyK5Jaq7jrPDx5Zd3kR
tVr6RrNZQXVfL1RKyOw+Cbov8uxHyyovo8OlGF99Rq7/AIbvqbXA5516uhhu79wrPhK6T/7RYlqD
vRptxhwajk5L7zvnvUVzLjNOfVz7qKM/Iqt/3a9cVZd7t3mnEWboN0afSXExov8Adt3qPhCOcl2t
xS79xMrp06eHdR0rwuaf8ZKnorD2SvF1Esl9iHUvOf4eBjCerv18v5sHGaVVVMQ6q8yneUeqC8hP
tUY9p0eX1GaIwc8XrRprWqTcaUEtutUfs1VJPrFXGbHobpPi4eDnQ8MJRf01ROCa2tv95P15cLx4
HKfar2Z36vHQ85YteJpUqe93qP8AFkl3RTX3jq8VCtIxcHTorbCCT+9Lyn2py1fwgsHp7ojoiHRD
ByxNVLxkowilyXkxivvybl+JX2HG3b34Y9k2POOlcXLpRpCdRy/e1La1tkdifZFXfUdeHiy+1Qzi
lpnF3fkwlNt/ZprN/wAMV6hwzzR1vwVaAemsXU0pWjaEJS1Fu13nlyinlza4GMr6PV0ce67FY6Y6
ej0y0oo3/ZqTaVvqR8qpNdaTa5JGpNRzzy779wpGGj894u9TJVJudRrdHOU32K77DXDlPtUJpp6f
xnleT42peT3RTd2+qK9SHCe1QmtrafxfkKzrVEordFN2iupKy6kTg9qhOlKvzpipeKTcXJQprfqx
tCC67JIsW+aF9IKsZ4iUIO8KSVKLWxqC1br7zTl1sQy5BOkX0FSGG3YeCpv7+cqndOUl1JCGXjx7
hmml8lpUMNvjDxk/v1bS/wACprrTJDLx4/fkZjP2LBUaXpVpOtL7sbwp+vxj6pILfEG6H7DgKk/S
xFRU19ynac++Tp9zBxPiM0J+x0cRit8YeKh9+teL/kVR9dhUx8bv78hHRako4lV5K8MPGVaXB6mc
V2z1Y9ophz8BHaMwctNYmFJvyqs0nJ7rvOT6s2y8JJuhencetKYqpVirRlK0FwgsoLsikhDK7okO
lf7NUp4RbMNTjTf335dT+eUl1JEjWfjx7hrSK+b8BQoelWlKvP7qvTpr1TfVJAvifxGaL/YMDicR
6VXVw8O3y6j7FFRfKZak8S35BHQ+mqeJ+USV4YaEq764eYu2biu0VcOd+7yILBYWppevClHOpVmo
rm5O3vHDEm6JHpZjY47GVHT/AHUGqdP7lNKEe9JPtEazu6HnSL9gw2Ewm9U3WqffrWav1QUO9iLl
4knz/EZgV826MxFb0sRUjQj92NqlT1+LXax6k8T4+CB9CKahi/lM1eGFhOu+uC8hds3FdoyTp879
3lpWKdKppKqoryqlSaS5yk/e2aY5Fh6b4iNXGzpU3enh1GhDqpLVb7WnLtJi31Ofh4B9Kr5s0Xhc
P6WInPETX2V9HT9k3+ITkviSe/z+g10U/q+hjMc9tOj4qn/vK/kZdUNdimHjd+78xAdHNE/PmMo4
bdUqRUnwjfyn2K77C26Ywm7oK6U6V+e8bXxC82dR6q4QWUV2RSQk0ud7rsTXSr+rsHgcEtqpOvU+
9Xd435qEYd5I1l4knz/Ea6Of1Zo/HYzZKcYYam+dV60/5INfiF5MfEt+QheiGiVpvSGHoS8yVROf
3I+VP+VMtumcJ3XQZ9I9KvTuMr4l/wBrUlJck3kuxWQk0mV3dix9MP6twmAwK2xouvU+/Xesk+ag
od5MXTPxJPu3+I10W/qzR+kMa8m6ccNT5us7ztzUIvvF5TDxLfl+I520bcghoAG8gAbVgAU0EAwN
tBAloKNBAloKEAGFQYAYAaaIoS1YA0VBgBgBgBgBgBgBsisFJAGwgwoMAMANkUbQAogMKgUgoUEC
kFCwD//R91npfHflU1YoNWCDRQaAMAMIowAwAwINBBgBqwUasUGgDAowgMANBBgBoIMAMAMAMAMs
FGrAGrAGrAGAGBBgBgBgBgBgBgBgBgBqwBqwBqwBoAwAwA0AYEGAGAGAGAGAGAGAGAGgDLAGrBRl
gDLAGrAGAGgDADAg0AYAYAYAYAYAYAYAYAYAYAYAYAYUGWCDVgDVgDViKMANAGAGAGAGAGAGAGWK
gwA0AYAYAYAasFGrEBoAwAwqDQBgBgBgBgBpxAE2sAaAMAMAMAMAMANlBgQYAYAYAYAYAYAYAYAY
AYAYAYAYAYAYFGAGAGAGAGWAMsAZYATKJQJIgwAwAwAwKNhRgBgBgBgBhQYAYAYAbsAKSIDYBgBg
BgBhQYAbAMCjADYAoiBcWUCwoxEUECDCg2iKFBAoKNoAUAbAFkBsoFoijZQKRAKQApACkAKRQKsQ
G9pVC0QG0ALAFoAUiKCJgCk7ACwBSYUKAFpgCkALTANkAtFApOwAsA2mRQsAUmAKAMCDAoUmAbID
ZQYAKuFGyIMANgGwo3cINgGwDADQBgBgBgBlwDTYUJCDQBgBgBgBgQJbANBRoAwINFQabIo0FGgg
0VBgBhFCWwBJUGAGAGAGAGrgGwBaZAKChSYAoAWmAKChSdwBSAFgCkwoWggImRQRMAKmFBUwAqYU
FiyALFgBEwoMmAFRFBEwAqACxYUFiwAqYUFTACIKDJgBUQBEwoKmAFiwoLEAJEKFoAWgBQULANoA
WAKRALKoWiA2UGAGAGNEAhqwBooMaIBDVig0AJaCDQUaCBDQUIkggE0ADaCAbQAJoqAbQANoIBtA
CGggE0ACaABtFQBkgAckEApIAE0VAJoAG0EAmgBDQANoqAbQANoIBSQAJoAG0EA2gBDQANoAG0EA
2gAbRQDaCBDQQIauADaKAbQQJaAENXAEACGgBDVwBAAloAQ0ECGgBDRQJaAEAA2gLCGgKG0EA2gB
DQANooBtACGgAbQAhoIBtAWEtAaIANWAEtACSoEtEAlooNEFhDVijTRAIasUGmggRYA0AIaAsbQF
KCgiIgUiqFEAWIGRYhQaIAZABYkUFiAOIhQeIAeIUHiQDiIVmjxAg8QocRIA8QoNEAPEig8QA8QJ
RohWR4kAaIUHiAGiFB4gBokAaIUHiBkaIUGiyANEKDRADRADIigiACIAIgoIgAkQAkQAiChYBsih
RWRsijaAFoAwKNoA0AYAaKyEsihIQaZQDYANgCGACYAhgAZIIAyQACRUAZIADIIASQAGRUAZIADI
IAyAASRQAkggBIIG8kUAJoIASRQAkggbyQQBkigbyQQAkigDIIBNXAPSWiMPDwbaJlXqpePmlJp7
5teTDqW/8TOF+1Xux/k8djzRi8RPGTlUqPWnNuUm97ebZ2eG3YaSRUHpPoFoun0J0bU0jiVadSOu
+Kh6EVzk8+1J7Dhld3T3dKdk3R520xpOppqvUxFV3nUk2+XBLklkuSO0mniyu7sRTKyPRPgj6PQ0
Rh6mlcTaKcZajfo04+dLttZclzOWd34e3oY6m6OK9K+kE+k+MqYmWSk7QX1YLzV73zbZ0k082eXd
diulcx3LwNdFvlNWWkKq8ileNO++Vs5fhWXW+KOWdevoYb8ikeETpR/tTjZTg70afkUuaW2X4nn1
WW41jNOXVz7qKEbcB1LwU9FPn/GKvUV6OHtJ8JT9GPvfJW3mM8tPR0cO6/AOfC90q+ecX8lpu9LD
tp22Op6T7PNXO/EYTTXWz3de4ciOjzC49BOjD6VY2FFr6KPl1X9lbut7F133GMrp16eHdR03wz9J
ktTRlFpRhaVVLZ9iHYvKt93gYwnq79fP0Hn86vEJjQGhqnSDE08NS86pK1+C2tvkldkt01jj3XQ9
BeFDTNPopo+novC+S5wUXxVNZO/OTy5+UcsJu7e3rZdk1B5jO7wg2Gw08ZONOmnKc2oxS2tt2SIs
8j1LpivDwW6FjQptfKKicU1vqSXlz6orZ1RRwn2q9+X8niPKbzO7542gg9U9E8FDwbaHnjK6+mqR
U5J7bv8Ad0/XnwbfA4X7VfQwn1eO6PMWOxs9I1Z1qr1pzk5SfFt3O7wW7DYIPR/gi6PQ0PhqmlcT
5KcZajfo045yl2tWXJczjnd+Hu6GOpujifSrT8+k+MqYmeSk7QX1YLzV3bed2dJNPLnl3XYrxXMd
o8DvRX5zxLxtRfR0H5HOpu/hWfW4nPOvV0MN3fuEB4T+lP8AtJjXGm70KF4Q4N+lLteS5JGsZpjr
Z91+A5xY24i8eD/ou+lONjTkvoYeXVf2Vu/E8uq73Gcrp26eHdRf/DL0oVacdHUX5NO0qltmtbyY
9izfNrgYwnq69fP0HCTq8gldCaIqadxFPDUvOqSt1Le3ySu31Et01jO66HoXwj6Wp9D9HU9GYbKV
SGrzVNec3zk8ud5HHGb8vZ1cuyag8znZ4QuEHUajFXbdklvYUepKSh4LdC3dvlM/XVktnNRXek97
OPtV7/7ax+8eXKlR1pOUm3Jttt7W3tZ3eAIAPSngw0LT6MYGppTE+S5xbV9qprPLnJ5rj5PE45Xf
h7elj2zdHBNP6ZqdIMTUxNTzpyulwWxJdSyOkmnkyy7rsQ9isDtPge6K/OFd46qvo6LtC++px/Cs
+tp7jnnXq6GG7v3CteEnpR/tLjWoO9CjeFPg/rS7Xs5JFxmmOrn3Uc9sbcBceg3Rl9KMbCk19FHy
qr+yt3W9i677jOV069PDuo6j4WOkqU4aOou0aa8ZUS2Xirwh1La1zjwMYR6Otn6Dh1PyNT7Kc+3d
fk7R7+Z0eQH0do+ek6lHD003KrPK3N29Vm77kFk34HorptpKHQPRccJQdqtVOKayeedSfbey4Nrg
cp5r29S9k1B5uXkVI/8AG1ftXlNPtyOrwhvHyKbf1nbsWb/ygHqHobo6HQXRfyiurVaiUpJ7c/Mj
6/K4Z3yRxt3XvwnZNjznVx89I162LqO8nrT7ZOyt1XuuUTq8W93YZQ+hoSlvqSUV1R8qXrcO5lZH
efBP0aVGmsdWyUVJwvlZyycupRSs/tS4HLKvZ0cPUc26e6Zl0q0m4wfkxapU08rZ53/E3flbgbxm
o4dTLuorMdTSGKv/AGSd7b/F01s69WNus0580W3weaDn0p0kqlRXhTl42o+d7xXbLdwTM5XUdOlj
3UX3wndKFUqyw1N+Rh43nbfVmtWEeuKbn1rijOMdurn6e78xxLR37PTq1t6j4uP3ql0/5FPtsdHl
gf8AR7RtTHa0aSvUquNGn1zzk+pRTUuCkSrjN/kO99N8ZDoJoiODw7tOa8Wnvs85z63muTlyOc81
7OpezHUHnbBr5Lh6tXfO1KPb5U2upJRfKZ0eGeIMwC+SYetW3ySpQ/FnJr8K1X98LPEGaM/ZaNav
v1VSh96pfW/kU0+ckCeBvQ37NCtiPqQ1Y/fqXiu1R15LnEUx94zQC+TzniX/AGEHNfffk0+6TUuq
LFMfHn3AfR6jGWIVSavCinVknsahmk/vStHtFMeQHReH+eMVGNRu0pOVSW9RV5Tl2JNlvgk3RqvO
p0gxbcV5dapaMdycnZJclklyHCX7V+IV0gxMcXiZ+LzpwtTp/cglGL7Urvm2IZXyHHSX9mnDCrZh
6ag/vvyqndKTj1RRI1l48e4b0r+w4XD4f0pJ159c8oLsilJffYhfE18xkP2DR8n6WJqaq/3dLN9j
m49sGDifEZoL9io4jFvbGHiqf3614vugpvk7Cpj43f35Aei2HjUxUalRXp0VKtNcVTWtb8TtHtFM
ORGUKVXTmJUV5VWtUSvxlN/Fl4TXdQ86TYyGNxU3T/dQtTp/cppQi+1K75tiLnfId9I18hpYbB76
dPxlT/eVrSfdDUj1pki5eNT9+RkP6u0ZJ+ni6qiv93RzfY5yj2wCcT4/oNdFV8i8fjX/AMk9KWo/
+OVPo4dqu5/hLVw8efcIfQGjPnjFUqDdlOaUnwjtk+xJvsF8M4zdCekGkvnjFVcQlZTm3FcI7Irs
SS7CzwZXdEx0t/YVh8Ev+SeinNf8cq/ST7k4x/CSeWs/Gp7hqkvmvRM5bJ4uqoL/AHdHypd85R/h
Y9TifH9FJ6ExWHrzxkvNwlKVbPZrryaa/jlHuGR0/f7lVfCYSek60KUM6lWaiucpOy9bNOcmxO9N
cZDFY6pGk/oqKjRp/dpJQT7bOXaTFvqXdDrTC+bNF4XDbJ15TxM1y/d0vUpy/EJ5pfEk9/ka6Jf1
fRxmO30qPiqb/wCOV/ITXNR12Srh43fu/MV3QGinpzF0cMv7WpGLfBN5vsV2at054zd0D9LdKrTW
Or14+ZKbUOUI+TBfwpEk0ud3diY6Sf1Xo/BYNZSnGWJqddV2h3Qin+ITy3l4knzGuiX9W4THY57Y
0lQp/frvVbXNQU32iph4lvy/EVno9oh6dxlHCr+1qRi+SbzfYrstumcZ3XQddMtKrTmkMRXj5kpt
Q+5HyYfypEk0Z5bomekP9VaKwOE2Sq6+KqL771Kf8sW+0TzW8vEk+Y520bcQhoAG0AIauACauACa
Iiwko00ECWgoSECWgoSVBgBgBgBgBpoihLVgg0UGAGAGAGAC0RWWyojADADADZFGwBRAYVBsKFIA
2ALRAKKo/9L3Wep8d+VTCAwA0VBqwBqxQYAaAMIowAwA0EGBBgBgBqwUasUGgDCKMANBBgBgBoIM
AMAMAMCjLAGrAGrAGrAGAGBBgBgBgBgBgBgBgBoAwA1YA1YA0AYAYAaAMAMAMCDADADADADADADA
DADADADQBlgo1YA1YAywBqwBgQYAaAMAMAMAMAMAMAMAMAMAMAMAMKgwA1YA1YAywBqxFGAGgDAD
ADADADCgwINAGAGAGAGrAGiKNAGFQYAaAMAMAMANOIAmwBgBhQYAYAYAZYAywBlgDLAGWAMsAZYA
ywBlgDYBgBgUYAYAYAYAYAYAYAYAYAYUGAGAAnkRBgQYAYFGwowAwAwAwAwoMAMANgG0iIFBRgBg
BgBgBgBhQYAbCjADYAoiDCg2sgAoUYQC0AbKDZFCggUFGIAWgDYAtEBsoFIihRUG0FCiAUVQtEQb
ChYQbQULIBSKBZAbRVC0RApBQsAWgDd7BQtBApMKFhBtMKFgCkwBYApMAUALTIo2AKTAFAGBBgUK
TANkBsoMANhQq5EGAGwDLhQpMA2EGAGAGAGXAE3CjQBgQaAMAMAMAMCBLYAkKMAMCDRUGMihIUaC
DRUGAGXIoQ3cA0VBgBgBgBoA1ciDVwo2mAKKBadyKFIAWgBSYAsA2sgoWAKTAFgCkwoWmAFTIAkW
AFTCgsWAFTIoKmAFTCgsWAFiwAqZFBUwAqYUFTACpgBYhQWIASIUGTIAiCgqYAVMKCpgBUFBEAKQ
AoKFoINhQQAUiAWigUiKFFAqxAaKDQBhAIasAaKDCAQ1YoNAGmggQFGWCBDQAJqwANoIBtAAmgAb
RUA5IAG0ECGgATQQDaABNFAKSCATQQCaABNFQCaABtAA2ggE0ADaKgQ0ADaABNBAJoAG0ADaABtB
AhoAG0ADaCAbRQDaCAbQAhoIENAA2igQECGgBLVwAYAhqwAloAQAIaAEtBAhgCGigQ0AIaABtAaI
aCAbQANoAQ0ADaKAbQAhoAG0ECGgAYGmmgKQ1YA0AJaCBJVGiIEtFAkg1CGrFFaIBDVig1YIENAG
gDQDZSAFhQtEAooCRIAsQoNEAMgAqIoLEAPEAPEKDxChxEgDxCs0eIEOIgBosig8QoPEAPEAPEig
8QJRohWR4gBosig8QA0QoPFgBokUGiwA0WBkaLCg0SAPFhQWIAeIAaJFBIgBIgBEFBEAEQARABEF
Cwg2RoLDI2gowKFoqDZFGwDGAaANFQaZAJANFQDABgA2ADYAhgApIIASAAyKgBIADIIAyAAyQQBk
UAZIIASAAyKAEkEAJIABJFQN5BACSKAEkEAJBACSKAEkEAJAAJIqDpXgx6MfPGJ+UVF9FQafKU9y
7Nr7OJzzuno6OG7v3Bv4UOk/z3ivEU3ejQbXKU/SfZsXa94wmk62fdde4ctaOjzi7eD7ot/tNjEp
q9GlaVTg+Ee1+pMxldO3Sw7qLZ4X+lHyurHAUn5FLOpbfPcvwr1vkZwjp189+BxB5HV5RY+iXRyf
SjGQw8bqL8qpL6sFtfuXNomV03hj3XQ6/wCF3pFDRtGnorD2itWLqJejBebDttd8ktzOWE9Xp6+e
vswedrHd4hJaG0TU05iKeGpK86krLlxb5JXb5Ilumsce66HonwhaVp9CdGU9G4V2nUjqc1D05PnJ
5dsnuOOM7rt7ereyag8xHZ4AbD4eWLnGnBOU5NRiltbeSQXWx6i0jWh4LdDKlTa+UTVk+NSS8qXV
FbOqKe04T7Ve+/yWP3jyvKTk7vNs7vnBNiqPU3RnBQ8Gmh54uuvp6iUpRe1yf7un2Xz4Ny4HC/ar
6GE+rx2PMWOxk9I1Z1qr1pzk5SfFvM7a08Fuw0CD0r4KdA0+jmDqaVxXkucG4t+jTWbfXJrLikrb
Tjnd+Hu6OPbN0cG6S6dqdJMXUxVTbN+SvqxWUV2Lvd3vOsmnjzy7rsQRWB3bwMdFPlFSWkay8ine
NK++VvKl2LJc3xRzzy9Hs6GG/IofhF6Vf7VY6U4u9Gn5FLqW2X4nn1WW41jjpy6ufdRQjTkOneCz
op/tHjVUqK9Chac+Dl6Me15vkmt5jK6dulh3X4Cb8MXSv51xKwdJ/RUH5Vt9Tf8Aw7OvWJhNNdfP
d17hxo6PMLN0Q6OT6U4ynho3UW7zkvRgtr9y5tGbdOmGPddDs/hf6RQ0bQp6Kw9orVi5pejCPmQ7
bXfJLic8J6vT189fZg86nV4Q80fgKmlKsKFJXnUkoxXN+7jwQWTY9MdLsdT8HWiIYLDv6apFwT35
/vJ+uy4NrgccZ3V7879XjqDy4d3gG0rhR6m0FhoeDHQ0sRVS+UTSk09rm/Mh2b+HlM4X7Ve/GfV4
7HmHFYmeNqSq1G5TnJyk3vbd2zs8FuwEIPRvgn0BDQmFqaUxPk60Xqt+jTjnKXa1lyXM5Z3fh7eh
j2zdHEuk+np9JcXUxM8tZ+SvqxXmru28Xdm5NPNnl3XYgDTA7F4IeivzriXjKi+ioPyb76m7+Hb1
6pjO6enoYbu/cIjwodKf9osa6dN3o0LxjwcvSl35Lkk95cZpnrZ91+A5rY284uHQfow+lOMhRd/F
x8qo+EVtXW9i677jGV069PDuo6d4YekqpqGjKFlGKUqqWxW8yHZ5zX3TGE9Xfr5+g4IdXkD3Ruj6
mla0KFJXnUkoxXX7ltfBEWTY9H9M8fT6AaKhgcO7VakXBPfb+0n1u9lwby2HKea93Uv1eOoPMZ2e
AYAeoOjeDh4NtETxVdfT1EpST2uT8yHZfPheT3HG/ar34T6vHY8418VU0hKrWqNyqVJK/Nyet7rW
58jq8Nuwis7a7Wy6guaW/wBSv19QB3nwVdG44Txmkq9lGCcKbexKKtOfqa/iOeV9Hs6OGvNHL+mP
SF9Kcb4138WvNjwgs+9rN82zcmnnzy7qKjrNxlJ7ZO3Xvfrt3mnMdG8HPRb/AGgxkXUV6GHSnPhK
TzjH48o24GMrp26WHdfgLB4U+lPzhWnhqb+jw61XwdWeT/hjrLlK/ImMb62e/HuHH5rxNCK3zlrd
kbxj63LuRt5hM4DQtTTmKo4Kn51kpPhfypt/du1z1Uib01J3XQ77070zT6N4ano+hl5F5LhShuf3
2lDndnPGbezqZds1+9Dzfgm4KpXlm1FpN75Ty77a0lzidXhg3hYOjQnJedUapxXHZKVufmrqkCD0
bgKUPBhod1JpfKJ5tcakl5MeqK29UnvOPtV7p/JY/ePPGPrSdKOu26laUqs29rzcY35+e+qSOrw3
8wPHL5PRpUd7TqS6521V/CotfeYL4HoPwbdHoaHw0cbXtFRpykm9i1rOcv4VGPLVlxOeVe3pY6m6
OQ+EPpDLT+KTd1GMbqPDWztyerqqS+smbxmnn6uXdRW9Lfs8aWH+pDWl9+paT7UtWL5xNRzy9w3p
b9mhSw/1I68vv1LSfdHUi+aZIZe4a0qvktKjh96j4yf3qlmv5FDqbYL48DNIL5HhqNHfO9af4soJ
9UVrL74L4gzEfsWDp0/SrydSX3YXhD1+Mf8ACwt8T4jcP2LBN+liJ6v/ACDp2b7HJx7YMJxPiM0e
vkWFrV/SqWow7fKqNdUUovlME8T+AzQK+SKtiv7qFof7ypeMe1LWmvuCmPjyBdG6MZYhVZq9OhF1
Zp7GoZqL+9LVj+IUx5+AbaPwstOYqMJSzqzvOT3Ju8pPqV2y8JJ3Ua0vi/njEzqQWU5WhHhFeTCP
Ykl2Engyu6HnSiSp1lh4u8cNBUlbY5Ru6j7ZuTXKwjWfu9wXpj9gwuHwvpNOvU66ltRdkFGS++xD
LxJPmMor5u0dOfp4qooL/d07Sl2OTh/CwcT4jXRtfIlXxj/sabUP95V8iPak5TX3RTDx59wYdHNH
x0liqdOp+7Tcqj4U4LWm/wCFPtFTGboaaSxk9M4idZry6s3Ky+08kvYizwzbuiW6XyVGvHCxfk4W
EaOWxyWdR9s3LssSN5+73BWkP6t0dQoeniJOvP7sbwpr/HL8SBfE+Pka0Cvm7C4rGPztRUKf3qt9
ZrqgpL8SLfJj4lvyDHopo+GkMZTVX91C9Sr/ALumnOXelbrYqYTdEVpLGz0viKleWc6s5SfXJ3sv
Yixm3YsHTSSwtango+bhKUaTts8Z51R/xya7ESN5+PHuWMqL5q0SlsnjKus/91RyXfOT/gHqcT4/
orXQpfI6lbHPZhaMpx/3kvIpr+KWt+EZGHjz7hV9HYCela9OhDOdWcYLrk7GnOTfgTPTTHwx+Oq+
K/dU7UqX3KSUI99r9pMWupd0PNM/1XozC4b0q8pYmouT+jpepSl+ITzWr4knv8jOiH9XUsXj3to0
XTpv/jlfyE11R132Eph43fu/MVjQmipabxVHDQ21Zxjfhd5vsWZq3TnjO66Eh0y0pHTGPrVaf7vW
1Ka3eLgtSHqSJJprO7olNPL5q0Xg8JslWc8VUXKXkUv5Yt/iE81rLxJPmNdCP6uhjNIPbh6DjTfC
rW+jjbqTk+wmXuTp+N33T8xTdF6PlpbEUsPDzqs4wXXJpG6xJsWDp/j4aQ0jW8X+6pNUaa3alJKC
tydr9pnFvqXdFLZpyA2UCGADasAIaAAtWCBDA00BSWAJANBAhoKNBBhQYAYAYAYAaaIBJQaAMAMA
FxAzWwIwAwA2RRsKFEQYVBsA2FCiINlUKRALKD//0/dZ63x35VMIDCAwAwA0EGWKDVgDRQaAMIow
AwA0EGAGBBgBgBqwUasUGiAwKMANWCDADQQYAYAYAYAYAYFGrAGrAGrAGBBgBgBgBgBgBgBgBgBo
ATYA0AYAYAYAYAYAYAYAaAMAMAMCDADADADADADADADADADQBlgDVgoywBrVAMsAaCDADQBgBgBg
BgBgBgBgBgBgBgBhQYEGgDLAGrAGrEUYAaAMAMAMAMKDQQYAYAYAasAaIo0AYVBoAwAwAwAwAywB
qwBlgo0UGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGFBgBgBgBgBgAiSCBJAbAMCjADADAD
ADADCgwA3YIFJEBsKMAMAMAMAMAMKDADYBgUYAKSIg2AYUGABVmFGyAWgDZQbIoUgg2FGwBaANgC
kQCig2goWRBsqhRAKAFIAUFCkECgoWgDYAtACkRQtBBtBQQA2gBYBtMKFhApMKFACkALIBSZQKAF
p3ANkUE2gGAG0wBYBgQYFG0wBRAYAbKDYBtMgNgGAGwDdwoUmEGrgGrhRoAwINAGAGAGAGAGmwgS
2AaCjADAg0EGBQkKNBBoqDADG7EUIbuAaKgwAwAwA1ciBNwo0UGAGAC0wBSyIBYApMKFACkwBYAp
MKFgCkwBQAtMKCJkAVMAKmFBUwAqCgsWQBUwAqYUFTACpkUFiwAqYAWLCgqACphQVMAKmFBYkAVM
KCRACxACxCgqACoKFoAUFCkECgoWgBSACIA2iKFlAtEBjQAnYUGgDCAS0AJKDNpAIasUGgDTQQJC
hLQANoIBtAA2ggG0ACaKgG0ADasEA2rAA2gAckEAmgATRUAmgATQQCaABNFQDaABNBANoAG1cAQ0
EA2igE0EA2gATQANoAG0EA2AIaABtBANooBtAA2ggQ0ADaCAbRQIaCBLAENACGgBDQAhqwAhoAS1
cAQAIaCBDRQIaAENACGgLA2rgUhq4QDaABtACGigG0ADaAENAA2ggQ1cCwhqwGmgBLVgBIBpoIEF
UaIgS0UCSDZDVig0QCLWKg0AIaANAC0QCiqFkBtFAREAWIUGiAGQAVEUFiAGiAHiFDiIAeJFB4gZ
o8QqHEQA0SKDxADxCg8QA8SKDRAlHiFZHiAGiRQeIAaIUGiAHiQBYhQeIGRohQaJAGiAGiFBogBo
hQVEARABEFBEAEACABEAEQUbIBSAFAGBQpFQKIowA2AaAMYQJZQJZAaKgQwAbABsAGwBDCAUgAMg
AEggDJFAGQAGQQBkUAZBACQAGSCAMigBIIASAG8kVACSCAEkAAkioASQACQQAkioASQAvB4Kekas
aNNXnNpJc3+swSbHoDpDjKfg90XHDUH9NNOMXvu/Pn2buGS2I4z7Ve3K/VzQ81SVzu8ITCm6zUYp
uTaSS2tvcQHpWnGHgv0Q5OzxE/XUksl1RXek97OPtV7v7ax+8eYa9WWIk5zbcpNtt7W3m2dng5AG
UHpvofo6n4PdFzx2JVqs4qclvt6EFzd8+Deew4W91e7CfVzdHmzSekaml6069V3nUk5N9e5clsXB
HaTTxW78iPKyPR/gq6Pw0BhamlcV5OtFuLfo01m31ytlySttOOd34e3o49s3Rw7pTp+p0mxdTEzy
1naMfqxXmr48Xd7zrjNPLnl3XYr5pgd18DnRVVpy0jWXkU7xpX2a3pS6kslzb3o4530evoYeoonh
C6VPpVjZTi/oad4UlyW2X4nn1WW41jNOXVz7qKIbcR1PwU9E/n/F+PqK9Cg1J32Sn6Mfe+StvMZ3
T0dHDuvwDrwudLPnrFfJKTvRoNp22SqbG+zzVz1uJMJo6+e7r3Dj51ecXDoN0Xl0rxsKOfio+VVf
CK3db2LrvuM5XTr08O6jqXhk6TxoxhouhZRiouqlsSXmQ9kmvunPCerv18/SDz4dXjEroPQ9TT+J
p4akvKqStfgt7fJK7ZLdNY4910PRHhG0xT6FaNp6MwuU6kNXmqfpSfOTuud5PccsZu7ezq5dk1B5
hsdngC6NCWJnGEE5Sk0opbW3kkVZ5HqnFTh4KNCqEbfKZ5J8aslm+qK2dSW88/tV9C/yWP3jytKb
qNybbbzbe1s7vnjViA9RdBtGU+gGiqmkMSrVKkVNrfq+hBc23d82k9hxyu69/Tn1c3R5v0rpOppm
vUxFV3nUk5P4LklkuSOsmnhyu7sR5WR6E8DvRmOFhPSmIsopSVNvYorz5/5U/vHLO+j29DDXmjlP
TXpNLpVjJ18/Fryaa4QWzte182dMZpw6mfdRUjTkOseCbop8+Yv5RUV6OHaeeyU/RXZ5z7FvOed0
9HRw7rv3BXhY6V/PmL+TU3ejh21lslP0n2eau17xhNHWz7rr3DlBt5xauhvRuXSnGQw6vqedUfCC
29r2Lm0Zt06dPDuuh1vwv9JI4KnDReHtFJRdRLdFeZD3tcFHiYwnq9PXz14g89nZ4w80fgKmlK0K
FJXnUkoxXN+7jwRL4WTY9K9LMdT8HWiYYPDv6apFwi9+f7yfrsuDa4HGfar3Z36vHUHmBI7PnhVg
D1B0bwdPwbaIniq6+nqJSkntcn5lPsvnwvJ7Ecb9qvoYT6vHY8043GT0jVnWqvWnOTlJ82dZHht2
GpUHoPwRdHI4GlPSmItFWkqbe6K8+fqsuSfE5Z30ezoY680ck6YdI5dKMZPEO+p5tNcILZ2va+bZ
0k082efddirmnMdQ8FvRX5/xfjqivRoNSfCUvRj73yVt5jO6ejo4d1+AeeFrpV88Yr5LTd6VBtPg
6m99nmrnrcSYTS9bPd17hzSl5Ci+ClPt2Jd6XebcBOdF9Bz09i6GGhdZ6839VbW+5K3N23kt01hj
3XQ7J4T9Mw0PhqWicN5GvGKlb0aayS7bZ8k77TljPV6utlqdsHn1y1lOey7slwW3LqSt1M7PEDUc
K8TUp0Yptu2S2tyzy52sutE2utj0piqsfBloh2t8pqN58as9r6orZyS3s4+1Xuv8lj9/6jzXiNac
YQzc5tzfFuWST47Lr7x2eGg+rGriLZOnTXY4wWf8Vn2yC+o714N9Ex6P4OrpbF5TqRcrvaqe3vk8
7b/J4nLK78PZ0se2d1HGNPaaqaalVxVTKVedkvq04Wer1X1c+MWdJNPLllvz7xDYn9no06e+V6ku
3KKfYnJcplYo694OOivzhiY1ai+iwiXVKtLyn2wuk+cYnPKvT0sN34fmIPwjdIJdKsfHC0X9FSl4
uPBzbtKXVuT4K+8uM0z1cu66FFko6WxWrFtU7pJ/VpwVrvqirvqNuPNEt0e0TLplpGNNK0JS1p29
Gmt3YrRjzsS3TWOPfR2vwj6dhS8Xo2GULeMr2ytSh5Wpycrexekc8Y9fVy9Px+A8+4FfOmKdStnG
8qtTmleUlyvsXNo6PFPNCcDH52xXjK2cW5VKv3VeUu15pc2kOCeb5GsJF6axetVeU5SnUa3RV5Ta
6knbuLwT7VGqalp/F+V5PjZtye6MdrfVFX7EOD2qNV3LT+LtTVnVmowjuisoxXUlZdSJwX7VCdL1
lpHEtUk3BONOkt7jFKMe1pJvm2ImV3QvpDUSreJg7woRVKLWxuPnNcpTcpLkxFy/IL09+yeKwq/s
YeX/ALyflT7V5MH9wRcvHgb0kvkOFo4f0p/TVPxZU0+qK1l/vAXxNfMZb5vwH28TP/lHTfslN99M
JxPiM0V+wYaviX50l4in1zXlvsgnF/fQq4+Jv5DXRiKoVZYqXm4aDqZ75qypr+NxbXBMUw9/uDDQ
+A+d8TCnJ2UpXnLhFeVOXZFNlrOM3QjSuMlprEzqpZ1J+TFblsjFdSsl1Engt3RIdKpqlWjhou8M
NBUstjkruo+2blblYRrP3e4L0p/V+Cw+G9KpfEVPxeTTXZFOS5TEL4mvmNaPXzdgK9fZOu1Qh91W
nVfdqR6pME8T4+AjolTVKvLFTV4YWDrO+xyVlTXbNx7LimHv9whsBg6mmsRClF3nVmld8ZPa/ay8
MSbod9J8fDSOLnKn+6janS/3dNase9K75tiRrO7ofdIf6uw+GwS2qHjqv36tmk+qCh2tki5eJJ8/
xGaPXzXo2vX9PESVCH3Y2nVf+CP4mXknifHwAdDMPGWLVeor08NGVea4+LzivxS1Y9oyTpzz8PIr
svGaUrXzlUqz7XKT97ZWeRYemtePyr5PTd6eFhGhF8dTz32zcn2kjXU517vDUExq+adFUqWyeLqO
tLj4uneFNPk5Ob7EPVb4nxGdDP2D5Rj3/wAk1J6j/wCO1PIp913L8Iph43fdBV9E6NnpfEUsPDzq
s4wX4na/ZtNWueM3dCV6ZaRhpPHVZUv3UGqdL/d00oR70r9pJ4a6l3RIaa/qnRmFwuydeUsTU6n5
FJdylL8QnmtXxJPf5Guhn9XQxekH/YUXCm/+O1vo426k5y7CUw8bvun5ip6I0bLTGIpYaHnVZxgv
xO1+zaarnJvwJjpxpGOk8fWlT/dQapUlu1KaUI260r9pMfDXUu6JHSv9UaHw2H2TxVSWJnx1I/R0
11Py5do5rWXjGT3+RroAvkNSvpCWzB0Jzjw8bP6Omv4pX7Bl7jp+PPug57J3zNOIQ0ADaKBDQANo
AQ1cADIAQEWEgaJANMASAaaAEAGAGioMAMAMAMAMAEuIBq1gDQAqIEpQGWyKMANgCgDAgwA2FCkA
bCBSChSIBaAP/9T3ZY9b478qmgDADCAwgMAMAMANFQasAaKDQBhFGAGAGBBoAwIMAMAMANWCjVgD
QUYAaCDADQQYAYAYAYAYAYAYFGrAGrAGgDAgwAwAwAwAwAwA0EGgDADLAGrBRlgDLAGrAGAGAGAG
AGAGAGAGgDADAgwAwAwAwAwAwAwAwAwAwAwA1YA1YAzVANWANWAMANAGAGAGAGAGAGAGAGAGAGFQ
aAMANWANEUaAMAMAMAMKg0AYAYAYAasAaIo0VBoAwAwAwAwAwAwAwAywBqwBoqjADADADADADADA
DADADADADADADCgwAwAwAwAwAwAwAwA01cAQQGAGAGAGAGAGAGFBsA2kRAoAwKMAMAMAMAMAMAMK
DADYUYAbRAKCDADCgwAXEKFkAtAGygwihaANoA2AKQAoA2gBYBgULIDZQKRAKQApACwo2ggWRQqJ
QbIBaKBSIBaKBRFC0AbAFgGwoWEG0FCwgUFC0AbIBaKDayACAG07EULAMANp2AFJ3IDZQYEG7hQp
MgMANgGFApMA2QGAGAGwDADADQBgBgBgBgBgAlsINBRoAwAwINBBgUJCjADQQaKgxuxFCGwDRUGA
GAGACWyASUGAGAGAGBBtBQsAUnYihQAtMAUAKTAFBQtMAUALTuAKTCgiYAVEAWLCgqYAVMAKmRQV
MALFhQWLACpgBUyKCpgBUwoKgAkQoNEAImFBUwAyZAETCgqACoKCoALFhQRAC0AKQUKAFoAUgBaA
FIihZQKiQCigxq5AIaCjRUGACWiASUGEAhqxQaANNACQBDQANoIBSQANoIBtAA2ioBtAA2ggG0AD
aCATQAJooBNBAJoIBNAAmgAbRUAmgAbQQDaABtACGggE0UA2ggFJAAmgAbQAhoIBtACGgATQQDaK
BDQQIaABtBANoAQ0UCGgBDQQIaAEtACGrgCABDQAhoASADaAEtFQIYANoAQ0BoNoAQ0EA2gAbQAh
ooBtAA2gAbQAhoIEgahDVgK0AJaANACWggTYqhJECWiiwkg0Q1YoNEAhoqDQAmwApACkFCgBaIBS
ACxCg0QAqADIigsQAsQBxEKDxADxIoPEDBxEKDRADxCg8SAPEKDxADxIoNECUeIVkeIAaJAHiFBo
gBohQeIAWJFB4gZo0QA0QoNEgDRCg0QA0QoMgAiIAiACIKFoAIgAkQAkQoUQCkAbCDYaCkECgDAo
2AaAMCDRUCCKNFQJkADkADkADkAIYAJhAGQAGSAAyKgBJAApBACSAAyKgDIADIIAtFACQQAkgAEk
EAJIoASQQAkigBIIG8kEAJIoASCDtvgz6PRwFOWksRaKs9RvdFedPt2Llfics76PX0cdeaOVdLek
EukuKnWd1BeTTXCK2dr2vmzpjNPPnl3UVWSK5jsHgo6LfK6rx1VfR0nanffPe+qPt6jnnXp6OG/I
qXhE6Uf7S4t6jvQpXjT4PjLt3ckjWM059XPuo56zbiOk+DDop/tBi/G1FehQalK+yUvRj73yVt5z
yunfo4d1+AfeFvpZ87Yj5HSf0VB+Vb0qmx/w7OvW5DCaa62e7r3DjrOjyi4dBui8uleMjSd/FR8q
q+EVu63sXfuM5XTr08O6jpvhg6URpRjovD2UYqLqpbEl5kPZJr7vMxhPV36+foOAHV4xM9H9B1Ok
WJp4altm83ujHfJ9S79gt01jj3XQ754StN0+iOAp6LwvkynDVdtsaext85O6vv8AKZxwm/L2dXLs
moPNB2eEOMHhJ4+pGlTWtOclGKW9vJBZNj0/prFU/BdoiOHotfKJpqL3ubXlz6o7vwo4T7Ve/K/V
Y6HlhvWze07vnjSVwg9TdH8HT8F+iJ4mul8oqJSkt7k/Mp9m/h5T2HC/ar6OM+qx3R5gx2MqaRqz
rVXrTnJyk+LZ6Hgt2GoQelfBZoCn0awdTSuK8lzg3Fv0aazv1yezirW2nDO78Pd0ce2bo4R0m0/U
6TYupiamWs/Jj9WK81di28Xd7zrJp5M8u67EAVgd08DXRP5TUekay8ildUr7HLfLqitnN8YnLO+j
1dDD1FJ8I/Sv/avGuUH9BSvClzW+X4n6rG8Zpy6ufdRQYmq5Dpfgy6Jf7TYxSqK9CjaU+Dfox7dr
5J8TnldO3Rw7r8BYvDF0s+cq6wNJ/R0Xedt9Th+FZdbfAmEdOvnu69w4qdHkFj6K9Hp9J8XTw0Ml
J3nL6sF5z9y4tpC3Tphh3XQ7b4V+kENBYWnorC+TrRWul6NNbI9crZ8ln5xywm/L19bLtmoPOJ2e
EOsFgp6QqQo01rTnJRiuLeRNrJsendPYun4MNERw1Fr5RUTjFra5teXU7N3DyUcZ9qvdlfqsdDy3
tOzwDAo9Q9E9H0/BxoqeMxC+mqRUpLfn5lPrzz4NvcjjftV78J9XN0ea9I6QqaVrTr1XedSTlJ83
7tyW5HaeHht2GRUHoTwQ9Go4KnPSmItFJSVNvdFefP3LkpcTjnfR7OhhrzRynpl0kl0pxk67uoLy
aceEFs7XtfNm5NPN1Mu67FVNMDqXgr6KfP2L8fUV6NBqTvslP0V731JbzGV079HDuvwDjwsdK/nr
FfJaTvRoNp22SqbG+zzV28Rhjpetnu69w5KdHmFk6KdHp9J8XDDxuk3ecvqwW1+5c2jNunTDDuuh
2Xwr9IIaIw8NF4a0bxjrpejTXmx7bXfJcznhPV6utlqag88WOrxBxhcLPGTjTppynNqMUt7eSQ2S
bHprSteHgw0RGjSa+UTTSfGo15U+qO78KOPtV77/ACWI8wpOo+Lb72dXgD+a17qPpSUIvio2/wCW
WFHovoPoun0PwFTSOIVp1I6yW9U/Qgucsu+Kew5ZXb3dPHsm6OCaa0tPTGJrYqo7yk7LhnkkuWqn
Y6SaePLLd2ItQTcIPYlrS7c3/Kl2lZHZPBF0b+W1p6RrLyYNqnfY5vzpdiy63yOederoYb8ireEH
pC+leOjCm/oYeTDhm85dTyfUaxmnPq5d1FNpVlOpOsslBXiuHowXWsnzUWachbegPRh9Iquo19G2
vGP7EGpNdcnqpclLgZyunTpYdwuvhe6S3cNGUMox1XUS4+hC3Lbb7vAzhPV16+fpByDEUPlFeNBO
0YWhfalbOcuq+tLqOjzXnQe6JwkukOOjGEbpyuovZqxyjFvhsjfde5L4XGd1HonpFj4dAtFulTle
s4u0t7nJ+VPru724LLYcp5r25Xsg8zaP/Z6dStvS1I/emmn3RUupuJ2eGDeFXyWhUq+lP6OHtm11
K0XymQniD0H0M0bT6A6MnjsSrVakVJrfb0ILm7583nsOdu69nTn1c3Rw7SGkamMhVxVV3q4qduqE
bSa6r6ijyi0dI8ly3594YQ/Y8JKXpV5aq+5Czl3y1bP7EkE4nxGUv2PCSl6VeWovuQtKXfLVSf2Z
IHE+I3h18iwtSp6VZ+Lj92NpTf8AgXNOSBPEGYFfIsNVr+lP6GHbnUa6o2i+VQE8Qa0T+x0q2Je2
MfFw+/UTTfZBSd9z1RVx8eRvQH7NKeKf9hHWj/vH5NPtTev1RYpj48+4C0Bh41a3jKivTop1Zp7G
o7Iv70tWP4hUxgFgcPLTmKSqS/eScqk+CzlOXYrscEm6E4ytPT2KbhHyqs1GEOCfkwiupWS6hwX7
VBekOIjVr+Lpu9KjFUoPioZOX4pXn+IQyoP0gXyONHBr+yhrT/3lS0pdqWrB84sRcvHgZi183YGn
S9PES8bL7kbxprtevLq1WC+J8Rmjv6uwdbEPzqr8RT6naVRrqWrHqmCeJv5DXReKw9WeLl5uGg6i
vvn5tNfxtPqTFMPf7hG6I0e9M4mFJu2vLypPdHbKT6ldvqF8M4zdGtN4/wCdsTUqxVoylaEeEF5M
I9kUl2CGV3RJdKX8klTwS2YaCjL/AHsvKqdzep1RQjWfu9w3iF82aOhT2TxU/GS/3dO8YLtlrv8A
DFg4nxGujn9X0sRjXtpw8VS/3lVON192GvLk7Crj48/vyI3o5o2OlcVTpzyppuVR8KcFrTf8KfaW
1jGboZ6Y0hLTOJqV5LOpNyS4JvJLqVkuoshle6ib6Xv5HKlgVswtNRl/vZeXU7m9X8KMxrPx49wx
L5q0U/r4ypb/AJBUf+FNr+AvNOJ8f0CehkVhatTGyXk4Sm6ivsdR+TSX8bT6osZGHjz7hWcFg6ml
q8KUM6lWaiuuTtn3l2xJsiZ6ZY6GMxk40v3NFRo0vuU1qp9rTl1sRrO7rR3pVfNGjMPhvTxEniKn
3VeFJf45fiRJ5q3xJPf5GdD/AOroYnSD/sKTjTf/AB2teEbdS1pdgph43fd+orGh9Fz0ziaWGh51
WcYrld7ezaatYxm7oSXTHScdLY6rOn+6i1TpLcqdNakLdiv2kx8Lnd0SOmf6p0XhcLsnXlLE1Orz
KS7lKX4hzWsvEk9/kZ0I/q1YnSL/AOSai1Tf/Hav0cO68pfhJTp+N33T+IpujsBPStenQp+fUnGE
euTsarnJsWLp7joY3H1IUv3NBRoUvuUlqLvacu0mLfUu78PAe4r+ptCUqeypjazqy/3VHyYJ9cnJ
rqHNW+MfjfyHPGjTiEtAA2AIaKAbQAhoAFNAAggS0BqEgVoAS0AaANBBqwUJAMANBBhQYAYAYAYA
asAatYAWRWGBRuwQKAMCDADYUbAFEQbKo2gBSAFkB//V93nqfHflU1YATYA0UGAGEBhAYAYAaKgw
A1YA1YoMANEUYAYAYAasEGAGBBgBgBgBqwUasAaCjQQYAYAaCDADADADADADADADVgDWqAZYA0AY
AYAYAYAaAMsAYAYEGgDADADADLAGWAMsFGrAGWANWAMAMAMAMANAGAGAGBBgBgBgBgBgBgBgBgBg
BgBgBqwBlgDWqAJasAaAMAMAMAMAMAMAMAMANFQYAYAJsRRoAwAwAwAwoNBBgBgBgBlgBNiKNAGF
QaAMAMAMAMAMAMAMAMAMsAasAasVRgBgBgBgBgBgBgBhQYAYAYAYAYAYAYAYAYAYAYAYAIeRAaAM
AMAMAMAMKDdggUQGwowAwAwAwAwAwAwAwoMANgGBRsAURBgBhQYAbAFIKFgCkRQoqDCKFIAUAbAF
IAUAYgBZAbKBaIo2UCkQCgBSAFIAUUCjKjaKBZAKRQLIBSChQApACwBUQBQApBQoIFIKFAC0AKAF
IAUAKQAoAUmRQoAwAwAUmAKIDCgwAUmAbIDADYBlygUmQGwDADADADADADADADTYQJANBRgBgBgB
oIMuAJCjADQQaKgwihDYBoqDADADLgCGyA0UGAGAGAGggwA2FG07ACwBSZFCwBSYAoAWmAKChadw
DaYAsAImFBUyAKmAFQUFiAFiFBUyAKmAFTCgsQAsSKCxACRADJhQVMAKmFBUAFiwoLFgBERQWJQF
TIoKmAFTCgqAFoAUgoWAKiAKAFoAWRQtFApEAooMAMIBLQUaKg0AaaIBIBoAQ1YoNAGmgBAAhoIB
NWABtBANoAG0ADaKgFJACGrhANoAE0EAmgAUkVAJoAE0EAmgAbRUAmgAbQQDaABtAA2ioBtAAmgA
bQQCaABtAA2gBDQQDaABtAA2ggG0UCGggQ0ADaCAbQAhooENACWggQ0AIaAENXAEACGrACWgBDAE
NACGioENAA2gLCGgKG1YAQ1YIBtAA2gBDRQDaABtAA2gBDQRWgNEtAGgBLQAkAS0ECWiqEkQJaKN
EkFJasUCSAS0VAkAwAWiAUVQsgFIqgkSANEAKgAqIoLEANEAPEKDxADxIocRAwNEKDxADxIoPEAP
EKDxADRIoPECUeIGR4hQaJAHiFBosANEKDRYAaJAGiFSjRYEGiFBosgDRCg0WAHiAFQUFRAEQARB
QtABIgBIgBIhQsA2iAUVBsijaAFoAwKNoA0AYEGioEsihJUGpAA2ADYANgA2ADYAKQQBkgAEioAy
AAyCAMgAMkVAGQACSAAyCAMkUAJIIASQACSKgBJBA3kigDJBACQQN5IoLB0V6Oy6SYqNLNU15VR8
Ir3vYu/cZt03hh3UdB8J/SGOEpx0dQskkvGW3RXmw975W4sxhPV362evEHC2jq8YkdB6GqafxEMP
T2yeb3RW9vqXwJbprHHuuh23wgaZp9EsDDR2F8mU46uW2MN7fOTuv4mcsZvy9fVy7JqDzgzs8INg
sFU0jVhRpLWnOSjFc2Fk2PSOnMZT8GWio4ei14+aai97m/Pn2bvwo4z7Ve7K/V46Hl2b1s3tO7wB
Kg6jSSu3kkgD1DovD0/BZoiVaqk8ROza41GvJh1R3/ia2nC/ar3yfVY/ePMWLxc8fUlVqPWnOTlJ
ve3mzs8Fuw2KD0x4PNC0+hej6mk8X5M5w1s9safoxXOTs7fdW1HHK78Pd0seybo8/af01U6Q4mpi
avnTd7bktyXJLL1nWTTxZZd12IU0yPQPgf6LRw8ZaUxFlGKkqV9iS8+ftS/FyOOd9Hs6GHrRy7pz
0ol0rxkqyv4qPk0lwit/W9r7txvGacOpn3UU405Dr3gk6I/PWJ+V1V9DQaavslU2pdnnPnbic87p
6ejhu79wbeFbpb/tBi/EUnehQbStslP0pdmxdr3lwmk62fdde4cpNvMLt0B6KPpXjI02voYeVVf2
Vu65bOq73GcstO3Sw76Oi+GPpUvJ0ZQaUYWdW2z7MOpbWvu8DGGPq79fP0g4EdXjEx0f0JU6RYmn
hqXnTeb3RW+T5JZ+olum8ce66HoPwk6ap9DdH09F4TyZThq5bVT9JvnJ3XPymcsZu7ezq5dk1B5j
OzwA2Gw88VONOCcpzajFLa28khSTY9T4upT8FOh1CLTxM8k/rVZLOXVFbOpLazh7VfQv8lj948sT
m6rcpO7bu29rbO754SAeoOg2iqfQDRlTSGKVqlSKk1vUfQgubbz5tJ7Dhle6vf052TdHnLS+lKmm
8RUxFZ3nUk2+XBLklkuSO08PFllu7EcGR6B8D/ReNCMtKYiyjFSVJvYkvPn7Yp/e5HLO+j2dDD1o
5f046Ty6V4ydbPxUfJpLhFb+t7X123G8Zpw6mffRUDTmOo+Czon/ALQYvx1RXoUGpO+yU/Rj73yV
t5jO6d+jh3X4B74W+lnzzifklJ3o0G722SqbH/D5q56wwml62e7r3DkVjbzCzdEujk+lGLhh43UX
nOX1YLa/cubRm3TeGHddDsvhY6RQ0Rh4aLw1o3jHXS9GC82Pba75L7RjGb8vX1stTUHnc6vEHODw
c9IVI0qa1pzkoxXFsLJsemdOYqn4MdERw9Fr5RNOMWtrm/Pn2bvwo4z7Ve7K/V46Hl5u53eAYkQH
p3oZoyn0A0ZPHYlWqzipNb7ehBc3fPm89hxyu69/Tn1c3R500ppKppivPEVXedSTb+C5LYuR1k08
Nu/IYFQd38EPRdLW0lXVoxuqV9n2p9mxfi4HLO+j19DD1o53076UPpTjJVE/ooeTSX2Vv63t7luN
4zTj1M+6iqYbyXrfVV+3d67FcoOi+Dzox/tBjIqavRoRUqnBuWaj1vY+UTOV079LDuvwFk8KvSr5
ZX+R0n9HQ8qpbfU2RX4bq/O/AzjG+tnvx7hxuML6kHv8qXJfklddZ0eYSmhNFVekFdUaa8urLVXC
K2yfUl6nYlumsZ3Ud46d6UpdEcDT0ZhnqynCzttjTXny65Z9flPac8Zvy9fUvZNQeeKUmlUqva/J
XXK9+zVuuV0dXiGTpuFOFNK8qj1mlt+rFdfnPmpIA9RaKwtPweaMTqW8a4rW33lZytzUfKl1Xscb
9qvoYz6uDzXHGTxuIq4yo7yTdT8TfkrsbTt9WLOrw73dhphV8npTq75fRx7fOfYvJf3wzB3XwTaB
jorD1NJV7R1k9VvdTj50u1+qN95zyvo9nRx1N0c06cdIpaeq67ulLylH6sM1TT52vP8A5CG5NOHU
y7hWdIr5PGnQ3xWtL787N9y1YtbmmWOd9w6T0K6K/PeMhTmvoMGl4zhKq3dx555PjGC4oxbp36eH
dfgC+FXpLLTWJjgKGcKUrNL0qjyt+HZ1tjGHWz7rqDmukl8prxoUvKULUoW9Jp5tfek3JdZuOF8+
BrSn7VXVGl5UYWpU7elZ5tfek3L8QL5GtMPxtZUaflRpJUoW3tPNr70nKS6xDIa05JQqKhHONCPi
1bfJNub53k5W5W4Fhl7vcFac/Z5Qwy2UI6sv94859z8jqiiRcvHj3DemP2SFLCrbCOvP/eVEm12R
UYtbmpcRDLx4GaQXyHDUqHpT+mqdqtTT6o3kv94C+JoZU/q/BKPp4mWs/wDdwbS/indv7iBxPiMw
X9X4SrW9Os/Ew+6rSqPu1Y81KQJ4g3oL9ijVxb/so6tP/eVLqPbFa01zihTHx5AOjuFjVr+MqK9K
jF1Zrio7I/ilqw/EKmM/gG2FoVNP4pRb8utO8pPdd3lJ8lm3yLwT7VG9N41aTxEp009TKNOPCEUo
wXXZK/MkMruh70maw0qeDWzDw1Zf7x+VUfZJ6vVFEi5+73DeOXzbgaVD0678dP7qvGmv8cuqUWUv
ifHyM0X/AFbg6+J9Kp9BT7Veq+yNo/8AIQUnib+QH0WoxVd4ior08NF1ZJ7G42UI/im4rqbFMPf7
hFYXC1dOYmNNO9StNK74yebffdjhmTdDrpLjoY/Ey8V+5ppU6X3ILVi+22s+bYi53dD3T6+bsPh8
EvOUfHVfv1UnFP7sFHqcpCLl4kg1gF81aPrV3lPES8RT+4rTqtfyR/E0FnifHwA9EMPF4nx9RXpY
aLrTW56nmx/FNxj2iphPO/d5EDq1dL17Zyq1p9rlN+9s0xyJvpjiIzxPiKbvSw0Y0IPjqedL8Uta
XaSNZ8/DwDY9fNOjKNHZUxU3Xnx8XC8Ka6m9eXcJ5q3xPj5GdEf6ujiNIP8A5J6bVP8A3tW8Idy1
p/hFMPG77vzFb0PouWmsTSw8NtSajfhd5vqSzfJF3pjGd10uz/pZpOOlsZUnT/dRahSXCnBasPUk
+tiRc7uqktOL5p0dhcIvOq3xNX8Xk0l2RTl+Mk8tZeJJ8xrol/VlHFaQeTpU/F0n/wAdrXimucY6
8u4Uw8bv78isaE0VLTeKpYaG2rOMb8E3m+xZ9hq1jGbuhIdMdKR0vjatSn+6i1TpLcqdNakLdiv1
smPhc7uiU0x/U+isNhdk8TKWJqcdXOFJdVlKXaiTzWsvEk9/ka6CL5vliNIvZhKMpQf/AB2p5FNd
7cvwjL3HT8bvugpGEws9IVYUoK86klGK4uTsvWbrnJsWvwg4qFXHOhSd6WFhHDw6qStJ9stZ9pnF
vqXzr3eBRjTkEtBQhoIBtACGigG0ADaAANWCDQFhLQGiQDQAloA0EGgDADVgo1YA0AaCDCgwAwAw
AwA2iKyUkBGwgwA2AYFGwoURBhUGw0FIiBSKBZAf/9b3eep8d+VTADADLACdUA1YINFUYQGEBgBg
BoqDADADVgDVig0QGBRgBgBgQaAMCDADADADADVgo1YA0FGggwA0EGAGAGAGAGAGAGAGAGWANWAN
WANAGAGAGAGAGAGAGgDLAGWAMAMCDQBgBgBgBgBgBlgDVgoywBqwBgBgBgBoAwAwAwIMAMAMAMAM
AMAMAMAMAMAEtACbWANAGAGAGAGAGAGAGAGFQaAMAMsAJsRRoAwAwAwAwqDQBgBgBgBpoKEkBhUG
gDADADADADADADADADADADADLAGrAGWKo0AYUGAGAGAGAGAGAGAGAGAGAGAGAGAGACZEAkAwAwAw
oNhBuxAbANhRgBgBgBgBgBgBgBhQYAbAMCjYBtEQbAMAMKDADYUbAFoAWiKFFQYRQpACgg2FG0AK
ANgC0QGygUiKFFQbQUKIBRVC0RBsKFoINhQtAGwBZAKQULQQbQUEANoAWAbQUKCBSChYQKQUKAFI
gFlBiACAGEAQKMAMAMAFJgCiAwoMANpgCtpAYAYAbANplAogMAMAMAMvYATcINBRoAwAwAwAwINA
GNgCQowA0EGioMIoS2AJAMKgwA02AJuAaAMAMANBBgBpsijQBtMoFACkwBRFC07gCkALQApAC0Ab
TsFCwBaYAtMALFhQWLIAsWFBUwAqYAVMigsWAFiFBUwAqZAETCg0WAFiFBYgBUFBUwAqYUFTACoi
gsQAsQAsQoKgAqCgiAFBQsAUgBQAtACgoWiAUgBZQbIowqDRAaaChJUGgDTVyASAaAEtWKBIBpq4
AhoAG0EAmgAbQQDaABNFQDaABtAA2ggHJAApIIBNFAJoIBNAAmggE0ADaKgE0ADaCAbQANoIENFA
JoAG0EAmgAbQANoAG0AIaCAbQANoIBtFAhoIBtAA2ggQ0AIaAEMoENACWggQADasAJaAEPMAQ8gB
DQAloAQADaKgQ0AgbVwNENAA2gBDQQDaABtFANoAQ0ADaAEWCBLQGoSBSWgDQAloASAJsECWigSQ
WEtAaJAEtFAkAS0RBpFAsihUQBQAtAC4hQaIAVABURQWIAaIAaIUHiAOIhUHiQZGiFB4gB4kAeIU
HiAGiFB4kAeIVKPEDI8QoNEANEig0QA0QoNEAPEgDRCpRosCDRCg0QA0WRQaIAaIAaJFBUAEQARB
QRAC0AEQARACwBRFCioNkUbChZUGEUbAMANAGisjTIoQAYyoBsAGADYANgA2ACkEAZAAZFQBkABk
EAZFACREAZFAGQQBkABkUAJIIASAASKgBIIASQACRUAJAAlB1GopXbySW9hB37A0afg60a6lSzrz
za4zfmx6lv7XvOPtV7ZPq4PPGMxM8bUlUqPWnNtt8Wzu8VuwxkGR6F6F6Jp9C8BPH4pWqTjrPio+
jFc5O1+dluOOV3Xu6ePZN0cE03pappzETxFV+VN3tuS3JcksjtJp48su67EKwyO9+Czo1DRtKWlM
TaK1ZeLb9GC86fbsXK/E5Z30ezo4a80ck6ZdJJ9KcXKu7qC8mnHhFbO17XzfA6YzTzZ591FTZpzH
ZfBH0R+cK3y6svo6T+jT3z49UfbbgzlnXp6GG/IrXhL6Xf7TYvUpu+Ho3jDhJ+lLt2LkubNY46Y6
ufdRzc24jo3g16I/7T4tSqK+Ho2lPhJ+jHt38k+KMZXTt0sO6izeF/pb8vqrAUX9HSd6jW+fDqj/
AIr8DOEdOvnvwOJnV5RZuiHRqfSrFww8bqPnVJfVgtr69y5tGbdN4Yd10Ox+FjpJDQ+HhorC2jeK
10vRprzY9u18vvGMJvy9PWz1NQeczs8QkNFaMqaZrww9FXnUkkve3ySzfIl8NYzfgekul+k6fg40
XDBYZ2rTi4xe/wC3UfN3y4N5ZROEndXuzv1c1B5dO754VTpus1GKbk3ZJbW3uCj1Ng6VPwU6HdSa
TxM82vrVGso9UVt6m9rOHtV75/JY/ePLeJxE8ZOVSo3Kc25Sb2tvNs7vn27ALFB6b8HGg6fQzR9T
SeL8mc4a2e2NP0UucnZ23+Stpwyu7p7+lj2TdHnzpBpup0ixNTE1fOm8luit0VySy9Z1k08eWXdd
iFKwO+eBzompOWk66ShC6pX2X9KfUtifG/A5Z30ezoYetHP/AAgdK30sxkpxf0NO8aS5b5dctvVZ
bjeM04dTPvoo5pyHTfBf0R/2kxfjKivQoWlK+yUvRj73yVt5jK6ejo4d1+AmvC90t+dcR8ipP6Ki
/Lt6VTY/4dnXfkZwi9fPd17hxs6PKLJ0T6Oz6UYuGGhdRec5fVgtr9y5tEt06YYd10O0+FbpFDQm
GhorC2jeK10vRprZHrds+S+0c8Zvy9fWy7ZqDzmdXiDrA4KppGrCjSWtOclGK4thZNj05pzF0/Bh
omOHotfKJpqL3ub8+p2bvwo4z7Ve7K/VY6Hl1u+Z2fPGAHp7olo6n4OtFzxuJVq04qUlv+xTXPPP
g275I437VfQwn1c3R5w0npGppetOvVd51JOTfuXJbFwR1keG3fkMDSDv/gi6MRw0JaUxFlFKSpN7
El58/al+Lkcc76PZ0MNeaOX9Nek0ulWMlWzVOPk0lwit/W9r67bjpjNPP1M+6ip2K5jpngx6J/7Q
4vxtRXoUWpSvslL0Y+98lbeYyunfo4d1+AlPC10s+dcR8jpP6Ki/Kt6VTY/4dnXfkTCNdbPd17hy
A6PMJ7ozoCp0lxUMNTy1neUvqxW1/Di7LeS3TWGPddDt3hP09T6O4SGi8L5LlBKSXo01lbrlv4q9
9pzxm/L19bLtmoPOdjq8Qk8DhZYlwpxTlKpLzVtaW5de7mg1Jsel5Sp+DTRdsniJ3bf1qjV2+qKy
XUltZw9qvd/bcHmablic5u8qknKUn25v+Zs7vByESldSnsv5MeS/JWXUyA9F+D7QdPongpaQxXky
cL57VDb3ydlzSicsrt7elj2TdHC9PabqaerVcVU86pK0V9WK3LqVlzu+J0k08mWXd5DKdFzdOgsr
ZyfByzbfUrJ8LMqfcOqeDDo3894qWOqR+hotKmnvkl5P8Kt225nPK6ejo4d137gw8I3Sv56qTVN/
QwbpU7bHazqT/wAMVxjfiy4zTPVz7hzjEfs9GFPfPy5eyC7ry5qSNuN8C06B6Ny6RYyngo3UKSvV
kt2+fbe0FxsnsM26dMcO66HUPCTpuFJU9E0HqQsnW1fQpxV1HuWtbgkt5jGerv1cv5sHDsPNaQxE
qtRfRxvOUdyjHZDqfkwXWjo8nNDjQlGppLEurbXmnrJfWqSdoLtk02vqqXAVcfNHofHTh4NdEOMG
nXa8761WW2We223PdGxy9qvbf5PH98jzhoyTo+MxUndwVot76k7qL60taafGK4nWvDPeM0T+yxqY
n+7WrD/eTul3JSknxiuIpj48jeiP2VVMS/7NWh/vJ3Ue1JSmucVxFMfHkZoX9mc8S/7FXj/vJZQ7
VnPqgxVx8efcM0HBU5yxEleNCOvnvle0Fz8pptfVUhUx9/uA9D0FiKzq1fKp006lS+9LYn96TUfx
C0xCcDSemsVes3aTlUqy+yrym+u17cXZDgnmjUtfpFi8rKVWdkt0U9n4YruSHB7VGtLYhaTxDVJN
wWrTpLfqx8mPa9r4tsGV3QbpDNU6kcPB3hh4+Lutjlducu2Tdn9VLgIuXu9wVplfIKVHCb4rxtT7
9RJpfhhqrlJyEMvHgbq/1bgYw9PEy13/ALuDaivxS1n+CLHJxPiM0Yvm/C1sS/On9BT/ABK9Rrqj
5P8AyEJSeJv5BHRqkqNWWKmrww0fGWexzvanHtk02vqplph7/cGGisFLTWJhTlK2vK85PdHzpyfU
k2+ot8JJujNM4/53xM6kVaMmlCPCEVqwj2JJE0ZXdEh0nawsqeDjsw0dWXOrLOo+x+R1RRIufjx7
hvFL5r0fCl/aYmXjZ/7uF4012y15dSiyl8T4jNA/1bQr415SjHxNL79RNNr7sNZ8m4irj48hh0b0
dDSOJiqn7mF6lV/8bgtaXelZc2hWcJuhjpHGVNNYidWSvOrNuy4yeSXsRYlvdRMdLpqhVhg4O8ML
BU3bY6m2o/4211JEjWfu9wVXXzRoyMNlTGT15f7qm2or8U9Z/gQXifEa6JL5A62PezDQvD/ez8mn
3Zz/AAiph48+78xAaI0bPTOIp4eHnVJqN+F3m3ySu3yRq3TOM3dB50p0lHSmLnOn+6janSXCnBas
fUrvm2STS53dEjp1fNWBw2DWU6l8TV65q1NdkFrfjEXLxJPmNdGv6rw2Kx7ylGHiKL/45VTTa5xg
pPtQvkw8S35fiIHo9oj58xdLD3spyWs+EVnJ9kU32Ft0zjO66aK6TaWWm8ZVrpWhKVoLhCPkwXZF
JCTRnd0TPSJfNOBwuBWUpJ4mt96orU0+qCT/ABMk8tZeJJ8xnRP+q8PitIPJ06fiaL/47WTjdc4w
133CmHjd/fkVbQmipabxVLDQ86rOMb8E3m+xXb6jV8MYzd0JHplpSOmMdVnT/dRap0luVOmtWFux
X62THwud3RKaV/qbROHw2ypipvEVOOpG8KS6n5cu1E5rV8Yye/yEdAaawdatpCa8nB0pVFfY6kvI
pL+J3/CMvcdPx59woVSbqNybu27t8WbcgJoAS0ECGgAbQAhooBtACGgAMkRANooNAahLQFJANACW
AJCDADADADLBQmwBoA0EGFBgBgAuJBmtgRgBsKNgGBRtIINhBsKNgCiAUigUQH//1/d56nx35VMA
MAMAMAMANNBAmwBoKMAMIDADADRUGAGBBgUasAasAaAMCjADADVggwIMAMAMAMAMANWCjVgDVgo1
YIMANBBgBgBgBgBgBgBgBgBlgBLQBoAwAwAwAwAwAwAwAwAwAwA0AZYAwAwINAGAGAGAGAGAGAGW
CjVgDLAGgDADQBgBgQYAYAYAYAYAYAYAYAYAJcQBIBoAwAwAwAwAwAwAwAwqDQBgBlgBLRFGgDAD
ADCg0EGAGAGAGrAGiKNFQaAMAMAMAMAMAMAMAMAMANgGFBgBgBgBlgDVgDLAGrFBlgDLAGgowAwA
wAwAwAwAwAwAwAGQGAGFAqwQbIDYBgUYAYAYAYAYAYAYAYUGAGwDAowAUiINgGAGAGFBsA2FGACo
gC0RQsqDADaIoUECgo2gBSANgCkQCig2goWRBsqhRAbQAtACgoUggUFCkAKIBSKBSIBaKBRFC0Ab
AFoA2ALANhQsIFBQoIFEaC0VBsAWgDYApMgFBRgBgBgAtZkBsAwoMCDAoWncgMAMAMANp2AFJ3AM
bsAauAJAMAMAMAMAMCDADRUGrkUaCjADQQaKgwihLYAkAwqDADGAIANAGAGAGggy4Am5FGigwAwA
UmAKAFpgCthFC1mAKTAFACkwBYULTAFAC0wAqYUFTIAqYAVMKCRYAWLCgqZAFTACphQWIAWJFBog
BYsKCpgBUwAsQoLFgBYhQVMAKiKCpgBUFBUAFiFBUAKChaAFIAWAKQAsKFogFFAsgFIKMANFQaAN
NEUJANFQaauQCQDQAloASUGmgATQANq4QDaABtBAJq4ANoqAbQANoIBtAA2ggC0ACaKgE0ACkggE
0ADaKgE0ADaABtBANoAQ0EAmgAbRQCkggE0ADaAENAA2gBDQQDaCAbRQDaABtBAhoAG0ECGigQ0Q
CWigQ0AIaCBDQAhoAQ0AIauAIAEtWAENACGECGigG0BqENAA2gAbVwgQ1cAG0ADaABtFAhoAG0AJ
CKS0BpoAS0AJAEtBAkKEtBAlooEkGoS0BSQBLQQJKo1YiDZVC0QCkUCyAUgoNEAKgAqCgsSALEAN
EKHEQA8QIPEisjRCg8QA8QA8SKDxADRCg8SAPEKlHiBkaIUHiQBohQaIAaIUGiAGiQB4hSixAyPE
KDRIA0QA0QoNEANEKCxIAkQAiACIKFoAKAEAFgGyKFhBtBRgULRUGyKMANsA0AYVAlkAkA0VAgAG
ADYANgA2ADkEAJAAZBAGRQBkABkEAZFAGSCAEgAMkEAZFAGSCAEgAEioASQQN5FACQQBkAdS8G/R
pVpfLqy8iF/F33yW2XUt3PqOeVejo4eoqXTnpK+kOIag/oad1Dnxl27uVjWM059TPuookjbiOg+D
ror8+4jx1VXoUmm77JS2qPVvfKy3mMstO/Sw7rsOPCh0q+da3ySk/oqT8pr0p7+yOxc78hhNL1s9
+ByWRt5hauhXReXSjFqm7qlHyqj+zw63sXa9xnK6dOnh3UdD8K/SiOHjHRmHsopLxttiS82Hsb7F
xMYT1d+tnrxBwRnV4xLdH9BVOkWJhhqW2Tze6MVtk+pd7y3i3TWOPddDu/hD05T6G4GGjMJ5M5w1
ctsae9vnJ3V/vPbY5Yzfl7Orl2TUHmdo7PAHGCwVTSNWFGktac5KMUt7YqybHp3SmJpeCvRMaNJp
4id1F/WqNeVPqju/CjhPtV77fqsR5anN1G5Sd23dt7Wzu8A0lrZLaAeo+juApeDHRU8ViF9PNJyW
9yfmU11b+HlPYjhb3V78Z9XN0eaNI6QqaVrTr1XrVKknKT5v3bktyO08PDbvyGLRWR6Q8F3R2n0b
wk9K4vyXKDcb+jTWd+uW7la20453fh7ujj2zdHD+lXSKp0oxc8TPJPKEfqwWxe98W2zrJp5c8u67
FdK5juHge6I/LKj0jWX0dJ2pX3z3y6o7vtfdOWdevoYb8ipeEjpd/tTi2qb/AGeleNPg+Mu3dyS5
msZpz6ufdRzs24Do3g16If7UYtSqK+Ho2lU4Sfow7d/JPijGWWnfpdPuos/hh6XfL6q0fRf0dJ3q
Nb5/V6o/4uomE9W+v1N+Bw+x1eUWLor0dqdKcXDDQyTd5y+rBbX7lxbSM5XTphj3XQ7j4U+kVPo5
hIaKwnkuUEpW9Gmsrdct/K99pywm/L1dbLtmoPN6Ozwh5gcDU0jVhRpLWnOSjFcWyWrJsendM4qn
4LdExoUWvlE01F73Nry59S3fhRxn2q9+V+qx0PLUpObu829rOz540lcA9R9E9G0/BvoueMxK+mml
KS3/AGKa58eDbvkjjftV9DCfVzdHmzSmkqmmK88RWd51JOT+C5LYuCO0mnht35DAqD0L4JOjEcBT
lpXE2ilGXi2/RivOn7UuV+KOOd9Hs6OGvtUcq6adJpdKsXKu7qmvJpx4RWzte183bcbk08/Uz7rs
VM05jqngr6JfP2J+UVVehQaeeyU9qj1La+xbznldPR0cO679wN4V+lvz1ifktJ3o0G07bJT2N9S2
Lt4lwmjrZ7uvcOSnR5hZ+iPRufSnFww8bqPnVJfVgtr69y5tGbdOmGHddDsXhV6Rw0RQhorDWjeK
10vRgvNj27Xy+8c8Z6vV1stTUHno6vEHOCwdTSNWFGktac5KMVxbIsmx6X0ziqfgw0TGhRa+UTTU
Xvc350+pbvwo5T7Ve7K/VY6HmBtyd3m2dngGJAHpnoXoqn0B0bPH4pWqzipNb1H0ILm3t5tX2HHK
7r39Odk3R560vpOppuvPEVXedR3fLglySyXI6zw8WWW7sRyVysjvngq6MJzlj6q8imtSlfY2vPn1
J3s+LfA5ZV7Ojh6iidOek0ulOJlKD+iT8XSX2U7uX4nZ9StuNYzTj1M+6ilzmvKktnmx6tl+7b1m
nIXfoJ0WfSTGRhNfQULSq8G731etvJ/Zi+RnK6denh3X4C4eFzpQqzWj6L8mLTqW3tbI9S9qtuM4
R16+foOO06adRKWcKavLnbNrtfkp80dHmEloTR1XTVXUhnVry1IvhfOcupLbykS+Fxnd8x3TpnpK
HQjR1PR2E/e1I6kbedZ+dPrk3Zc27bDnJt7Opeyag4BUpLE1o0U/IprVclnlG8pyXHPWa5WR0eLk
bw1X5RWliGsoeUo7VfZCK4pOyt9VPgFnvHoTQOEh4N9FzxWIV8RUSlJPa5PzIdm/8T2I5X7VezGf
VzdHAcVjamIhUxFV3q4iTV/sppyfK71UrblJHV47fX3htUXyTDqPpVnrP7kW1Fdru2vsxYTiDu/g
v6Mx0fh1ja9le81fKys0pPqjez+277Ec8q9nRw1NjnXhG6SvT1eMVdQirpdfm356tnxTlKO41jNO
HVz7qKjpNfJIU8Pvitef35pO34Y6qtulrcTTlfHgb0ovkkaeGW2C1p/fnZtfhWrG26SlxIuXjwFa
UXySFPDb4rXqffmk7fhjqq26WtxEL48DNJr5FSp4ZbbeMqfemvJX4Y26pSkiwvjwNY79hw9Oh6U7
VanarU12Rbl+PkC+Jobr/sGEjT9Ou9eXKEbqC7XrSa4KDBxPiMh/V+DcvTxD1Vypwd5P8UkkvuSW
8hxPiM0evkGHq4j0p3o0/wAS+kfZF6v/ACERSeJsa0CvkfjMW/7FeRzqyuod2c/wCmPjz7gDQOFj
ia2vVV6VJOpU5xj6P4naC5yFTGAdClU6Q4q0n5dabcpPYru8pPkldvkhwT7VGtM4taUxDlTT1MoU
o71CK1YLrslfi7veIZXdDrpJJYecMJF+Th46jtvqPOo/4vJT+rFCLn7vcF6Q/q3CUsPsnVtWqdVm
qUe5uf41wC3xNfMbwP8AVmCq1359dujT+6rOrLu1YdUpcCE8T4+APozSVCpPFzV4YaPjLPY53tTj
/E039mMi1MPf7hGaMwM9N4mFK+dSXlSe5bZSfUrt9Rb4STdBNPaRWlMROpBWp5Rpx4QitWC7kr87
kkMruiR6Sr5BCjgVtox1qn+9qWcr/dWrDriyRrPx4/exlP8AqnR0pbKmLlqr/dU2nL+Kdl+Bl5OJ
8fyCeikFhp1MbNXjhYa6vsdR+TSX8T1uqLFMPHn3CC0dgammsRCjF3nVmld83m31bWXhiTuoe9J9
IQ0liZOl+5glTpL/AI3Base+2s+bZIud3Q/02vmrB4fBrz5/tFXrmrU49kPK/GJ5ay8TXzGuj/8A
VWFxOOeUreIo/fqLy2vuwv2yQpj4lvyER0b0UtM4unSk7U761R8KcVrTf8KfaW3TGE3Q309pR6bx
VXENW15NpcIrKMexJLsLJoyu7sTnSlfNdDDaPWTpw8bWX/HaqTs/uw1Y9dyRvPxqfvyM0F/VGAxO
Mfn1P2al1zV6r7IeTf7YvlMfEt+QhejGiFprGUqMnam3rVHwpxWtN/wp9pbdM4TurRv0h0s9O4ur
iWrKpNtLhHZFdiSXYJNJle67E90nXzRhMJgFlLV+UVvv1UtVPnGCj/EyTy3n4knzGdFP6pw2K0g8
pQh4mi/+OVk02ucYaz7UKYeJb8vxFV0Joqem8VSw0POqzjG/BN5vsWb6jV8MYzd0JLpppSGl8bUl
S/cwtTpLcqdNasbdaV+tkx8Lnd0SmkP6k0PRobKmMqOvPj4uF4U0+TetJdhOa1fGPx8jnzRtyCbA
CGgBDQQIaABtACGigG0ACmgATRECSixoDRDQBoAS0AaANWAMCDQBgBgBlgo1YASAYAaKgVEglLAy
wKNhRgBtIINhBsKMChSIg2igUgBZFH//0PeB63x35VNAGEBgBgBgBgBgBpoIE2ANBRgBhAYAYAYA
aKgwAwIMANWCjVgDQUYAYAYEGgDAgwAwAwAwAwA1YKNWANWANWAMANBBgBgBgBgBgBgBgBqwBlgg
1YKMsAZYA1YAwAwAwAwAwAwAwAwAwAwA0AYAZYA0EGAGAGAGAGAGAGrBRoAwA0AYEGAGAGAGAGAG
AGAGAGAGgBLQBoA0AYAYAYAYAYAYAYAYVBoAwA00AaIo0AYAYAYVBoAwAwAwAS0FGiAwqDQBgBgB
gBgBgBsAwoMAMAMAMAMAMAMAMAMAMAMAMAMsAasAZYqjVgDADADADADABElYgNJBBsA2AbCjADAD
ADADADADADADCgwA2AYFGAG0iAUEGAGAGFBgBsKNgGAG0AERFCyoMANkUKCDYUbQAtAGwDaIBZQY
goWQGygUiAUgBSAFIAUgBZFG0UCiAUigWQCkFCgBSAFgCogCgBSChQQKQUKAFIAWAKQAoA2gBYBh
ALTANhRgBgBtMIFkUYAYUGBBtMAURRgBgBgBsA0AYAYAYAYAYAYEGioNXIo0FGAGAGgg0VBgAlsi
jQBoqDADABDdwDQBgBgBoINNkUaANFBgBoIMANoKFpgCgBadwDadiKFgCkwBYApMAWFC07gCkwAk
WAFiwoLFkAVMKCpgBUwAqIoLFgBUFBUwAqIoNFgBYgBYsKCoAKmFBUwAqYUFiAFiyKCxKAqIoKgA
qYUFiAEChcQDYAQAUgoWggVEKFABEQG0FCwgSFGgDRUGmiKEgGioNNEUJCDQAloASUCGgAbQAOSC
AbQQCaAByQANoqAbQQDauADaABSQQCkgATRUApIIAtAA2gATRUAmgBDQQDaABtWKAbREA2gATRQC
aCAbQANoAQ0ADaCAbQAhoIBtFANoIBtACGggG0AJYAhooENEAhlQIaAENACABDVgBLQAgAQAIaAE
NBAhooBtAaDasAIaABtBANoAQ0ADaABtFANoAS0AJCLGmgNEgCWgBIBpoIENBQmwQJaAEgaJaApI
AloIElUbQQLIoUgBSAFoKCxACoAKgoLEgCxADRCg8QA0QIPEisjxADxCg8QA8SKDRADxCg8QA8SK
lHiBkaIUHiQBohQaIAaIUGiAGiQBohSjxAyNEKDRIA0QA0QoNEANEANEihaACIAIgoIAEQARABEA
bIoWgDYBgUKRUCiKMANgGgDGEGmUCGQGioEMAGwBDABsAGwAUggFJAAJAAZFQBkABkEAZFAGQQAk
ABkggE0UAJBACSAASKgBIABJBACRQS3R/QU+kGIjRjlHbOXCK2vr3LmS3TWOPdR0np9pyGhsPHR+
G8luKUrejDh1y38us54zfl6Orl2zUHC5HZ4w50boyppetChSV5zdly4t8ks2S3Sybo7n0m0nT6Ba
PhhMM/pZpqL3/am+fDnyRyk7q9ed+rmoPOMszs8I1SoSxMlCCcpSaUUtrbySC62PR0VS8F+i7u0s
RP8AmqNf4Y+xcWcfar3f21B5oxVeeLnKpNuU5NuTe1t5tnZ4Ldho0EHpbodoil4P9HTx2KVqs43k
t6XowXNvbz2+accr3V7+nj9XN0edtN6Wq6exE8RVd5zd+SW5LklkjtJp4ssu67EQVgehfBT0Xhoq
jLSuKtHyX4u/owXnT7di5X4nHO78Pb0cNeaOR9M+k8+leLlXd1TXk048IrZ2va+btsSOuM083Uz7
6KkVgdm8EfQ/50rfLqy+iovyE/Snx6o7eu3BnLOvT0cN+RDeE7ph/tJivFUnfD0W1G2yUt8vdHln
vNYzTPVz7r8BzI24C/eDzoi+lWLSmvoKVpVHx4R7fZcxldOvSw7qLv4X+lqrSWjaDtCFnVtsbWyH
VHa+dluM4T1devn6QcJsdXkE70Z6P1Ok2KhhqfpO8pfVitsn7uLst4t03hj3XQ7v4S+kFPongoaL
wnkynCzttjT2O/OWfZrPejjjN+Xr6uXbNQeaDs8IdYLB1NI1YUaS1pzkoxS3tkWTY9P6UxNLwVaJ
jRpNPETuov61Rryp9Ud34VvOM+1Xvt+qx+8eWZzdRuUndt3be1s7vAEWuEHqToloul4NdFzxuKVq
04qUlv8AsU1z48275ROGV7q9+E+rm6PNWltJ1dNV54is7zqSbfuS5JZLkjvPDw3LfkMIioPRPgl6
Lx0bSlpXFWitWXi7+jBedPt2LlfijjnfR7ehhr7VHJemnSeXSvGSru6pryaceEVs7XtfN22I3Jp5
upn30VM05jrngo6IfPmJ+VVVehQaavslPal1La+xbznldPT0cO679wH4Vul3z9ifk1J3oUG1lslP
Y31LYu17y4TR1s+669w5TY28wt3QvoxLpVi40VdU15VSXCK29r2Lv2Jmcrp06eHfR1fwtdJo4ClH
RWGtFKMfGJejFebD3vlbizGE9Xp62evEHn06vGH+jNG1NL1oUKKvOpJJL3vktre5DhZN+B6R6UaR
p+DbRcMJhn9PNOMXvu/PqP3cG1uRxk7q92d+rmoPMG07vnhSjcgPUHR3AU/BpoueKxC+nmlKS36z
8ymurfwes9iON+1X0MJ9XN0ebNI4+ppStOvVetOcnKT5v3bktyOrw27DMqD0D4J+jMcBSlpTE2it
WXi2/RivOn7lyvxRyyvo9nRw15o5T0y6Sy6VYuVZ3VNeTTjwitna9r5u246YzTz5599FWSK5jp/g
x6Jf7QYnx1VXoUWm77JS3R975WW8xldO/Rw7r8A/8K/Sz53r/JKT+iovymtkqmx9kdi535Exmmut
nu69w5GbeYWbojoGfSLFwowyXnSl9VLf+tuwlunTDHuo7V4SNO0+juDjo3C+S5QUWl6MNluuVnff
3nPGb8vV1cu2ag8/Sfi7v6i1V1u9/wDM12HV4gXD4eVepGlBa0lbyVvk2rK3W1HsCyD0fLU8GWi1
FWliqjsvtVZb/ux93FnH2q939tz7/wBR5tqV3XqSqtt2zu9rk9j62/KfHM7PCEuPiaSS86o7/hTs
l2u919lMA9HdBNA0+i2FljsTk1Tdnwgs5Pm5PZxioI45Xb29PHtm6OI6U05U07iauPqZNZU19Vu6
gl91Xlfe1zOmtPLcu67ELBfJqDfpVXqr7sXdvtdkn9mSKxwOueDPon8tlGtVX0dNqo0/SqNeQuqM
Xr9c0tzMZV6ejhsQ3hK6Qy6SY1YSi706UtSK3SqPJvs81dTe8uM0x1cu66FEqwWka8aUHanFaqlw
hG7lO38U2ubNOPNEz0f0NLplpCNOKapXTl9mlGySvxtaKfF3JfDeOPfR2Twhafp4OMdH07KEYa9d
LK1ONtWnls13aPJNbmYxj1dXLXj8RwPAv5ZWniK3lRhepO+yTvlH8Umk+Cbe46PFPPkZo39oqzxF
bylTvUnf0pXyT+9JpPld7hSefIzRi+U1pV63lRp3qTv6Tvkn96TSfJt7hSefIzRsfl1eVav5UYXq
1b+lns/FJqP4gTyNYKHztiHUrO8byqVX9lZytzfmrm0hSeaNUYy0/irzeqpycptbIwWcmlwjFOy4
KxOD2qNVtbT+KtBW8ZJRgt0YryYq/CMUrvgrl4X2qE6VrLSFfUopuEdWnSW9xWSy4yflP7UmIl8g
mnqipzjh4O8KEdS62OV7zlzvK6T+qoiLl7vcCaY/YKdLCLbFeMq/7yaWX4Y6qtulrEhl48DMQvm3
Bxp7KmIaqS5U43UF2vWk+SgwXxPiNYFfNmEqV/TrXo0/u5OrLuahzUpcC8k8TY10disI54yWzDpO
HOrLKmux3n1QYpj48+4M9C4FaUxCjUbVNXnVlvUIrWk+uysuLaW8XwmM3QPG16mn8U5KPl1ZpRit
18oxXJKyXJDgt7qHfSSvHxqw9N3pYePi4tbJNNucvxScmuVluEXP3e4G0p/VmEpYX06lq9XtVqUX
1Rbl+PkRb4mvmM0evmvBVcQ8p1r0KX3cnVl3asPxvgCeJv3+AHovhous8RVV6WHi6sk9jasoR/FJ
xXVctqYT19wi6FGrp3EqK8qrWqbXvlJ7X2u7LwntUPuk+NhjMQ4UnejRiqVLnGGWt+J3k+cjMXO7
odaXXzTg6OEXn1LV6v4lalF9Uby/GWeVy8TXzGaD/qvC18a8pNeIo/emvLkvuwuuuaFMfE38hGdG
9Fx0pioQqZUo3nVfCnBa0/UrLm0KzhN0M9MaSlprEVK8lZ1JNpcFuiuSVkuSLPCZXdE50s/q9UdH
r/knhepzrVLSn/CtWH4SRrPx4935jMB/U2jatfZUxT8RT4+LjaVV9vkw7ZBZ4m/f4DDojo6GOxSl
W/cUU61X7lPNr8TtHrZbWcJuiF0ljqml69SvPOdWbk+uTvZexF0zbuiydMmsB4nR8dmFp2nzrT8q
p3ZQ/CZxdM/Hj3fmN6L/AKm0ZXxLyqYl/J6f3FaVV9Xmw7WW+ak8Tfv8KieieiY6XxlOFTKjG9Sq
+FOC1p+pW62i26TCbqo7TulZacxNXEz21JuVuC3LsVkuoSaZyvddix9K180YbC6OWUow8fW/3lVJ
pPnGGqu1knny3n4knz/EZ0TXzThsVpF5ShDxNF/8drJptc4w1n2oX3Lh4lvy/EVLQ2i56axNLDU/
OqzjFcrvb1La+Rq+HPGbuhL9N9Jw0pjqjpfuaVqVFblTprVjbrtrdpMWupd0VE05hLQAloAG0AIa
ABtBAhooBtAA5K4AAA00RAgqtRphFJaANACWgDQUYAaCDAg0AYAYAYAasFCbAGbAgKFYYFGAG0gg
2EGBRsKNhAogNlUKRECiqP/R95nqfHflU1YATYA0AYAYAYAYAYAYEGrACbAGgowAwgMAMAMANFQY
AYEGAGBRqwBqwBoKMAMCDQBgQYAYAYAYAYAYAYAasFGrACbAGAGggwAwAwAwAwAwAwAwAywBlgDQ
QYAZYA1YKMsAasAYAYAYAYAYAYAYAYAaCDQBgBgBgBgBgBgBqwUaAMANAGBBgBgBgBgBgBgBgBgB
gBoA00ECbBRoAwAwAwAwAwAwAwoNBBgBgAmxFGAGgDADADRUGAGAGAGrAGiKNFQYFGEBligywBhU
GAGwowAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwA1YAywBlgo1YA00EoSGRgUbCjADADADADADADA
DADCgwA2AYFGwDLEAoIMAMAMAMKDYBsKMAMAMACoihZUGAGyKFBBsKNgC0AbANoAWAYALRFGygUi
AUAbKBZAbChaCDYULIDaKBZAKQULCDaCggBtACwDaChQQKQULCDaChYApEAooNgBADADaIBYUYAY
AYAKTIgUFGAGFBgQKTANkUYAYAYAYAYAYAYAYAYEGioNMijQUYAYAaCDRUGEUJbANAGioMAMAEN3
ANAGAGAGggS2FGgDADQQYAYAZcAwAUmFCkAKTsALAFJkULAFJgCgAiAFJ2ChYAtMAKmFBUyAKmAF
TCgsQAqYUFTIAqYAWIUFiAFRFBkwAqCgsWAFiFBYsAKgoKmAGTIoLFgBYgBYsKCIAMmFBUAKQUKA
FoAUgBaAFIihZQLiQCkALAMAEtBRoAwqDTRAICjCoNNEUIANFQJaIoS1cqAbQANoIBtAAmggG0AC
aKgG0ADaCBDQAKSCATQAJooBSQQBaCAbQAKSCATRQDaAENBANoAG0EAmgAbRQCaABtBANoAGwBDQ
ANoIBtAA2ggG0UCGggG0AIaCBDQAhgCGigQ0AJYQIaAENACGrgCABDQAhq4AkAQ0ADaKgG0BYQ0B
Q2gAbQAhoIBtAA2gBDRQDaAEEQJaKoSEajTQFJAEtXAEgGrACLAGggQ0AJA2S0AJKBLREGIAUVQt
EApFULREC4hQZABUFBUQBYgBUFB4gB4gSjxIrI8QA0QoPEAPEig8QA8QoPEAPEis0eIEGiFBogBo
kAeIUGiAGiFBogBkRUo0QINEKDRIA8QA0QoLEANEKDIgCIAIgAiChaACIAIgAkQBRFCkAbCDYaCk
ECgDAo2AaAMCDRUCCKNFQJkADkADkADkAIYAJhAKQACQAGRUAZAAZBAGQAGRUAZAAZAAZBAGSKgB
IABJFQAkgAEggEqbqtRirtuyS2tsoO5YHD0+gGAdWpZ1pbVxluiuS39rOPtPZJ9XBwbHYuePqSq1
Hec223+vUdnit2I+SKg7v0M0NT6JYSePxXkzlG+e2MN0Vzk7ZdS4nHK78PZ08eybo4lp/TNTT+In
XqbZPJboxWxLq9bu951k08mWXddiCkVgds8GPReOGi9JYiyik/F32JLzpv1pdr4HLO+j19HD1o5x
036Ty6UYpzV1SheNNcuPW9r7FuN4zTh1M+6ilM05jqngu6IfPNf5VWX0NF5J7JT2pdS2vnZcTGd0
9HRw3dht4Uel/wA/Yj5NRd6FFvNbJT2N9S2Lte8YY6TrZ9117hyg6POLr0C6JS6V4tQkn4inaVV8
t0euWzqu9xnK6denh3UdB8LfSyMEtGYZpRil43V2ZebBclk32LczGE9XbrZ+kHBWrnV4xNdHdAVe
kmJhhqW2TzlujFbZPq9bst5LdN4Y910O9eELT1LoXgYaMwfkznDVy2xhvb+1J3z+89tjljN+Xs6u
XZNQeZzs8Ic4PBz0hUjSpJynNqMUt7ZCTY9P46vS8FOiVTp2eJnez+tUazl92O7sW1nH2q99v1WP
3jy3VqyrycpNuUm229rb2tnd4AhK4B6g6JaKpeDfRk8bilatOKlJb/sU1z489uUThb3V78J9XN0e
btMaUq6brzxFZ3nUd3y4JckslyO88PDllu7EYVkeiPBN0WhoujLSuKtFar8XrejBedPt2Llficc7
6Pb0cNeaOR9NelE+lmLlXd1TXk048IrZ2va+btsSN4zTz9TPuoqRpyHYPBL0O+esR8srL6Ci/JT2
SqbUuqO187Lic87p6ejhu79wa+FXph/tBifk9J3w9BtK2yU9jl1LYu17xhNJ1s+669w5SdHnFz6C
dFJdLMZGlmqUfKqy4R4db2Lte4zldOvTw7qOo+FzpVHDQjorDWjFKPjdXYkvNh7G+VlxOeE9Xfr5
/wA2Dz+dXjEnobRNXTuIhh6KvObsuCW9vklm+QvhrHHuuh6N6ZaWpeDzRsMDhXatOLjF70vTqPm3
s5vLzTjjO6vd1Mvq5qDzDY7PnhdOm6rUYptt2SW1tgHqPRmGpeCzRMq1VJ4idm19ao15MOqO/wDE
95xv2q+hJ9ViPMmMxk9IVJVar1pzk5Sb3tnV4bdhsaQejfBf0dp9HsLPSmL8lyg3G/o09rfXLdyt
bzjjnd+Ht6OPbN0cX6VdIanSjFTxE8k8oR+rBbF73zbOkmnkzy7rsV4rA6/4J+iPztX+WVl9FRfk
p+lU2rsjt67cznldPV0cN3fuEb4Tul3+0WJ8TSd6FFtRtslLfLq3LlnvLjNM9bPuvwHMjbgLd0K6
Ly6VYuNHNUo+VVlwit3W9i79xMrp06eHdR1HwsdJ44OnHReGtFJR8ZbdFebD2N8rcWc8J6vR1s9e
IOBpHV4w+0do+ppWtChSV5zkkl+ty2t7kRZN+B6P6R4+n4NtFwwuHf0804xe+78+o/dwdlsRyn2q
92d+rmoPMjzOzwDLAHpvonoyn4O9GTxmJX004qUlv+xTXPPPm88kcb9qvfhj9XN0cE0ppKppOtLE
VXebbk/vS2JdSsrfZZ1keS3fkRyioNJ7ILWa5vd7E11hkdu8FPRhQi9I4jJK7p63K6c3fhnZ829y
Oedevo4etHP+mvSh9JcTOsn9FC8KK5b5db2verxW41jNOHUz7qKlCh4xxpLK+cnw33fJLPlmacxf
/B/0e/2nx3jZK1CjZvsyhHryu3yfEzldOvSx7r8Ba/C10oUorAUX5N71LfZ2LqT7nFrcZwjr18/Q
cerUHJ08NHzk/K+/K178LKyfBps28v3CU0Rot9JsbDD0k3TVkt1oR2t8L7X9qQt01jO66HoDpdpm
n0LwPiaNlUccuuV/K627tLZZStsOUm3szy7IPNWEfyanOs/Od4Q62vLfZF265J7js8M8BVJfJaDl
6dZ6seOon5T7XaKfBTRDiD0HoDA0/BrouWJrr6eaTkt7k/Mprq3/AInsRyv2q9uM+rm6OE6Yx1Sv
Fyqu9bES8bUfL0I8ltlbZZw4HWPJlf4hpi18ioQo+lO1SfVb6NdzcueuuAS+BvGr5FQhQ9KdqtTt
XkLsi3L8dtwL4mgrGL5DQhQ9KdqtTtX0ce5uX41wBfEG8SvkGGhS9OrapPlH+zj23c3xThwBfEG6
i+b8Ko+nX8qXKnF+SvxSTk1wjF7wcT4jIL5uwrl/aYjyVypxflP8UkknwjJbwcT4jeB/q/D1MR6d
S9Kn2r6SXZFqP43wBPE2M0L+xRqYt7aa1af+9lfVf4VefJqPElMfHkC0Fh4yqOtUV6dCPjJJ7JNZ
Rj+KTSfK73CmP5AOAw8tN4n6WT8pynVnwirynLuu+byLwkndRrF1p6exXkRzqSUacFuWUYRXUrLs
HBftUF0/iYVKqo0nelQj4uD3O2cpfik3LqaW4kXK/wAAfTS+b6VLBrzorxlX/eTStH8MbLlJyEXL
x4GrfNWB4VMU+6jB/wCaa/k5l5OJ8fyG9A/1dTq417aa1KX+9mmk192OtLlLV4kpj48hjoDAQx9d
eN/c006lV/Yhm11vzVzaFTGbob4qtV09iXO16laeUVxk7KK5LJLkXhL9qh90mrx8bHD03elh4+Li
1sk07zl+KTbXKy3CLn7vcD4/+qcFSw6yqV7Vqn3c1Sj3a0/xR4EW+Jr3+RvQf9WYetjX51vE0fvz
XlSX3YX6nKIpj4m/kI3o7o2OksRGNTKjBOpVfCnBXl2vYubRbUxm6GmlMfPTWInWa8qpK6it19kV
ySsl1DWkt3RMdK2sE6WBi/Jw0bTtvqyzqPsdodUUSNZ+PHu/MKpf1Po2U9lXGS1I8VRpu8n+Kdl+
BlOJ8fyAOiOFgq8sVVV6WFi6sk9jksoR/FNxXVcVMJ6+4V/6XS9ffOrWn2ylJ+9svDPInemOIiq8
cLSd6WFgqUWtjks6kvxTcn1WJGs76e4GkvmXRdtlXGzvzVGk/wDNPvUB6rxPj+QB0Mw0ViJYuqr0
sJB1pJ7HJZU49s3FdVxU6fO/cKxUlU0nWbd51as783KT97ZpjkWfptVjQqwwNN3p4OCpXWx1NtWX
bJtdSRMW8/d7gvB/1JoqrW2VcZLxMOPioNSqPqctWPYxzSfZnxaRnQ/RUNKYyHjf3FJOrWfCnTWt
Lvtq9bLamE3RD6Z0nPTeIq4mp51Wbk+V3kupLJckWeGcru7Fn6W/1Rh8Lo5ZSpw8dWX/AB2qk0nz
jDVXazM8+XTPxJP35GdEf6ow+K0k8pU4eJov/jtVNXXOMNZ9qF9xh4lv78jnxtxCWgBIAhoAS0AD
aAENBANlANoAQ0AAkrACADTREWEFVpphAkASAZYA1YA0FGAGggwA0EGAGAGAGrBQpBWWwI3YINhB
sKMCjABSIgUigwKFoiDZVH//0veZ6nx35VMAMAMsAJsAJAMAMAMAMAMANBBlgDVgDVgDQUYQGAGA
GAGAGioMAMCDADAo1YA1YA0FGAGggwAwIMAMAMAMAMAMAMANWCjWqAJsAYAaCDADADADADADADAD
ADADADLAGggwAwAywAkKMAMAMAMAMAMANAGBBoAwAwAwAwAwAwA1YKNAGAGgDAgwAwAwAwAwAwAw
AwAwA0AaaCBLVgo0AYAYAYAYAYAYAYVBoAwAywAmxFGgDADADCoNAGAGAGACWgowAwoMAMAMAMAM
AMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAB2sEGBRgBgBgBgBgBgBgBgBhQbAMCjY
BliAUEGAGAGAGAGFBsA2FGAGAGAGABIkUEKgwA2RQoINoKNgC0AbAMQAsgNlApEUKKg2iKFACiqF
IiBQUKQQKChSAFEApFApEAtFAoihSAFAC1mAbAFoA2FC0ECkFCggURoLRUGwBSAFAGEAtEBsqjAD
ADaCBRAbCjADCgwIFogMCjADADADADADADAg0VBgAkjQwAwAwASVkYAaZFCQDRUGAGACWwBIBgBg
BoIE3uFGgDADQQYAYAJbCjQBiYAsIFJhQsAUmAKCgidyA2gBaAFpgCgoWmALQAWLACxCgiZAGTCg
iYAZMALEigqACphQZMALEgCxCgqYAVMKCpgBUFBYgBYhQaIAVEUFTACoKCpgBYhQWIAtBQsAUgBa
AFoAURQsoFRIBZQLRAbCjQQaaCjQBoqDTVyATYKNFQaaIoQAaKgS0RQhoqAbQANq4QCaABtBANq4
AJoqBDQAJoIBtAAmggC0UA5IIBSQAJoIBNAA2ioBNAA2ggQ0ADaABNBAOSABNAA2ioBNACGgBDQA
JoIENAA2ggG1YoBtBAhoAQ0EA2gBDQAloAQ0UCGgBDQQIaAENACGrgCABDVgBLQAhgCGgAbRUA2g
NBtACGgAbQAhq4QDaABtAA2igQ0AJIBLRRSQjTTQAkAS0AJANNBAhoKEhAloCwkDRLQAkAwA2igW
QCkFC0ALiAFQAVEUFiAFiAFQAeIUGiBKPEisjxADxCg8QA8SKDxADxCg0QA8SKwPEANEKDRADxIA
0QoNEANEKDxIAsQqUaIEHiAGiRQaIAZBQaIAWJFBkUBCAIgAiCgiACRAFxACRAFhQpEBsqDZGgpB
ApAGBRtAGgDAg0VAlkUJKg1IAHIAGwAbABsAGwgFIADIABIqAMgAMggDIADIqAMgAMggDIAFIoAS
CAEggBIoASQQdQ6A9HVD9ur5Rjfxd9mW2T6t3a+Bzyvo9PSw9aKZ0w6RPpBXvH91C6gvbLrfssje
M05dTPuopskachf/AAf9Fvnit8oqr6Gk9j2SluXUtr7FvMZXTt0sN+Rrwj9Kfnar8mpP6Gk82vSn
8FsXO74DCaOrnvwOWyR0ecWnob0Xl0nxKg7qlC0qj5cFzezqu9xnK6dOnh3UXvwn9J44aC0bhrJJ
LxltiS82C9r7FxMYT1dutn6QcKkdXkEpoHQdTpDiYYeltk83ujFbZPq9bst5LdNY4910O59OdOU+
hOBho/CeTUlGyttjDfJ/ak72fG73I5Yzb19TLsmoPNTOzwg2EwdTH1I0qScpzaUUt7YWTY9L4utS
8FWilCFpYiex/WqNZy+7H4Lazj7Ve6/yU+8eXq1aWJk5zblKTbbe1t5ts7vABpXAPT3RTRVLwb6N
njcUrVpxTkt/2aa58ee3KJwt7q9+GP1c3R5z0zpWrp2vPEVnec3d8FwS5JZI7Tw8OWXddiKsaZHo
fwVdFoaIoy0ri7R8lunrejC2c+3YuX3jjnd+Ht6OGvtUcj6adKJ9LMXKs7qmvJpx4RXve192xI3j
NPP1M+6ipGnMdi8E3Q353r/Lay+hovyU/SmvdHa+duZzzy09PRw35DDwo9Mf9osT4ik74ei2lbZK
exy6t0eV3vGGOmetn3XXuHLDo4C79AuiT6WYtQkn4mnaVV8t0euWzqu9xnLLTr08O6jovhd6WRpp
aLwzSjFLxursy82C5LJvsXFGMJ6u3Xz9IOAWOzxiY0BoSr0ixMMNRXlTeb3RW+T5JfDaZt03jj3X
Q9DdO9N0ugOj4aOwb1as4aqe+MfSm/tSd7c7tbDjjN+Xs6mXZNQeYDu8ALQoSxM4wgnKUmlFLa28
kkF5HqajCl4JtEuTtLEz2/aqNZL7sfYnvkcPar3/ANtY/ePL+JxM8bOVWo3Kc25Sb2tvNs7aeC3Y
AUHpfwdaAp9DcDPSeM8mc4a2e2NPcl9qTtl91bbnDK78Pd0seybo4P0j09U6S4qeJq7ZPyY7oxWy
K6vW7vedZNPFnl3XYgysjuHgj6IrEzeka6+jptqlfY5LbLqju5/dOWdevoYeoqXhF6XPpTimqb/Z
6V40+fGXbu5Jb7mscdOfVz7qOenRxF+8HvRF9KsUlNfQUrSqPjwj2+y5jLLTr0sO6i7+FvpYqslo
2g7QhZ1bbLrZDqW187LcYwnq7dfP0g4cdXkEvoHQtXpDiYYal503m90Vvk+SXw2kt01jj3XQ7/07
01S6D6Pho7CZVJw1VxjD0pPnJ3tzu9xyxm3s6mXZNQeaTs8IJSpSryUYpuUmkktrb2JFND0/gaFL
wWaKdSdniJ5tfWqNZR+7Hf1N7zhftV75PqsR5oxWKnjqkqtRuU5tyk3vb2nV4bdhuEHojwZdHYaA
w09KYryXKDcb+jT3vrlu5Wt5xyyu/D29HHtm6ON9KukM+k+KniJ5ReUI/Viti975tnSTTzZ5d12K
6aYHWPBZ0R+ecR8qqq9Gi8k9kp7UupbXzst7OeWWno6OHdd+4H8JfSlabxCoU3ehRbb4Sksvb5K2
5O62jGaOrnu69w5it2tn6cud9i9a6tZm3AWDov0eqdJ8TDDq9pPXqy+rFe93y46yJbpvDHuuh1nw
odIYaHw0dG4a0XKKUkvRgtke3K/2es54zfl6Otnqag4I4rWUX5sFeXN7/XaN+o6vGHeDw9TFZQTl
Vry1IJbc3m+V3ZX2W1kRZN/MejKvi/Bxo2NCm18oqXSlxm15U39mCz6klvOXtV7v7bmvUedvlHyu
tPESzjDNKWd3sgnxbecuK1mdXi58gFGTo051pO853hF78/Pfc9XnrN7gg774P9DU+h+AnpHFeTOc
dbPbGHopc5PO2/yVtRzyu3s6WPZN0cg6V6XraexNpK85O7it0pZKC+6rR+9rPebk08+d7qIjEUvl
dWGHpNOMPIT3N7ZTb4Xu77opcCsc+B1PwddG1pzFPGzX7Ph7Rop73HY+zzpfbfWYyuno6WPdd+kE
V046RLpXjfFRl+yYe7bW+3nS7fNhza+sJNM9TPuv3QUPD20pXlVqryI3nNLJKK2RXC+UI8Lo04zz
RmE/rOvKtWzhG9SpbLJPzVwu2oLhdbkCeaMwa+c68q1fOCvUq2yyT2LhdtRXBtbgTzRmFXzviJVK
3mZ1KrWVorNpcL5Rjuu0gk80ZRi9O4lyqPVjJuU2tkYRV3bqStFdSHB7VGnrafxVlaKm7LhCEV7I
xXchwvtUZjaj0ziFCinqtxp0o79VeTFdb2vm2xwl80a0zWjXqKlSd6dJKnC3pWecvxSbl1NLcWLl
QTTjWF1MJHZRT1+dWVtfusofhvvEMvHj3BWkf6uw9PDLz52q1e1fRx7IvW6523EL4mhtf1Zg7/2m
JyXKlF5/xSVuqD3MHE+P5DNEr5uo1MW/OzpUfvyXlS/DF9kpRYq4+PIBoDDRdSVeqr0qEfGST2Sa
doQ/FKyf2bvcWpjPX3Btg8PU0/ikpS8qpJynN7lnKcnySu31DhJO6jNM41aVruVNNQVoUo71CK1Y
rrtt4tt7yTwZXdD3pE1g/F4KOygnr231ZWc+6yh+HmI1l48e78xut/VOBjDZUxTU5cqUH5K/FJOX
VGL3l5OJ8fyGaA/q2nVxz2014uj/AL2aea+5G8uUtXiSmPjyI/QOjY6TrxjUdqUU51ZcIRV5dtsl
zaRbUxm6AaTxs9N4iVW3lVJeTFblsjFckrJdQnhLe6iU6UTWFlTwUHeOGi4ya2OrLOo+/wAlcooR
rPx49wW/6n0fwq4x9qowf+ea7ocyHE+P5BHRaksLKpjpq8MLHWinsdV5U13+U+UWKYe/3CDwGDqa
bxEKUc6lWaV3xbzb9rZqsSbof9KMfDH4hqj+4pRVKl9yGV/xO8nzkSNZ3dD3SX9TYClhtlTENV6v
KGapR7taf4ojlb4mvf5Guisfm2NbSEv7COrS51ql1D+Fa0/woUw8efd+YruidGz0ziKeHh51SSjf
hfa3ySzfJFvhiTu8B/0r0lDSeKk6X7mmlSor/jcFaPf5z5tiLnd0SGkf6l0bSw6yqYpqvV4+LV1S
i+vyp9sSctXxNe/yEdDaawc6ukJq8cJDWinsdWXk0l3+V1RFOn48+78xVMPh6mk60acbyqVJpLi5
SdvazbnrYsfTbFQliFhqTvRwsFRg+Lj58vxTcnferGcW87517vCwej/UeiZT2VcdPUjxVGk7yf4p
2XNRY5q+zj8fyVHdDNGQ0jjIyrfuKKlWrfcprWa7XaPaXJnCbvwEFpjSU9NYipiKnn1ZuT5XezqW
xcizwzbu7Fr6Xf1Nh8Lo1ZSpx8dXX/HaqTSfOMNVdrMzz5dM/Ek+Y5+0bcQgAS0AJaAEAA2gBDQA
NoIENFANoADJEAJqxQaAEtERqElVWmggQAaCDCgwgNWCjQUYAaCDADQQYAYAKQVmlBEYUGyKMCjA
DaCBQBsKNoIFoijCg//T95nqfHflUwAwAwAwAwATYASAYAYAYAYAYAYEGgDQBlgDVgDQUYQGAGAG
AGioMAMCDADADVgo1YAywBoKMCDVgDADAgwAwAwAwAwAwAwA1YA1qhQmwBgQaAMAMAMAMAMAMAMA
MAMAMANBBgBgBqwUasAYAYAYAYAYAYAaANBBgBgBgBgBgBgBgBqwUasAYAaAMCDADADADADADADA
DADADVgBLQQaCjQBgBgBgBgBgBgBoqDADADVgDRFGgDADCg0EGAGAGAGAGrAGiqMAMAMAMAMAMAM
AMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAEyAEgGAGAGAGAGAGAGAGFBsAwKN2IBQQYAYAY
AYAYAYAbKDYUYAYAYAYAYQC4ggKUGAGyKFBBtBRsAUgBQBgAsgNlApEUKKg2goUQCigUiAUFG0EC
yKNooFEApFAsgFIKFACkALAFRAFACogGwBaChQAtAGwBSIBZQbQAsAwA2iAUQGyqMAMAFJhAoijA
DADCoNoAUQGBRgBgBgBgBgBgQaKgxkUJCjADADQQaKgwA0yKEsA0VBgBjABgGAGAGggS8wo0AYAa
CDADTYUJANAGBBgApMKFgCkwBQAtO4ApOxFCwBaYAoAWmAK2BQsAImAFTCgqZAFiwAsWFBYsAMmR
QVMALFhQWLADJkAVMKCpgBYsKCxACphQVMAMmFBYgBYsigsSgKiKCoAKmFBogCwoIAKQAoAWgBQU
EQBtEAQoFIihYBoAwIE2CjQBoA08yoEtEUaKgS0RQkA0VAlqxADaKATQQDkgAckEAmgAckVANoAG
0EA2gAUkACkggE0UAmggE0EAmgATQANoqAbQANoIENAAmggE0ADaABNAA2ggG0UCGgAckADaCAbQ
AhoIBtFANoIENACGrhAgAQ0AIaAENFAhoAS0ECGADaAEtACABDVgBDQAhoAQ0EA2iiwNoChtACGg
AbQANoIENAA2gAbQAlooEkQJaKrUJCK01cASAasAIasAaCBDQUJCBLQGiQKS0AJKBaIBSAFIAWFC
kAFQAVEUFiAGiAFQAaIUGiBmjxIqDxADRChxEANEig8QA8QoPECDxIMjRCg0QA8QoNEgDRCg0QA0
QoPEgDRCpRogQaIAaIUGiQBkFBYgBogBohQVEAtABEAEQUEiAEQAtABADaIoUVBsijaAFlBhFGwD
ADQBorISyKEgGMqAbABsAGADYANgApBAGQAGRUAZAAJBAGQAKRUAZAAZAAZBAGRQAkggBIABIqCf
6MdH3p+vqvKlHOb5cFzfxZm3Tphh3C2dPukCw8VgaGSSSnbct0F7+xcTOMdOrn6Qcfkjq8okNDaH
qadrxoU9r2vdGK2t/rN2RLdNY4910Ot9L9MU+iOEjgsLlUlG3OMd8n9p527XuRzxm3q6mXZNQcBk
js8QVhcHPH1I0qa1pzaSXNgk2O/4utS8GmjlCFpV57PtTazk/sx+C2u5x9qvbf5KDzfXqyxEnObb
lJttva29rOzw0N9VyyWbCD0d0c0ZS8HWj54vEr6aaTkt/wBmmufHnfcjjb3V7sJ9XN0eeNMaUq6a
rzxFZ3nN3fBcEuSWSO0mniyy7qIlhkegvBl0YhoShLSmLtFuLcL+jC2cuuW7l945Z3fh7ejh2zdH
IOmPSefSvFSrSuoLyacfqxXve188tiR0xmnm6mfdRUjTmOzeCfob851fl1dfRUn9Gn6U1v6o/wCL
qZzzyeno9PfmiG8JnTL/AGlxHiaT/Z6LajwlLY5dW6PLPeXHHTPV6ndfuHMTbzi++D7og+leKSmn
4inaVR8eEVzfqV3wMZXTt0sO6i8+FvpcpW0Zh2lCFvG22XXmw6ltfOy3MzhPV262fpBwax2eMTvR
vQFXpNiYYaltk7ylujFbZPq9bst5m3TeGPddDvXhB0/S6FYGGjMH5M5wtltjDfJ/ak759b22OWM3
5ezq5dk1B5nOzwhzhMJPH1I0qUXKc2oxS3tkJNj0/iKlHwT6KUY2liZ7PtVGs392PsstrOPtV77/
ACWP3jy5XryxM5Tm3KUm3Jva2822dng5Aig9PdCdC0vB9o+ekMWrVZxu1vUfRgvtN2vzsn5pwyvd
4e7p4/VzdHnbT2mavSHEzxNZ+VN7NyW6K5JZevad5NPFll3XYhysjv8A4I+iMaKelMTZRin4rW2J
Lzqj5LNLtfBnHO+j2dHD1o5x0/6Wy6W4tzi34ineNJct8nzlt6rLcbxmnHqZ91FJRpyHUPBj0N/2
kxPjaqvh6LTlfZKW1R98uWW855Zad+lh3X7oJnwtdMPnSt8hov6Kk/La2Smt3VHZ134ImEa6/U34
HGjo8osnRTo5U6U4qGHhknnOX1Yra/cubRm3Tphh3XQ7X4TekdPo3hYaLwnkuUEpW9Gnw65b99r3
2pmMZvy9XVz7ZqDzkdnhDrBYKekKkaVJa05tRilvbJasmx6bx9el4K9FKlTaeIndJ/WqNeVL7sd3
Yt5x9qvff5LH7x5gqVJVpOUm3Jttt7W3tbOrwBBQemOhGhqXQPR89IYtWqzjrNb1H0YLnJ2vzsns
ONu3u6ePZN0eftOaZq9IMRPE1X5U3s3JbkuSWR2k08eWXddiKSDI7l4Jeiam3pKurQhdUr7LrbPq
Wxc7vccs69fRw9aKV4QOlj6U4puD+gp3jTXHjLt9lkaxmnLq591FENOIvng+6JPpTilrr6ClaVR8
eEe32X5Gcrp26WHdRdPCz0sVaS0dQdoQs6ttl1sh1La+dluJhPV162fpBxGx0eUS+hND1NPYiGHp
Lypu19yW9vklmS3S44910PQvS/SVPoRgKeAwr1ak4uKe+MfTqPm87c22thxk29ud7JqDzs2p7ck/
Ka4RWUV2/wDBZ2eIZGDrtRzbm9Z2223Jc+C33QB6Q0RhKfg50bKvVSeIqWbjxm/MprlHfw8p7Djf
tV7sZ9XN+o8747SE9I1p4ipLWle9+Mns6t8ktitqnV4rd+QyhSctWmvOm037vi+VuBU0O9+Dfo9T
wcJaTr+TCMWqOtlqwXnVHwcs+9vejllfR6+lhrzRzTpf0mn0gqzru6jK8KMfq00831yeV/vR2JG5
NOOefd5Faq0ZLUw0V5bacvvS2LsXHY3Irn9wv3Qbouuk2LUpK+Ew1lym1ml+J3k1uTtwM5XTt08O
6/dBYfCJ0pWNrOhTd6GGd58J1dkY81F5tb7S4ImMa6ue/Hu/McjwknQjPESd5NuMG9rk/Ol+FPbt
UpRZt5p7xMdGtCVNKSjSp/vK7cU/q01+8n/lXHyo7SVvDHfzHYOnmmqfQ3Aw0dhPJnOFucYelJ85
O+f3nuMYzb09TLsmoOE1v2Ggqfp1bTlygvMXb5z4rUZ0ePiDeJ/YaEaPp1LVJ8lbyI9z13x1o70C
+IN4v9goRo+nUtUqdVvIj3NyfHWW+IW+IN4r9goRo+nUtUqclb6OPc3N8daO9AviDdf+r8PGl6da
058oLzI9vnvitRg4nxG5L5uwtv7TEZvlTi8l+KSv1Ri9kgcT4jdFfN2GdT+0r3jHlTT8t/ifkrkp
oE8T4jej1830J4l+fK9Kl1teXLsi7dc01sFJ48jWhY/JFPFy2UranOrLzP4bOb+6lvFMfHkC0Lho
4io6tbOlSTqVPtWeUeuUmo9re4lMYEYelPT+K8uVnUk5Tluis5Sl1JXduVi8E+1QnSFeWmsR9FF2
bjClDeoryYR67Wvxd3vBftUG09WjGUcPTd6dBaia2Sle85dr2fZUeAhl7vcDaU/qzD08IvPlarW6
2vIj+GLv1za3EL4mhlBfNWDlU2VMTeEOVOL8uX4naC5KaCzxPiE9HoLB6+NksqCWonvqy/drss5v
lG28tMfHn3fmI/RGA+d8QoTk1HOVSfCEfKnLuT63ZbxfDOM3QnSuNemsRKcY2Umowgt0V5MIrqSS
E8Fu6JDpJJYRwwUHeOHTU2t9WWdR9jSguUVxJGs/d7vzCpr5nwCjsq4vN8VRg8v45q/VBcS8nE+P
5DXRqKwPjMdLZh0vF331pXUP4c5v7vMlMPHn3fmInROjpaaxEKN7OcvKk90VnKT6km31F3pnGboJ
0g0ktKYiU4K1KNoUo8KcFaK7ld822IuV3RJ6e/qnD0cCvOyrV/vzXkxf3YW/FKRIuXiaGtDL5owl
bGvKc70KPXJfSSX3YvVvxnyC4+Jv5CL6OaLjpbExhUdqUbzqy4U4K8n3Ky5tFtZxm6Gum9JS01iK
leStryyjwisoxXJJJLqE8Jld3Ym+k/8AVVKjo9baS8ZW/wB7USbT+7HVj16wjWfjx+9jNCr5nwdf
GvKpUvh6PXJXqSXVHyU+MxfJj4m/kIXo5on56xUKMnqwu5VJfVpxWtN9iT7bFvhnGd1AukOlfnvF
VK9tWMnaEfqwirRj2JJCeEyy3ROaf/qbB4fALKcv2iv96atTi/uwztxmSeW8vE18xroivmuFfSUt
tCOrR51ql1G3HVWtPsQvuMPHn3fmKno7AVNLV6dCnnOpNRXW3a79rNbc5Nic6aY+GMxXiqLvQw8V
Rpc4wycvxSvLtJjG87u/Dw0eL+otEPdVx87c1RpP1a0+9RHN+C+zPj+QjuhWjIY/GRlW/cUIyrVv
uU87drtHtLlU6c3fh5EDpfSM9M4ipiKnn1Jyk+17OpbFyLPDFu7sRgZCWigQAIaAEtACGrgA2ADY
AhoAG0VAKSABEAhqxQaApLQRokKEtBAkKMCDQQYUGAGrEUasAYFGggwINACkBKUBlsKMCjADaCBQ
BsAwKFIiBRVCkRB//9T3pY9T478qmgDADADADADADABLQQJCjADADADADADADQQYAYAasAasAaIo
wAwAwA0VBgBgQYAYAYAaCjLAGrAGgowINWAMCDADADADADADADADADTVwBDVgDQBgBgBgBgBgBgB
gBgBgBgBoIMAMAMAMANWCjQBgBgBgBgBgBoA0EGAGAGAGAGAGAGAGWChNgDADQBgQYAYAYAYAYAY
AYAYAYAasECbAGgo0AYAYAYAYAYAYVBoAwAwA1YijQBoAwA0VBgBgBgBgBgBqwBqxVGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGFBgBgBpgCCAwAwAwAwAwAwA2UGBRuxAbsEGwDADADAD
ADADADCg2FGwDADADADCAUEG0UgKFGAGyKFIINhRsAUggUFGAC0QGyg2goWRBsqhRAbQApACkAKQ
AsijEUCyA2igWQCkFCwg2goIAYgAgBtBQoIFIKFhBtBQsINkaCyoNkAtFBsAwgFIAUFGAGAGAC0R
BsKMAMAMKgUmAbIowAwAwAwAwA0VkYAJZFGBRgBgBphBoqDABLI0NMINFQYAYwAYBgBgBphAgKMA
NBBgAlsKNAGggwAwAwAwAWmFCkALTAFJ2AFgC4sihQAtMAUgBYApMKCJgBYsALFkUFTACphQVMAN
FhQVMgCpgBUwoNEALEigqYAVMKCoALEKDRYAVBQVMAKiKCpgBUAFiwoMgAqCgqChaAFIAWAKQULA
FxAFACwBaIoUAbAMANAGmggSFGgDRUCSKNFQJaIoSAa2hANooBtAA2ggG0ACaCAbVgAbVioBtAA5
IIBNAAmggE0ACaKgE0ACaCATQANoIBNFAhoAG0EA2gATQANoIBNAA2gAbVwgGwBDRQDasEA2gAbQ
QIauUA2ggQ0ADaCBDVwBDAENACWgBDRQIaAENBAhoAQ1YAQ0AJauADAEtAA2gAbQQDaKNENAA2gB
DQANoAG1YIENAA2igQ0QCWigSQVpoo0SECWrkAmxQaAENAGmECGgBIFhLQGiQDTQBsAUgBSAFoKF
ABEAGRFBYgBYgBUAGQUGiBgeJAGiFB4hQeIAeJFB4gB4gBohUo8SDI0QoPEANEKDRIA0QoNEANEA
NEKDxIJRYhUHiAGiFBYkAeIAWIUGiAGiRQVABIgBEAEQULQARABABYApEUKKg2iKNhQorI2RoYAb
YBoAwqBLIBIBoqAYAMAQwAbABsAFIIAyAAyCAMkUAZAAZIIAyKAMkEAZIADIIBNFACQQAkAKwuDn
j6kaVNXlJ2S/W7iCTY6/jsRT6DYJU6dnWls5y3yfJbuxHP2nqt+rg4ZWqOs3KTu27tve2dXjobqD
qNJK7eSS4lB3PRWDpdAsDKvWs60krre36MF7+17EjjftPZjPq5scK0nj6mlKsq1V3nN3fwXJbEdp
NPHbsRckVkdx6CdH4dHsPLSOK8mTjeN/Rhx65d9rLe0ccrvw9fSx7ZujkXSnpBPpJiJVpZR2Qj9W
O5de98zrJp5s8u6isyK5jr3gw6IrEz+X119HB/Rp7HJbZdUd3PqOeeXo9XRw35oq/hC6WvpLiNSm
/wBnpNqH2nvl8OXWy4zTn1c+6jnLNuI6B4POh76T4jXqL9npNOf2nuh27+XWjGV07dLp91+4WTwr
dMFipfN+Hf0dNrxrWxyWyPVHfz6iYT1b62e/EHEGjq8osXRXo1U6U4qNCGUds5fVitr69y4tozbp
vDDuuh2rwkdJKfRbCR0Xg/JlKCUrehT4fel32u96Zzxm/L1dXPtmoPNx2eEPtG6PqaWrQoUVrVJu
0V+ty2t7lmS3TUm/A9LaWxlHwWaLjQotPETuov602vKm+S3L7q4s4z7Ve7K/VQeX6lR1pOUm3Jtt
t7W3tbO7wBMYubsldvYgD0/0b0XR8GWjZ4vEr6eaTkt935tNe/nd7Ejhb3V78J9XN0ebdMaUq6br
zxFZ3nN3fLglySyXI7yaeHK912I0IPRPgs6LQ0NQlpXF2j5LdPW9GFs59b3fZ+8cc7vw9nRw15o5
H006Uz6WYuVZ3VNeTTjwj8XtfdsSOmM08/Uz7qKiacx1/wAFHQz56r/LKy+govyU9k5rNdkdr52X
E555aeno9PfkN/Cn0z/2gxHyajK+Hot5rZOexy6lsXa94wx0nW6nddDlB0ecXLoP0Tl0txapZqlH
yqsuEeC5vYu17jOV06dPDvo6l4WOlUcBSjorC2ilFeN1fRivNgvU3yst7MYT1ejrZ68QeebHZ4hK
aF0TV05Xhh6KvObsuC4t8ks3yM3w1Me66HpHpTpSl4NdGwweFf0801F7/tVHz4c7bonGTur255fV
zUHmBu+bOzwBUIOo1GKu27JLa2RR6h0JgaXgu0XLEV0niJpOS3uT82muS3/ieyxyv2q9+M+qm6PN
WkdIVNLVp16z1pzbcn+ty2JblkduHgt2Glgg9D+C3oxDQ1CWlcXaN4t07+jDfPre7l945ZXfh7ej
h2zdHI+mPSefSrFSrO6gvJpx4RWzte18+SRuTTz9TPuoqppzHV/BZ0P+fMR8qrL6Ci8k9kp7Uupb
X2LezGd09HRw7rv3BfhS6X/Plf5LRf0FF5tbJT2N9S2Lte9DCaOtn3XXuHKbG3nFn6I9Gp9KcVGh
G6gvKqS+rFbe17FzfC5m3Tphh3Udf8J/SWGhMPHReEtG8Up29GG6PXLfy+8c8Zvy9PWz7ZqDzydX
iDrA4KppGrGjSWtObUYrmwsmx6W0jiKXgu0XGlSaeIndJ/Wm15U3yju/Ct5yn2q91v1UHmWpN1W5
Sbcm223tbe1nZ4dhJEHpToNoOn0JwM8filarON7b1F+bBfak7XXGy3HLK7e7p49k3RxXTul6mn8R
OvUec3ZW2RhHN25blxs950k082WXddiGfl7ctbN8orYv1t8krA7F4LOi/wArk9IV0lCL+jT2XW/q
ju5pcDnlXq6OG/IqvT/pZ/tHXbpv6CneFLm350+1ZLk1vuaxx059TPuoorp5qD2Rzl17/dHrNOIu
3QboxLpLXbkrU/Ta3R3pcG/MXLW+qZyunXp4d1F68JvSFScdFYZqMUl41rZGKV1HLcktaXJLmjOM
9XXrZ/zYOOQnGtN1WvoqSWrF77ZQi92bzlxWszo8odaIwNXSM7QTlWrycIdvnyfJJ2b5t7Ykq4zf
zHdukGPpeDfRsMLh39PNNRe+786o/dzstiOU+1Xsyv1c1BwDF05XhhY5zv5XF1JbuzKPXrPedXjs
9BurT+W1YUKbWpDyVLdlnOb5bXxUUluBrfgejOi+jKXRLCTxuIWo3DJPbCnHzYfefnSttm+Ryt29
2E7Jujz/AIrHS6TYypicRfVznO26CyUV6oJ8Wm9514eK3uu6GmG/rKtOtW8yPlzSyVlkoLhd2iuC
z2IJPIzCf1hWnXr5wjepU3XzyiuF21HLYs9iCzz5G8GvnGtOvXzhG9SpuvnlFcNZtRVtl77EEnnk
ZhI/O1eVWv5ivUqtZZJ7Fwu2ox3JtbgTyMoQem8Q51Xqxd51GvRgttupeTFcbIcE+1RlpafxO6Ck
+yEIr2Riu5Dg9qjMVJ6bxChRVk3GnSi90VlG/tk+N2Tgv2qM0tXjiqkaVHOnTSp07elnnK3GUm5d
qW4QyuwTTclhtXCQeVG+u1vqPz32WUFyjfeWLldePcFaRXzbQhhV58rVavW15EeyL1nzk1uHJfE0
MS+asJf+1xOS4qlF5/xyVuqL3SIcT4/kM0R/VtKeMfnK9Oj99rypfgi+yUosVMfHkA0DhIVKjrVV
ejRWvNfW3Rh+KVl1Xe4Ux/IAw9Gp0hxVpPy6sm5SexLbKT5JXb5IvBPtUZprHLSVdummqcUoUo71
COUe17Xxk2JDK7D3T7WAjDAx/sburzqy87+FWh1pveSLl48fvYxr5nwX/HcV3qjF/wCeS7ocGOTi
fH8hro9FYBVMdL+xsqV99aV9T+HOb+6lvFMfHn3fmI3Q2j3pfERpydou8qk36MIrWnJ9STfN5C+G
cZujWmtIfO+IlUStF2jTj9WEVqwj2JJc3mWeDK7ok+kf9XQp4CP9itarzrTtrL8KtDrUuJI3l48f
vY3hf6mwM62yrir06fKlH95L8TtBclMck8T4hr0YwcKtV16yvRw8fGTX1rPyYfilaPVd7hWcJ/AR
VWdXTmIcnedatPvlJ/Fl4T2r8RL9KsRGNSGEpO9LDR8Wmtkp3vUn2yvb7KQjWfu9wM18y6O4VsY+
1UYP/PNdqhzIvE+P5Bv0TwsFVliqyvRwsfGyT2SknanD8UrdiZamE9fcIGbq6Yrtu86tWfa5Sfvb
LwxyJ3pfXjSqQwVJ3pYWPi7rZKd71JdsrpckiRvO+nuBsMvmTRs6uyrjG6cOKowd6j/FK0epSHNJ
9mfH8hG9E9GQ0jiU637ijF1a33IZtfidormy1MJuiI0vpGemcRUxFTz6knJ8r7EuSWS5ITwzld3Y
svSv+qKNDRqydJeNr/76ok7P7kdWPXck8+W8/Hj97GdF18z4fEaSeUoLxND/AHtRO7X3YXfW0L7j
DxLflBVNEaLnprEU8PT86pJRXK+19SWb5I1bpzmO7pYlemWkoaSxclR/cUYxo0fuU8k+13l2kkbz
u6qSn/UOiEtlbHzu+KoUnl1a0+9RHNX2cfj+Q5+0acglq4AgINNFAhgCABDQANoAQ0ADaABtFANo
IAAGmiAQUGgNQhqwRWgBDQBoKMAMCDQBhUGAGWIoTYAwKNBBgQEDTDADADdggUAbAMCjaCBaIDZV
CiIP/9X3tY9T478qmWAE2CjQQYAYAYAYAYAasEGrACQowAwAwAwAwAwAwINAGBBgUasAJsAYRRgB
gBgBoqDADAgwAwAwAwA1YKNWANBRgQaAMCDADADADADADADABLQAmwBoAwAwAwAwAwAwAwAwAwAw
A0EGAGAGAGAGrBRoAwAwAwAwAwA0AYEGgDADADADADADADLAGrBRoA0AYEGAGAGAGAGAGAGAGAGA
GggTYA0FGgDADADADADADRUGAGAGNXAEkUaAMAMKg0AYAYAYAYAYAYAasAZYKNFBgBgBgBgBgBgB
gBgBgBgBgBgBgBhQYAYAYAYAYAYAYADIDADADADADADZQbsRRuwQbAMAMAMAMAMAMAMAMANlBsKM
AMAMAMIBQQYUGwAoUYAbIoUgg2AbChSAFAGACkQCig2goWRBhVC0QG0AKQApAGyqFoiDYULIDZQL
QBtEULCBQULQBsAWgDYAsA2FC0EGwoWggURQpFAoAUiAUUGAG0QCiA2VRgBgBtBAogNhRgBgBhUC
kAbIowAwAwAwINFQYyKEhRgBgBgBoINFQYAJZGhoINFQYAYwoGEGAGAGmECAowA0EGACAo0EGAGA
GAGAGk7gGwBesFCkwBesAKUgBSkFBL3IBaYAtACkwBQUETACpgBUwoLEgCxYAVMKDJgBURQWLACo
KDJgBUyALFhQWIAVMKCpgBkwoKgAsQoLFgBUFBkyAKgoKgAsQoLEAJEKFAC0AKQUEQQKiFCwBYAp
EULAF7QBNgDADQBpoIEhRoA00VAkijRQJaIBIAloIBtFANoAE1cIBtAA2ggG1cAE0VAhoAE0EAmg
AUkEAmigFJBAJoIBNAA2gATRUA2rACGggG0ACkgAbQQCaABNACGgAckVANogENFANoIBtAA2ggG0
VAhoAQ0ADaCBLQAhoAQAIaAENACGUCWgBDQQIAENWAENACHmAIaABtAA2io1A2gBDQANoAQ1cAG0
EA2gAbQAgoEkAlooEkGo00UUkINEAhqxQaAENAGggQ0AJA1GmgKQAYALQApBQtBAoKCIAKiKCxAC
oAKgAqCoNEDI8QA8SKDxCg8QA8QoPEgDRADxCpRogZHiRQaIAaIUGiAHiQBUFB4gBohQaJBKNEKg
0QAyACxCg0SANEKDRADRIAsQoJEAJEAIgoWgAgAQAIgDaIoWVBsijAoWVkbI0MANgGgDGEGmUCGQ
GioEMAGwBDABsAGwAUggDIADIADIqAMgAMggDJFAGQQCkABkggDIoAyQQAkgDrfRvRMOjWHli8Rl
NxvzjHclzfwXE527erDHtm6OV6b0tPTVaVWe/KK4Lcv1vOkmnmyy7hByKwOpdAujapr5dXsoxTdO
+xW2zfu7+Bzyr09LD1opvTHpI+kFfycqMLqC48ZPm/UjeM05dTPuFLkjTkL70C6KfPdbx9VfQU3s
fpS4dS2vsW8xldO3Sw7gfwkdK/nKp8kov6Km/La9KS9y9bz3IYYr1c9+ByeSOjzCydEejM+k+JVN
XVOOdSXCPDrexd+4zldOmGHdR0nwkdJoaJorRuFtHyUp29GFsodb38usxjN+Xfq568QcCkdXjD/Q
+iKuna8MPRV5TfYlvb5LaS3TWOPd4Hf+k2laPg40fDCYX9/NNRe/Pzqj58OfKJyk7q9meX1c1B5m
m3J3ebZ2eAZSoSxMowgnKUmkktrb2JAnkem8BhqPgq0ZKrUtLETtdfWnbKC+zHe+t77HH2q98n1U
HmXSGPqaUqzr1Za1Sbbk+b925Lcsjvp4bdhmGR6S8HfRyn0Rwk9J4zyZyhdX2whu/FLLLbsW1tHH
K78Pf0sOybo4f0p6R1OlGKliKmSeUI/Viti974ts6SaeTPPuuxXDTmO4eCboasVL5xxC+jpt+KT2
OS2z6o7vtZ+ics8vR6+j09+aKr4R+mL6UYnUpv8AZ6Tah9p759u7lzbNY46c+r1O6/cOcm3AdC8H
fQ19KsTeov2elZ1H9Z7oLr38FzaMZZad+lh3X7hb/C30wVZ/NuHdqcLeNa2NrZBco7+dluM4Y+rr
1s/SDhZ1eQT3Rno9V6T4mGGpb85S3Ritsn7uLst5LdNYY910O9eEDpBS6FYGGjcH5NSULZbYw3yf
2pO+fW9tjjjN+Xs6uXZNQeZju8IcYTCzx1SNKnFynNqMUt7ewhJseoZuj4JtFWVpYmf89Rr/AAx9
nORx9qvf/bU+8eXcTiZ4ycqlRuU5tyk3tbebZ2eC3YAUHpvoDoCl0GwM9JYzyak4Xz2xhuivtSdr
rjZbmcMrvw93Tx7JujgnSPT1XpJiZ4mrtk/JjujFbIrq9bu951k08eWXddiDKyO5eCXoeq8vnLEK
1OF/FJ7G1tn1R3c7vcc876PV0cPWioeETpe+lWKtTf7PSuqa48Z9u7grb7msZpy6vU7qOfmnEX/w
e9EH0qxXlr9npWlUfHhHt38FffYxldO/Sw7qLp4Wel6qP5tw7tCFvG22XWyHUtr52W5mcJ6uvWz9
IOGnV5BM6A0JV6Q4iGGpLypPN7orfJ8l69m1i3TWOPddD0B0101S6B4CGj8JlVnGye+MfSm/tSd7
c7vccZNvZ1Muyag81HV4QSlSlXkoRTcpNJJbW3sSAPTmj8NS8Fui5ValniJ2uvrTa8mC5R3/AInv
scfar3yfVT7x5px2NqaRqyrVXrTm25Pmzs8Nuw2sVB6G8GXRqGg8PLSmLtFuLcL+jDfLrlu5feOW
V34e3pYds3RyPpd0kn0pxUq8rqC8mnH6sVs7XtfPkbk082efdRWCuY6n4MOiHz5X+U1l9BRex7JT
2pdS2vsW8xldPR0cO67D/wAJHSx6ar/JqL+hou190qmxvqir2fHPY0MY11c9+BzBpSyWx+qEfe2r
9a5m3nE90b0BU6T4mNCOSn5VSX1Ka/WS+6S3TeGPddDrnhH0/DQOGhovCeTKcVFpejT2W65ey/FM
54zfl6erl2zUHA1JRestkMo83uftln1HV4gXCYKeNnDD01epUay69nxfLqCyb8D0ri6tHwaaM8mz
qtWj9qbXsW17N+9nH2q99/k4PNtWtLUlUm26tdttvbq3zfXJ5dSe5nZ4P1C6uHbcMNHaneb3a2+/
KKyfB6z2Mi69B3zoToal0ew8tJYjyV4u1O+2NJZ3t9ab8prnZbbHPK78PZ08e2bo49pXT09O4mpj
6uyLSpR4PPUXZnJ7m1b0jcmnmyy7rsQeHfySnKs/PneEO3z5dz1Vzk2s4lYngdW8FvRL5XfF1V5F
/JT32fxWfJWzUjGVejo4b8gPhS6V/OElhKT+jWcrb+HY9q5ask8xjE62e/A5li18hoxoenO06nd5
EexPWfOSTzibcL4CscvkNOOHXnO06v3reTH8Kef2pST2AvjwN6Q/YKccMvOynV+815Mfwp58JSkt
yIXx4G9IfsFKOGXnO06v3mvJj+FPP7UpJ7AXx4G8b/V9GOHXnztUq8svIj2J6z5ySecQXx4G8R/V
uHVL+0rWnPlDbCPb575anAF8T4jf/MMw3/HMQu6kn/mkv4Y8JA4nx/IKwn9W4eVf+0q3p0+Uf7SX
d5C43lviCeIM0QvkEJYx7YeTS51Gtv4F5XKWpxFXHx5A9C4eMpSr1VelRWtJP0pejD8T2/ZUnuFT
GevuCMFRlpzEN1ZO0nKdWfCK8qUuvgt7st44STuoTiqk9PYm1OOc3GFOC3RVoxj2Kyv2l4W3uoXp
3EwnONGk70qK1Iv6z2yn+J3a+zqrcIuV/gD6WXzZRhg15+VSt99ryY/hi+yUpLcSGXjwN0v6owbn
sq4m8Y8qSflP8UlqrlGS3g4nx/IJ0BBYNTxs1lRt4tP0qsvMXPVs5v7tt4pj48+78ww0TgHpeuoz
k1HOdSfCCzlLrts4uy3lqYzdCNK42WmcQ5xjZSajTgt0V5MIrqVlzZOEyu6JDpFNYTUwUHeNBPXa
2Sqy8987WUFyjfeI1l48e78wu3zNgf8Aj2L740Yv/PJd0ODHK8T4/kB9G6UcK542avDDpOKeyVWX
7tdjvN8oviKmM15935iK0fgqmnMRGmnedSWcnu3yk+SV2+SHDMndQ46Q6QhpGv8ARZUaaVOkvsRy
TfN5yfNsRcrsSGl18zYSng1lUqWrV+Kuvo4Pqi3JrjPkJ5ay8TXzGujy+aaNXSD86H0dD/ezWcvw
RvL7ziKY+PIhdCaLemcRCjfVUneUvqxWcpPqSbLbpjGboX0h0otL4iVSC1aatClH6tOKtFdyz5ts
SLld0S2ml8zYSlgllUqWr1+Ta+jg+qL1muM+RI1l4mvnQnovH5qhW0jL+xWpR51ppqL/AAq83zSF
8mHjz+9iu6L0dPTWIp0IefUklfhfa3yW18jV8Ocm6JDpXpGGkMS40f3FGKpUfuQyv1yd5PmyRrO7
okMSvmLRkaeytjWpz4qjB+QvxSvLmooc1b9mfH8g06HYOE68sVWV6GFj42a+s15kPxSsuq4yMJ6+
4VvF4ippStKpO8qlSTb5ykzXDnbsWnplJaO8To2Dyw0fpLb6086nXbKC+6zMdM/Hj3fmN9Hv6kwe
I0g8qkl8nofemvpJL7sMk+MhfPgw+zN/KCsaE0TPTmJpYaG2pJK/Bb31JXb5I1bpjHHd00f9MdKw
0ti5Ol+4pJUqK4U6atHvzl1sSaXO7oqrK5hLQUJaKBBECWigQ0AIYANoAQ0ADaAENAA2ioATQAMA
01cgElBpq4GwwDTQQJsAaCjADADAg0AYVBgBliKE2AMAFoKywCNpBAoINhRgUYAKRECiqNoAWQH/
1ve56Xx35VMAMANWKBNgDQBgBgBgBgBgBqwQasAasAaCjADADADADADADQQYAYEGgo1YA1YKMIDA
DADRUGAGBBgBgBgBgBgUJsAaIo0VBgQYAYAYAYAYAYAYAaAEtAGgDQBgBgBgBgBgBgBgBgBgBgBo
IMAMAMAMANWCjQBgBgBgBgBgBoA0EGAGAGAGAGAGAGAGAGrBRoA0AYEGAGAGAGAGAGAGAGAGgDVg
g1YKNAGgDADADADADCoNAGAGAGrEBoKNAGFBoIMAMAMAMAMAMAMAMAMANWAMsAaKowAwAwAwAwAw
AwoMAMAMAMAMAMAMAMAMAMAEyIBIBgBgBsoN2CjdiINgGAGAGAGAGAGAGAGAGAGyg2FGAGAGAGEA
oIMAMKDYUEQBsA2RQpAGwg2FG0AKANgCkQCigwKFkBsoFIgNgCiqFkQbChSCBQUKQAogFIoFEAtF
AoihSAFACogCgBSAFACkFCggUiKFFApEAsoNogFlBgBgApEBsgNlUYAYAKCBRFGAGAGFBtBAogMC
jADADQZGFAlkUYFGAGAGACSsjADABJGhoINFQYAaYAgAwAwASwgSFGAGggwAQFGggwAwAwA0wBKA
FgGBQpACwDABaAFxChaIAiAFoAImALiFBYgBUFBUyAMgAsQoLEAKmFBUQBUwA0QoKgAqIoNFgBIh
QaLACxCgqACphQaIAWJFBYlAVEUFTACphQaLACIKFgC0AKAFoAWgoUAEQApEULQAuIBuwAloA0AY
AJaAEgGACWggSFGigS0QCQAbVioBtAA2ggG0ACaCAbQANoqAbQANoIBNAApIIBNAAmioBNAAmggE
0ADaCAbRQDaABtBANoAE0ADaCATQANoAG0AIasEA2igG0EA2gBDQQDaAENFQDaAENACAgQ0AIaAE
ACGigS0QCGVAhoAQ0AIYAhqwAhoAQ0ADaAENXAQNoqNBtAA2gBDQANoAQ0EA2gBDQAixQJIDTRQJ
INk2uECWig0QCGrFBoAQ0AJYQaaAEAaaauBWkgBQAtACkFCkgBaACxIoLEAKgIKgJsZBUFiAHiAH
iRQeIAaIUHiAHiRQaIAeIVKNEDI8SKDRADRADoKDRIA0QoNEANEKDRIJRohUGiAGQAWJFBogBohQ
aIAVAB4kUEQAtABEFBAAiAFoAJEAURQsIMANhoKRUCiAwKNgGgDAg0VAgijRUCWADkADkADkAIYA
JgApBACRQBkEApAAWEAZAAZFQBkABYQBkABkVBeehvR35XL5TVX0cX5Ke9rf1L29RjKu/Tw35EX0
y6RfO9TxVN/QweX2nx6uHfvLjNM9TPuFGkbcRZuifRx6erXkvoYZzfHhFde/guwzldOmGHcLF0+6
SKK+Q0MoqyqNctkF1b+7iZxjp1c/SDkUjq8olNB6Eqafrxo08r5ylujHe/hxZLdNY491HVumGm6f
RPCxwOF8mo42y2xjvk/tP4vgc8Zvy9PUy7JqDgUkdniC8JgqmkakaVJa05uyX69fBBZNjv8AiatH
wZ6OUYWlXns+1O2bf2Y/BbXc4+1Xtv8AJQeccTXnipyqVG5Tk25N7W3vOzw27DXVcsltCD0b0W0P
S8HuBnjcXlWlG8lvS9Gmube3nyjc429z3YY/VzdHn7T2maun8RPEVX5Unkt0VuS5L89p1k08eWXd
diFaKwO9+C7onHAU3pTF2ilFunrbIxtnN9mzld70cs76PZ0cNeaOY9OulkulmKc1dUYXjSjy4vm9
r5WW46YzTh1M+6ilWNOQ6r4L+hXz/W+U14/s9J5J7Jz2pdS2vsW9mM8tPR0en3eQfwqdNPnqr8jo
S+gpPymtk5r3LYuLu+BMMdL1s+7xByA6PMLd0K6Kz6WYpUldUo+VVlwjwXN7F37EzOV06dPDvo6z
4UOlUNC0ForB2j5KVTV9GFsodbW37P3jnhN+Xo62evswedzs8QktEaKq6brww9FXnN2XBcW+SWb5
Et01jj3eB6Q6Q6So+DDRsMLhmvHzTUXvu/OqP3c7LNJnGTur3ZX6uag8vzm6jbbu3m2953eAbhTd
VqMU227JLa2wD0/oHR1HwXaMlicQk8RNJyW9yfm011b31vYkcLe6vfjPq5ujzXpbSdXTVeeIrO9S
bu/clyWxcjvJp4bd+RGhB6K8FvRWGhaEtK4y0fJbp63owtnPre77P3jjnd+Ht6OGvNHI+mnSqfS3
FSrO6px8mlHhH4va+7YkdMZp5upn3UVE05jrvgq6F/Ptf5XXj9BReSeyc1ml1La+xcTnnlp6Oj0+
7yNeFTpp8+1/ktCX0FF5tbJz2N9S2Lte9DDHR1up3eByc284tvQzotPpZio0VdU4+VUlwj8XsXfs
TJbp06eHfR1zwodKIaFoR0VhLR8lKpb0YWyh1vfy+8c8Zvy9HWz1O2DzydXiD/Rmjqml60KFFa1S
bsl73yW1vciXw1JvwPSemcbR8F2jI4eg08RNNRe9zfnVHyW5fdXE4z7Ve7K/VTQ8wTm6rcpNtt3b
e1t7zu8A0lrbCg9OdEtD0vB1o+eNxStWnFOS3pejTXNvbz25RucLe578Mfq5ujz1prS9XT2IniKz
vObvyS3JckskdZNPFll3XYiwyO7eCjolGCek8SkoxT8VrbMvOm+SzS7XuTOeV9Hr6OHrRQunvSyX
SrFOUW/EU7xprlvk+b9SsjeM05dTPvopFjTkOg+Dzog+k+J1qi/Z6TTn9p7o9u/gubRjLLTt0sO6
i2eFfpcsRL5voP6Om141rY5LZHqjv55eiZxjfWz34g4odHlExoHQlXpDiIYel50nm90Vvk+S9eza
yW6bxx7rod96aaZp9BcDDR+DyqzjZW2qPpTf2pO9ud3uOeM29nUy7JqDz+oW8m9tqv65v3c0dXiC
qdN4hqKTvO2SzeqtkVze7i9XiAejdE4Sl4OdHSrVrePqZyXGVvJguUVe/U2tyON+092M+rg876Q0
hU0nVniKjbqVW7du31ZLt4HV4rd+Q01VezzjDN83v79nVmVB3TwYdG1gKctKYrJyTdO+6O+fbsXL
kzllfR6+jhrzRQOmen30rxm21GldLkl5z69yzs3azzNyacepl30VanW1pSxDVlGyhH7VrRXNRSu+
Nkn5xXP7x0Hwb9Enpifjqq+j333q+z8TVn9lST89MzldO/Sw2JDwpdJ3pKtHR2HzjBrXt6U90ez/
ABc4kxi9bPfiDmFWj8pnDDU2tWF7y3X2zn1ZbfqxW82898+BJ6J0TLpXjIYejdU1kn9WnHbJ83e7
3OUuZL4XGd90O89LtM0ujGGWEo+TaHlWecaaytfapTfkxe1Zy9E5ybezqZds0PO2Fl8qqTxNZJxh
5TW6Un5sOpvdugpW2HV4p58jMC/GSni63lKD1s/SqSvqp9t5P7MWt6BPeN6P86eLq+UoO+eevUld
xT453lLik1vQpPeM0aryniqvlKm75569SV9VPjneUuMYtbWgT3jNHRVac8TW8qNPypX9Obfkxf3n
m/sqT3AnvGYCHy+rOvXblCF6lR75NvKPXJu3JNvYgTz5o1hYPTWIlUrO0c6lWS3RW23qjFbLtIcL
PtUYtbpBid0FJ/hhCK/wxiu5cRwntUZjKj0ziIwoxerlTpQ4RWS7Xtk/rNscF80b0xXjOUaFJ3pU
lqxa9KXpT/E9m/VUVuEMr6A+l/2CEcHHbB61XnUa2fgXk/e13vJFy8eBuv8A1VhVS/tcQlOfKms4
R/E/LfJQHJfE+IzAL5qw8sS/3lTWp0eSt9JPsT1Fzk3tiCeJsD0FQjScsVUSdOgk7PZKo/Mj3rWf
2YyFTGevuDbAYWWnMR9JK2s5Tqze6K8qcn2XfN5by8E+1QnSeLemK94RaTtClBZ2isoRXO23i7ve
C3uod6fqRwupg6bvGhfXa2Sqvz3zSsoLlG+8kXLx49wXV/qfBqGyriUpS4qkn5K/G1rPlGPEHsz4
/kM0DH5thPHS20/Jo86slk/wK8+vV4irj48/vYjNDaO+dq6hJ6sFedSf1YRzk+u2zi7LeW+GcZsJ
0vpB6YryqKNk7RhBejFZQiupWXN5kiZXdEn0ia0fGngIv9zeVVrfWl538KtBc1J7xGsvHj97CsIv
mXBSrP8Ae4m9Onypr95L8T8hctccrPE+IZ9G8DDEVXWrK9ChHxlTml5sOuUrR6m3uFTGfwEbiK1X
TmIc35VWtPYt8pPJL2JBm+aJjpRXjRlDBUmnTwycW1slUedSXfkvsxQjWd9PcCUf6jwEqmyti7wj
xVGL8t/jktXqjLiOV4nx/IMui+Ahiqzq1l9BQi6tXmo7I9cpWj28hUwn8BEY/F1dM151Z+VUqzby
4t7F7EjUZt7hYOlU1gFT0fB3jh0/GNelWlnN89XKC+7zMxrPx4935jeiV8x4KrjHlVrXoUOKTX0s
11JqCfGT4DlcfE38hCdHtEfPeJhRb1YZyqS+rCKvOXYk+2yLbpjHHdCOkWlvnrEzrJasMo04/VhF
WhHsSXaWTRlluib0wvmPAUcGsqte1etxtspQfZebXGSJPLeX2Zr3+aA9DaEcLOpj6qvTwkddJ7JV
XlSj/F5T5RYyTp+/3CptVNJVd86tSXbKUn7W2ac+RaemtaOGnT0fSd6eEjqNrZKq86sv4vJ6oomL
p1Pd7gTQS+YsBiMc8qlW+HofiV6sl1R8lNb5EvlcfE38ligtG3FSGgBLQQICjTRQIZECGUCGgBDQ
ANoAQ0ADauADaKAUkRAFoASUGmiAQUVpoI0QFGgg1YA1YA0FGAGAGBBoIMKDADLEUYgM0pICFAGw
DAowA2kEC0RRhQKRAKAP/9f3uel8d+VTADADADADVigTYA0AYAYAYAYAYAYEGrAGrAGrAGgowAwA
wAwAwA0EGAGBBgBqwUaaIDQUYAYAaCDCgwIMAMAMAMANBRqxAaKDQBgQYAYAYAYAYAYAYAasAJsQ
Gig0AYAYAYAYAYAYAYAYAYAYAaCDADADADADViKNFBgBgBgBgBoAwA0EGAGAGAGAGAGAGAGAGrBQ
kAwIMAMAMAMAMAMAMAMAMANFQaIDVgDQUaAMAMAMAMAMKg0AYAZYATaxFGgDADRUGAGAGAGAGAGA
GAGAGAGAGAGWANWKDLAGWKDAowAwAwAwAywBlgDLAGWAMsAZYAywBlgDUkQAwDADaQUKsEGwDADA
DADADADADADADADADZVGwDADADADCAUEGAGFBsA2FCogCgDCKFIAUEGwo2gBSANgG0QCygwAWiKN
lQKRFGwBRVCkRAoKFIIFEUbRQKIBSKBZAKQUKQQKQULANoAWAbQAoAUgoWEG0RQsqDZGgsrI2FC0
QGygwAwgFEBsKNlBgBtBAogNhRgBgBhQbQQKIDAowINFQYyKEhRgBgBgBphBoqDADCKEBRoIMKgw
A0wBABgBgAlhAkKMYBoINMASFGggwAwAwATIASALTuAbANhQtBBsKFIAWgoWQBEALQAtABAoKgAs
QAsQoKiAKgoKgA0QoKiAKgAqCgsQAsSKCxACpgBkFBYgBYhQWIUGiwAqZFBUwAsQA0WFBYsKCoAK
goIAKQAtAC0AKQULAFxAFIiggApACwDQAloA0AYAaaAENWAMAEtBAkKNACWgBDQANoqAbQANoIBN
AA2ggG0ADasVANoAFJBAJoAE0EAmigE0EApIAFJBAOSABtFQDaABtBANoAG0ACaABNBANoAG0AIY
ANoIBtFANqwQDaAENBANoqBDQANoAQ1cASEA2rACWgBDQAhooENACGggQ0AIaAEtXAEAA2rACGrA
A2gAbQRqENFANoAQ0ADaABtWABtWAENBAloAQ0UGiAS0UWEtAaaIgQ1YoNEAhqxQaAENAGggS0AJ
A00BW0ALAFBQtAG0AFiRQWIEGQGRUAFQUFiAHiAGiRQ4iAGiFB4gBokUHiAGiFZo8QINEig0QA8Q
A0SKDRADRCg0QA8QoLEgzRogBohQaIAWJFBogBohQaIAWJAHiFBEAEQARAC0FBIgBIgC4gCwoWiA
wqDZGgpBApAGBRtAGgDAg0VAlkUJKg1IAHIAGwAbABsAGwAUggDIADIqAMgAMggDIoAyCAMgAUgA
LCCY0BoSWmqurspxzm+XBc3+ZLdN4Y9wtfTDTkcBT+R4fLK0rbo/V63v5dZnGOvUy14g5RI6PMHO
jdGVNLVY0aaze/clvb5C3S4zY6tpvSNPoZhI4eh+9ksuPOb58OfJHOTb05XsmoOHVG5tt5t7zq8Y
HSoSxMlCCblJpJLe2DWx3LC0aPg9wLnO0q09v2pbor7K+L32OXtV7J/JwcG0hjamkasqtV3nN3b/
AFu4cjtHit2I6RUHdehegKfRTDSx+L8mbjfPbCPD70u/YuJxyu/D2dPHsm6OOdJtP1OkmIlWnktk
I/VjuXvfFnWTTy55d1FbkVzHYfBl0QVZ/OGIVqcM6SextbZvkt3PPdnzzvo9XRw9aKr4Qel76S19
Sm/2em2ofae+T93Bc2y446c+rn3fAc5aNuAv3g+6HPpPiNeov2ek05v6z3QXXv4Lm0Zyy079Lp91
+4Wnwq9MVVfzdhnanC3jWtja2QXJb+eW7POGPq6dbP0g4dI6vIJ7ov0dq9KMTHD08k85y3Ritr9y
4uyM26bww7rodz6e9IqXQrBw0bgvJqShbLbCG9t/Wlnnt2vgc8Zvy9fUy7JqDzWdnhDnBYGppGrG
jSi5Tm0opb2/1t3DaybHpqtOh4J9FqMbSxE9n26ls3x1Y+yy2yOHtV7/AO2oPMGKxM8ZOVSo3Kc2
3Jva29rO759uwDaAemuhWgaXQDAz0hjPJqyjdrfGPowX2m7X52W65wyvd4e7p4/VzdHAOkWnqvST
EzxNXbLYt0YrZFdXrd3vO0mnjyy7rsQZWB3jwT9Dkv6zxKShG/ilLZltm+S3c7vcmcs8vR7Oj0/W
ijeEHpi+leJ8hv5PTuqa48ZPm93BW33NY46cern3UUA25Do3g46FvpRiNeqv2ak05/ae6HvfBc2j
GWWnfpYd1+4WjwtdMlipfN2Hf0dNrxrWxyWyHVHf9rL0TOGPq31upvxBw6x1eUWDox0dq9KMVDD0
sr5ylujFbW/dxdkZt03hh3XQ7x0/6Q0uhOCho3BeTUlC2W2EN8m/rSzz63lkcsZvy9fUy7JqDzMd
3hDvB4WeOnGlTi5Tm1GKW1t7CEmx6giqPgo0XuliJ/z1Gu/Vj7Ocjj7Ve/8AtqfePMeKxU8dUlVq
NynNuUm97Z1eC+QAoPSXg96O0+h+DnpPGeTOULq+2ENy+9LLLbsW25xyu/D3dLHsm6OHdKOkVTpP
ip4ipknlCP1YrYve+LbZ1k08meXddivpXK5jtHgp6HfOFT5dXX0VN/Rp+lNb+qP+LqZzyyevo9Pf
kQnhJ6Y/7SYjxVJ/s9JtR4SlscvdHlnvLjNMdXqd1+4c1NOAuXQfopLpXilTd1RhaVWXLgub2Lte
4zldOvTw76OmeFLpVHBU1ovC2ikkqmrsUV5sF6m+VlvZnCerv1s9eIOCWOrxiR0VoyppitDD0Vec
3Ze9vktr5Et0snd4HovT+kKXgz0bHDYdrx801F73J+dUfVu7FsTOM+1Xuyv1c1B5mlJzbbd2822d
ngGJXyCj0t0V0TS8Hej54zFK1acU5Levq01ze/nyjc5W9z3YT6ubo4RpDSdXTmIniqr8uby4Lhbl
Fd2TZ14eO5d12Gbs/utfyL3t+vkwg7T4Meiys9I4lJRV3TTySt6XUt27flqo55V6ujh60Urp10pl
0oxFoO1GN1BfZW2T+9a/KKXO+sZpz6mfdRR9e15rYvJh8evf1u5pxF16EdE30kxChJPxFO0qz4vd
Dr3cvK5Gcrp16eHdRffCV0rWHj8jw7SjCylbZrJZRXKCs3wk4Lc0Zxjt1c9eIOK+KlTjGjFXqVLN
9T82Pb5z/DvR0eUSujNES6QYmng6GcVtktn25+5X3KKZLdLJ3XUHoHpJpal0DwHiqNvGW1YLna13
3ZX3K18jlJt7c8vq4PN9GboQliJNupNtQb23fnT9dk+LbTvE7PB940o/IqNv7Ssu1Qv7ZNdequEi
HHzHf+jGjKXg80dPFYlfTTSclv8As01z4877kcre57cMfq5ujivSTSdXSVVxn5VWUtapb6+xQXKC
8lL6zltudJHlzuxH46Li4YSn5Ti/KtnrVHk7cbebHqbXnFZvuGY5a8oYWj5Sg7ZZ69SVlJrjnaMe
KSe1sF9wzHvXlDC0fKUHZWz16krazXG7tGPGKT2thb7hmkpJOGFpeUqbs2s9eo7azXFZKMeKSe1s
F9w3pVrDKOFhmqbbm16VR+d1qPmrdk2vOETLx4C9J/sEI4RbYvWq/wC8t5v4Fl95z3WIZePA3jV8
2UVh1+8nadXlvhDsT1pc2k84gvjwFSXzXhtX+1xCu+MaSeS65tX+6lukDifH8hvB/wBV4d13+8q6
0KXKOyc/8i65b4gnibGaHisFGWMkv3btTT31Xs7IrynzUU/OFMfHn97AdEYWOLqSq1rulTWvUd83
nlG/GTtHtb3MUxmwmnCp0hxXlNKVSTcn6MYrNvlGKXYkOD2qNaVxS0lWUaSfi4pU6Ud+qtnbJ3k/
tNlhbsOdOTWDUcHB3VK7qNbJVX53Wo5QXU36RIuXjwFVl8z4RU9lbEpSnxjSTvGP4mtZ8lDiF4nx
/IZoZfNdKeNl5yvCh/vGs5fgTv8AecRUx8efwDHQmj446rerdUaac6r+yty5ydorm0W1MZsCxVar
p/EuSV6lWSUYrdfKMVySslyQ4L9qh50hxEIyjhaTvSw6cU1slN+fPteS+yoki5e73A1dfM2DVPZW
xSU58Y0k7wj+JrXfJQ4g9mfH8gno9TWAjPHzWVGypJ+lWl5vZHOb6kt4q4+PP72IrRej56bxEad7
ObblN7orOUn1K7YvhmTuoLp/SUdJ13KmrUoJQpR4QjlHte182xDK7ElphfM2Gp4JZVJ2q1+tr6OD
+7F6zX1pchGsvszX4jWgF800amkJedH6OhzqyWcvwRz+84i+THx5/AQuhdFvTOIhRTspO8pPZGKz
lJ9STYvhnHHdBekOk1pbEOcFq0opQpR+rTjlFde982xDK7olNLf1Jg6eDWVWtq1q/FK30UH1J67X
GS4CeWsvE186EdFqa0eqmkKiyw6SpJ+lWl5i56uc391cRTDx5935iuYPB1dM140oeVUqzSV97k9r
9rZdsSdwmOleOhiKyoUHehh4+Kpv61vOn1yleXVbgI1nf4B1BfMOjXLZWxr1VxVCD8p/jkrc1F8S
cr7M+P5CN6K6LhpLEXrfuKMXVrP7EM2uuTtFc2W1nCboitM6TnpnEVMRU86pJu3BbkuSVkuSLJpn
K7uxZOkq+ZcNR0cspr6bEf7ya8mL+5G3bJknvdM/E186EdD4LRiraSmssNG1JP0q08odernN9SGX
nwYePPu/MU+hh6mkqsYQvKpUkkuLlJ/E05TyLP02xUIVoYKi70cHHxSa2Sne9SfbK/YkTF06nu9w
pLRpyaJaAENACWgBAAlooENACAgQwAbVgBDVgAbQANoAHJFAAiBLRQJAEtEAko1CWgikhRgQaAMs
AasAJCjADADAg0EGFBtEEpYVlsKMAMANoIFogMKo2AKRAbKD/9D3wel8h+VTQQYAYAYAYAYAasUC
bAGgDADADADADADADVggwATYA0FGAGAGAGAGAGggwIMAMANWChNiKMAMAMANFQYEGAGAGAGAGAGr
EUJsAaKDAgwAwAwAwAwAwAwA0AasEGrEUasUGgDADADADADADADADADADADQQYAYAYAYAasRRqxQ
YAYAYAYAaAMCDQBgBgBgBgBgBgBgBlgDVgoSAYEGAGAGAGAGAGAGAGAGAGioNWIBNgo0AYAYAYAY
AYVBoAwAwA00RQkAwAwAwAwAwAwAwAwAwoNgGAGFBgBgBgBgBgBgBqwBlgDLAGrBRhQYAYAYAYAY
AYAYACsRAqwBsAwAwAwAwAwAwAwAwAwAwA3YA2VRgBgBgBgBhAKCDADADZQbCjADaAFgGEUKQAoq
DZFG0AKQBsA2gBYBgApEUKKg2FCiA2igWiAUAbQAsijEUCyA2igWQCkFCwg2FC0AbACAGACwDaCh
YQbQULCBRFCkAKKBSIBRQYAYAbRAKIDZVGAGACkwg2QGwowAwAwoFBkbIowA0VAlkUYFGAGAGAGg
g0VBgBpkUJCjQQYVBgBqQUICDADABLAEgGMA0EGmFCQDQQYAYAYAIYBoA2mALANhRtACwDYAsAWi
KCRAFoAWAEQARBQVABUFBYkAaIUFQAVABYkUFiAFQUGTACogCxCgsQAqCgqYAZMKCoALEKCxACoK
DJkAVBQVABYhQaIUFQApAC0AKQAsKFgC4gCkRQtBAtBQsAwAwAS0AJAMANWAEtAGgBLQAkA0AJaA
ByQQCaKBDQAKSCAbQQCaAENXKgG0ACaCATQAKSCAUkACaKgE1YAE0EA2gATQQDasUA2gBDQQCaAB
yQAJoIBNAA2gBDQANq4QIaABtFQDaABtBAhoAQ0VANoAG1YAS0AIaCBDQAhoAS0ADaKBDQAloIEN
ACGgoQ0ECGrgA2gBDQANoCwNoIpDRQDaABtACGgAbQANoAQVBqxAIaKDViATYI1CWiqrRECGrFBo
gENFBoAS0ECQBLQAmwGikgKUgBSAFBQpABIkVBkBkVABUAFiFBYgBogB4kUHiAHiFB4gBokUGiAG
iFZo8SCDRKoPEgDRCg0SAPEANEKDIANEKDRAlFiRUGiAGiAGiRQWIAZABohQWIAaIUFIAgARABEF
C4gBIgC0AEAFIijZUGyKNoAWAYFG0AaAMANFZCWRQkINMoEMAGwAYANgA2ACkggDIAFIqAEgAUgA
MggDIoAyQQBkAFweCnpCpGnTV5S9XN8gSbHTMfiqfQ/CqlSzqy2c3vk/d2I5zy9NvZBx6tN1W5Sd
23dt72dXkAY03VajFXbdklvYB2DR2DpdCsI61azqyWfFvdBe/texHO+Xrk7IOOaTx9TSlWVWo7yk
+xcEuSOkmnkt2IuRWR1/oX0fhoak8firReq3G/ox49b3cus55Xb1dPHt80c26UdIJ9Ia7m8qccoR
4L4va+7cbk04Z591FVkacx0vwe9EvnGfyuuvooPyE/Skt/UvW8tzMZZO/Sw35ojfCF0t+e6viKL+
gpvavTlx6lsXfvVrjjpnq593gczaNuAtvQvopLpPiLSuqMLOpL2RXN+pXZnK6denh3UXrwldKo4O
n824W0UklU1dijugvfyy3sxjPV26uevEHCJHV4xJ6D0JV6QYiOHorypbXuit8nyXr2bWS3TWOPdd
DvXSrTVHwd4GGCwmVaUbRe9fWqPm3s58o2OUnc9meX1c1B5om3J3ebe07PAN0MPPFzjTppynJpRS
2tvYgsg9M4HDUPBTo11alpYidr/anbKK+zHe+t7Wkcfar3STpQeadI6QqaWrTr1pa1SbvJ/rctiW
5HaTTw278hkVkej/AAd9GafRTCy0njfJm4XV/Qh/wpcNtrLa2jjld+Hu6WHZN0cW6W9JanSrEyrz
yjspx+rHcuve3x5WOmM082efdRWLGnMdn8FPQr5xn8vxC+hpv6NPZKS9Lqj65dTOeeWnq6PT35oh
fCX00/2lr+Jov9mpPL7ctjl1bo8s94xx0x1c+74Dl50ecXroF0Ql0txKjK6oU7OrLluiub9SuzGW
Wnbp4d9HRfCr0vjhILReEtGKSVXV2JLZTX+blZcUZwx9XbrZ68QcAOrxiX0FoWr0gxEMNRV5Te3c
lvb5L8tpLdN44910PRPSrTFHwbaPhgsI/p5xai96v51R83u58o2OMndXtzy+rmoPMMpOTu82zu8A
VSpSryUIpuUmkktrb2JAHqDQ+BoeCvRkq9ezxE0tZb5Tfm01yW99b4I4W91e/GfVTdHmjSmkqumK
08RWetUm7t+5clsS3I7SaeK3Yj7FZHovwX9FIaDoS0rjLReq3T1vRhbOXW932fvHHO78Pb0sO3zR
yjpn0pn0sxTqu6px8mnHhH4va+7Ykbk083Uz76Kkacx1fwX9C/n6t8qrx/Z6TyT2TntS6ltfYt7O
eV09HR6fd5BvCn0z+eq3yShL6Ck/Ka2Tmvcti4u74Fwx0dbqb8DkiRt5haeiPRmp0qxUaEbqCzqS
+rHf2vYufK5m3Trhh3Udi8JPSan0cw0dF4O0ZOCUrehDh1y377Xe9M54zfl6ern2zUHnY6vEHeBw
NTSVWNGlFynNpRS4v9Z8EFk2PS2Kq0fBXoxQhaWIns+1Uazk/sx+C2u5x9qvdf5KfePM9evLEzlO
bcpSbcm9rb2s7PBbsCAPSPQbQFLoTgp6Rxnk1JRvntjDdFfak7XXUuJyyu3u6ePZN0cL6R6eq9JM
TPEVd+UY7oxWxL9Zu73nSTTyZZd12IMrI7L4K+h/y6p8vrr6Km/o0/SkvS6o/wCLqZjO6eno4b80
QvhE6XPpNifFUXehTdoW9KWxy90eWe9lxmmOrn3UUmyStus8+XpPrbyXLJmnIWroh0Zl0pxKptWp
K06zW6PowXN7v+WTNunXDDuo6L4S+k8MJBaNw/kxUV47V9GK2QXXlflZb2Yxjt1c9eIOGWc/vT7l
H3L2JcGdXkD7RuBnpStGnRV5NqNNc+L5LOT3LqFqybHoTSFan4OtHww2Hs8RUuot75W8qpL7MfZZ
bLnH2ntv8nNTkefZ1VipupK8qdPjtk221fnJ3lLO6V7bEdXi5AlUlSjKtJ3qVLqPU/Ol2+avxbGk
EHoHoRoGHQvBSxeIVq1RJtekk/Ngr+k21fZm0nsucsrt7enj2TdHG+kOlqnSrFtyktVXz2xSXnNc
kllvaSy1m79JNPNll3UQ8XHH1HKSaoU47N6itkfvSbzf1m5WtcrHI6h4N+jL0xWeksSl4uD+jW5y
W9fZhsXNfZMZXT0dLDfmhj006W/PFZ1YP6ChJxordOrvnzUVmvw/WZZNJ1M9/L8xz3BfsUHiX57b
jS+96U/wp5faaa81mnCePI3g1830nXfnyvGly3Sn2ebH7TbWcQTx5CsIvm6k67/eTvGlyWyU/wDL
Hm21nEhPHkbwS+bqTxD8+V4UuW6U+xO0ftO6ziCePI3o7+rqbxT867jR+9vn+FPL7Ti9zBPHkb0V
FYKLxcvQdqSe+px6oLynz1U8pCmPjyE6KpJOWJqrWhSs7P05vzYvjscpfZT3tAxnqMwFH5xqzrV2
3CN6lV75Z7L8ZN2XC99iYJN8jKUJ6fxLlNqKleU5WyhCKzsuEUrRXUkOF9qjWJqS05iIwpRsnaFK
HCKyin7ZPe22OC/ao3pjExqSjQou9KktWL+tJ+dP8T2b9VRW4SGVDjS39W044Necnr1v95bKP4E7
fecuQhl48Dcv6owtv7bEq74xpXy7ZtX+6lukF4nx/IZohfNlOWNl5ybhQ/3ls5fgTv8AeceYqY+P
P4BroXBRxVR1K37mktepzS2RXOTtFdd9wqYzYHLxvSLFZWdSrLJbEvhGK7ElyLwe1QTTuMhXnGlR
f0NFalPn9ab5yd3yVluJIuV/gHWk/wCqMPHCLKpO1Svyy8iHYnrNfWlb0Qt8TX4jejP6nw8sW/3k
706HLLy5/hT1U/rSv6I5SfZm/wAAw0Do+GNqudX9xSWvVf2V6K5ydorm77hUxmw2xeIq6exLla9S
rJKMVzyjFclklyHBftUSPSKvGi4YOk06eHTTa2TqPz5d/kx+zFCLn7vcCpfMmCvsrYtWXGNFPP8A
jkrfdi90hyvsz4/kG/RvCQ15Yqsr0cOlOSfpS9CH4nt+ypCphPX3CLtW07iN861affKT/XUOE9qi
T6TYqDnDC0Xejh1qRa2SltnP8Utn2VERc76e4OYr5iwDlsrYxWXGNGLzf45K33YviOV9mfH8gy6M
4CGIqyrV1fD4ePjKnO3mw65StHqu9wqYTfyETjcVV0zXlVn5VSrK9lxbySXqS7Bwzbuie6UzWj40
9H03eOHu6rWyVaXnvnq5QXU+Ijefjx7vzCtDf1HhKuOeVSpejh+KbX0k11ReqnxlyF8mP2Zv5QQO
gtEvTWIhRT1Yt3nLdGCzlJ9STZbdM4zuoJ0k0qtMYiU4LVpRShSj9WnDKK7s3zbEhnluiWx6+YNH
ww6yrYu1WrxVJfu4/id5vlqk5av2Zr3hp0QwUJ1pYqur0MLHxs19ZrzIfilZdVy1MJ6+4VzG4qpp
StOrPyqlSTk+bk93uRpi3YtXS1rRVOjoyH9gtetbfWmk5deqrQXaZnvdM/Hj3fmM6Jr5npVtJy20
l4uhzrTWT/BG8n2C+fBh48/h8RQ5XbuzTiEFFhDQFJaAEACWgBDAEMoENBAhoAQ0ADaABtAA2gAb
RQAkrBAkgENWKDQAhqwBoDRDVgK0AYAYEGgDAg1YKEhRgBgBgQYEBA0wwAwAwAWkRBsqjABSAFEB
hQf/0ffVj1PjvyqasRRoA0EGAGAGAGAGAGmigS1YA0AYAYAYAYAYAYAaCDAg1YKEhRgBgBgBgBgQ
aAMCDADAoTYgNBRgBgBoqDADAgwAwAwAwAwijVgBNgDRQYEGAGAGAGAGAGAGAGrAGgg1YijVigwA
0AYAYAYAYAYAYAYAYAYAaCDADADADADCA1YqjQBgBgBgBoAwINAGAGAGAGAGAGAGAGAGrEUasUGg
gwAwAwAwAwAwAwAwA0AYVAmxAaCjQBgBgBgBgBhUGgDADTQBoijQBgBgBgBsoMAMAMKDADADADAD
ADADADADADADADADADADVgDLAGrBRgBhQYAYAaZEGgDADADADADADADADADADADYUbKDADADADAD
CAUEGAGAGACiqMAMAMACAGEUKQBsqBRFGIAWgDYBiAFgGwBUSKFBBhVCyA2gBSAFIA2VQsyg2VQt
AGwBaANoihaCBQUKQAoAWgDYApACgBaCjYQLRFG0UCkQCyg2iAUUGwDADCAUEGyNDZQYAYAKCDZA
bCjADADEVAoIMAMZFCQowAwAwAwASVkYAYAJZFGgo0VkYAYAakAIAMAMAEsASAYwDQQJYUaANBBg
BgBgAMAwAwAWswDYBsKFoINhQtAC4hQtEARAC0AEiALiFBogBUFBUQBYgBYhQWIAZMigqACxCgsQ
AqIAqCgyACxCgsQAqCgyACphQWIAWJFBYlAVEUGTACoKCxYAWIUEQARBQREAsqgiVyAWooA3qgG0
gBVgBYBgBgBgBpq4AhqwBgBoAS1YA0AaaAEAGgBDQAJoqAbQANoIBNWAByQQDaAByRUA2gAUkEAp
IAE0EAmigC0EA2gATQQDaABtXCAbRQDaCAbQANoAE0ACaCAbQANgCGrAA2ggG0UA2rhANoAQ0ECG
igG0ECGgBDQAhoAS1cIEMAG1YAS0AIYAhooENACGggQwBDQAhoAG0AIauADaA1A2ioBtACGgAbQA
NoARJACGrhAixQaIBLRQJIDQRohoqq0RAhqxQaIBLRQJAEtBAloAS0BWwLspBTZSCJsoKbLIGy4h
UFQAVABUAFiFBYgBogB4kUHiAGiFB4kAaJVB4kAaIVkaJBB4lUGiQBogB4hQaJAGQUGiAGiFBogS
ixIINEKDRACxCg0SANEKCxADxACxIoMgBaACIAIgoWgAiACACwBaIo2VBtEUbQAsoMIowA2wDQBo
qDTIBIBplQDABgA2ADYAhgAmEAZAAZBAGRQBkACkEAJFAKQQCUHN2Su3sQB1HRuCp9FcO61b941n
x5RXv+COd8vTjOybHL9JY+ek6rqz2vduS3JHSTTzZXYi5FZHTeiOgo4CHy3EZZXjf0V9Z83u5dZz
yr09PHXmij9JtPS07VvspxyhHlxfN/kbk0455dwq0jTmL10J6L/Ok/H1V9FB5J+lJe5b+OziYyun
bp4b8hHTzpR85z+TUX9FB+U16Ul7lu4vPgMZo6ue/A5pI6POLD0W6Nz6R19TNU42dSXBcFze7v3G
bdOmGHdRfunvSSGiKS0fhbReqlO3ox+qub38uvLOM35durnrxBwySOrxh5orRVXTVaNCiryk+xLe
3yRLdNY493gd203pGj4OcBHD4ezryT1eLb86pL3LqWxM5Sd1ezK/VzUHnCrUdaTlJtybbbe1t7zs
8IFTpSryUIpuTaSS2tvYkEHo/Q2j6Hgz0fLEYizrzS1uLl6NOPJb31vYkcb9qvfjPq5ujztpjStX
TdeeIrO85u/JLclyWxHWTTw5ZbuxFMrI9A+DbonDQdF6UxlovVbhrehC2cnza2cuvLlld+Ht6WHb
5o5N026Vz6WYl1HdUo5Uo8I8Xze19i3HTGaebqZ99FONOQ654L+hPz5V+V14/QU35Keyc1/lW/i8
uJzzy09PR6fd5o14UOm3z5V+SUJfs9J+U1snNb+pbFxd3wGGOjrdTu8QckOjzC4dCuik+lmJVNXV
KNnVlwjwXN7F2vcZyunXp4d9HV/CZ0rhoOgtF4O0XqpT1fQhbKK5tbeXXlzxm/L09XPt8Qed7HZ4
hIaJ0VV03Xhh6KvObsuXFvktr5EvhqTu8D0jpnH0PBZo2OHw9niJp6r3uT86o+S3LqWy5xn2q9uV
+qmoPL9WrKvJzk25Sbbb2tva2d3gCYxc2kldvJJAHp/oxoij4NNHzxmK/fzSclvz82nHnx557I3O
FvdXvwx+rm6POmnNM1ekGIniKzvKb2bktyXJfrM7SaeLLLuuxElYHf8AwV9EI4SD0pi7Rik3S1ti
S21H/l5XfBnHO+j29HDXmjnPT3pfLpbiXKN1Qp3VKPLfJ836lZbjeOOnDqZ99FGNuI6Z4Nehf+01
fxtZfs1JrW+3Lao++XLLeYyy09HS6fdfuFh8K3TRY6fzfh39FTf0jWyUl6PVHf8Aa6jOGLfW6m/E
HFjo8osHRjo7V6T4mOHp5XznLdGK2t+7i7IzbpvDHuuh3Tp50hpdCsHDRuC8mpKFstsIb5N/Wlnn
1vLI54zfl6+pn2TUHm5I7PAHGFw08bONOmnKc2lFLa29hFk2PTVGFHwU6McpWliJ7ft1LZLjqx9l
98jj7Ve/+2p948z43GVNIVJVasnKc23Jve2dnht2GxUHo3wddGqfRfCy0njPJk4Xjf0IcfvS77WW
1tHHK78Pd0sO2bo430r6SVOlGJlXnlHZCP1YrYuve+fI6SaeTPPuuxWisDrXgv6G/PNX5XXX0FJ+
Sn6c17ltfF2XExldPT0envyA+E3pj8/Vvk1F/s9J7VsnPY31LYu170MZo62fd4HLDbzi1dEOjE+l
OJjRjdQWdSX1Y/F7Fz5Jkt03hh30dc8JHSanoDDx0ZhLRbilO3oQ+r1y377feuc8Zvy9PVz7ZqDh
GHp2Ws8r3XUt79y4t8jq8cEhhMJPH1I0qcdacmko835sepbW+F75ojcmx6DxNWl4MNG2VpYid8/r
1Htb+zH2WW1nL2q9l/koPOlecsRKUqjbk3r1JPa5Pd152629yOzw2gecvvT9S93uS4MIPQfQjQNL
olhJaQxXky1Lq+2MOr60nbLbbVjxOWV293Tx7JujkPSLTlXT1aVaSfjK3kwgvQp38mK5y37LrPZI
3Jp5ssu4QzpKrJUU/o6d3OSzz9J890Y8ctjkysDpfg66MfP1f5bWjahSaVOL2NrYuajtb3y45mMr
p6Olh3XY14Q+mHzjLxdJ/RxvGFvSfmzqdW2EPxvbYYw6uexzOqvkdNUl+8qWc+UdsY9uUn+Hembe
fgWXQXRyena8MDTyjF6+ImtzWTX4fNj9pyex5S3Tpjj3XX4jqHTvTUdGUoaJwVoylFKdtkKdt73X
V3J7o3b23MYz1d+rlr7MHEZxWk6saVN6tKCaTe6KzlN83nJrbsitiNvJyNtLS9ZRj5FGCsr+hTjm
2+bzb4ydltRTkZb55rW8ylFdepTj7X/im+LHByN2+eq9l5FOK61CnH2u2b3yk+LHC+0MlfTddRh5
FNK0b7IU45tvqV5Se93e1jg9qjK7ema8aVFWgvIpp7orO8uG+c3su29g4OaNY2fzhVhQw6bhG0Ka
3ybecnzk8+SstiQL58Qb0pWjeOGovWp07q69Ob86XbZKP2Ut7YhfcCaUawEFhI7YvWrNb6mzV6oL
yfvOT2NCGXjwFYr+qqCor97WSlV5Q2wh25Tl+BbUwXxBugvmnDur/a104w4xp7Jy/FnBctfkDifE
ZoeCwEJYyfoPVpJ76m1PqgvKfPVW8lMfHkB0ThI4ypKpWv4qmteq97V8op/Wk8l132JipjNjVqvS
LE7teo+qMYpeqMYrsihwe1RmmcXHFzjTo38TSWpTW9rfJrjJ3k+u2xIQyuw60x/VdOOCj5yevXfG
pbKP4E7fecuQjWXjx+I3Q/qbCupsrYhOMOMaWyUvxPyFyU+KBxPiA6Cw8Keti6qvTo2ai9k6j8yH
Vda0vsxfFCpjPX3BnhMNU0/ibOXl1JOU5vYltlJ8krtl4SfaoVpzSEcfVSpJqjTShSX2VvfOTvJ8
2ySLldh/pf8AqihHBLKpK1Sv963kQ/Cnd/ak1uJFy8TX4jNEr5noSxryqSvTofea8uf4U7J/Wknu
LyY/Zm/wEZoLRi0lWtUerSgnOrLhCO3texfaaFZxmwLSukJaZryqWtrNKEF6MVlGK6lZcxwZXuol
ukEloynDR8HnTevWa31Ws11QXk9etxJGsvHj97CtFL5lws8Y8qtTWpUOV19JNdSeqnxlyLyY/Zm/
wERoHRa0tXUJPVpxTnVl9WEc5P3Lm0hWcZsI03pR6Yryq21Y5RhHdGEVaMV1K3bmJ4MrsTOm/wCp
cNTwCyqStVxH3mvIg/uxd2vrSfAkay+zNfiEdGoLRkKmkZr9z5NFPfWkvJ/gV5vmo8S3yYePP72K
9o/A1NM14UYZ1KkrZ8Xtb9rfAcMSbok+lOPhiqqo0H+z4ePi6XNLzp9cpXl2rgI1nd/IPaa+YNHu
eyvjLxjxjQi/Kf45K3OMXxHK+zPj+QiujOio6UxC8blQpJ1Kz4Qjm11vKK5stqYTYYaa0pLTWIqY
ieTm7pborZGK5JWS6iyM5Xd2LDp9fMWEpYBZVJ2r4jjrSX0cH92Lu1xkZnlvLxNfOgPQ/Dxw0qmk
KqTp4VKUU9kqrypx7/KfKJaYTXn3CpTdTSNVt3nUqS7ZSk/a2zTnyLX0yqRwPitG02nHCxaqNbJV
pZ1H2ZRXCxnF0z8ePd+YoxtxCGrACWgNEACWgBLAENACGigQyAQyoENAA2gAckAIaAByQAGaKAQQ
aaIBBQaauAIArTVwNBgGAGAGAGBBoAwINWChIUYAYEC0FZrYEYALSIg2VRgBsAUiA2UGwM7f/9L3
2ep8d+VTADVgDRFGgDQQYAYAYAYAYAaaAEFBgBgBgBgBgBgBgQaANBBpoijRVGAGAGAGAGggwIMA
MANEUasAaCjADADRUGBBgBgBgBgBgBoijLACWig0EGAGAGAGAGAGAGAGAGgDQQYQGrFUaANAGAGA
GAGAGAGAGAGAGggwAwAwAwAwAwgNWCjRQYAYAYAaAMCDQBgBgBgBgBgBgBgBgBqxFGrFBoIMAMAM
AMAMAMAMAMANFQaIDVgDQUaAMAMAMAMKg0AYAYAJasRRhQYAYUGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGrAGWANNACQDADADADADADADADADZFGygwoMAMAMAMIDdgDYQYAYAYAK
KowAwAwAwAWgDZFCkAKCDYUYgBaANgGIAWQGyg3EKFkQYVQtEBtAG0UCyA2FC0EGwoUgDZALRQKI
BSAFIKFIAWAbQAsA3EAUAKiFCwgUiKFFQbRFCyoNhQsINhRgBgBtEAogMCjZQYAbQQbCDZGhsAwA
wA2ioNhBpkUaCjADADADQQaKgwAwKEkUaANFZGAGACZBQkIMAMAEsASAYwDQQJYUaYBoIMAMAEyA
EgGAGAG0wBYBsKFIAUAKQAtACyKCIAWgBaACIKCxACxACxCgyZAFQUFiAFiFBUQBUAGiFBYgBYkU
FQAVMKCoANEKCxACoKCpgBUQBohQWIAWIUFQUFQAVMKCoAIgAiCgiAFxIoJEAWAYAEAMANrMKNAG
BBgBq1wBLVgDQBoAS1YA0AaauAIAEtXABtAA2ioBtAA2ggE0ADaCAbQANoqATQQCkgATQQCaKAUk
EApIAE0EAmgAbQANoqAbQAhoIBNAApIAG0ADaCAbQAhoAG0ADaKgG0EA2gAbQQIYAhoqAbQAloAQ
AIaAENBAhgCGAIaAENACGUCWgBDQQIYANoAG1YAQ0AIaABtAaDaKgG0ADaAENAA2gAbVgDQQJaKB
JAJaKBNgK0RGiGiqNEQIasUGiAS0UCQBLQQJaANAC0AKChSQAogFoKCoAKgAqACxCgsQA0QA8SKD
RADRCg8QA0QA8SKDRAwNEKDxIA0QoNEAPEKDRIA6CgsQAsQoPFkEosQINEKDRYAaIAWJFBogBohQ
aIAaJFBYgBEAEiALQUEQARACwAgApEUKKg2iKNhQorI2RoYAbANAGFQJYAlkBoqBAANgA2ADYAhg
ApBAFgAZAAZFQBkACkEAZAAZFQX/AKMaFjg4/K6+WV433L6z93Ixa9GGOvNFS6Q6alpipdZU4+av
e+bNSacs8u4VuRpzFw6J9HfnKfjqq+ii8l9Z8Opb+7iYyunXp4bGdM+kfy6Xyek/o4vymvSa9y9b
7BjF6me/A55JHR5xNdHtAT09WUFlCOc5cFw63u79xm3TeGPcLz0y0/DQ1JYHDeTLVtK3ox4db377
Z7WZxm3fqZdviDjEjo8gcaP0bU0tVjRpK8pPu4t8lvFulk2O0aSxlHwfYJUaNnWls4uW+b5Lcupc
Wcp9p67fq4PP9erLESc5tuUm229rbOzxAEabqtRim23ZJbW2VB37QWjKPg9wUsTibeOkvK433U4+
/nnsRxt7ntxn1c3RwbTel6unK8q9V3lJ7NyW5Lkvz2nWTTx5Zd1EPIrA7l4OeicNGU3pLF2jaLlT
UvRjbOb5tbOWe9W5ZX0ezpYa80c16b9LJ9KsQ5K6owuqceX1nzfqVluN4zTh1M+6ikGnIdP8G3Qr
5/q/KK6/Z6b2P05Ld1LbLu3u2MstO/S6fd5vAd+FHpr86TeCw7+hpvy2tk5Ld92Pree5MmGOmut1
N+IONs6vKLR0P6LVOleJVGN1TWdSf1Y/F7EvcmZt06YYd1HY/CJ0pp9F8NHRmCtGbglK3oQ4felx
22z2tM54zfl6ern2zUHnE7PCH+jNG1dL1oUKMdapN2S975La3uRLdNSb8D0pjsTQ8FOjVSp2liJ3
t9qds5P7Mdy6ltbZx9qvdbOlPvHmLEYieLnKpUblOTbk3tbe1nd4LdgSWtktoB6a6H6Co+DzAzx+
MyrSjdrfFPZTX2m7X55bFc4W9z3YY/VzdHn/AKRaeq9JcTPEVnnLYt0YrZFdXrd3vO0mnjyy7rsQ
disjuvgq6GJf1niklCN3SUtmW2o77l6PO73JnLO+j19HD1opXhC6ZPpXiLU21h6bapri983ze7gu
bZrGacurn3Uc9NuI6J4O+hb6VYjWqJ/JqTTm/rPdBde/gubRjLLTt0un3X7hcPCt0zU/6twrShCy
quOy62QVty388tzM4Y+rr1up6QcKOrxic6O6Aq9JcTDDUVnLOUt0YrbJ9XrdlvJbpvDHuuh6A6Za
eo+D3AwwGDyrSjZPfFPzpv7Td7c7vdY44zuezqZfVzUHmRu53eEOKFCWKlGEE5Sk0opbW3sSMk8j
09o3CUPBXoyVWraWInbW+1PdBfZjvfW96Rx9qvfJ9VPvHm3SOkKmlq069Z61Sbu3+ty2Jbkdnht3
5oZBB6G8GnRaGgqD0pjLReq3DW9CFs5db3cvvHLK78Pb0sO3zRybpl0pn0rxLqu6pxypx4R49b2v
u2JHSTTzdTPvoqaRpzHVfBn0L+f63yisv2ek9j2TluXUtsuxb3bnllp6Ol0+7z6B34UemfzvV+R0
H9DTfltbJzXuju4vPchjNL1upvxByI28wsfRXo3U6UYmNCGUds5fVitr69y4slum8MO6jtPhB6R0
+imFjo3B+TNws7ehD/hS47bXe1pnPGb8vX1cu2ag862OzxBzhMJPG1I0qacpzaUUt7ZCTY9KxVHw
WaMu7SxE/wCepbv1Y+znI4+1Xu/tqfePN9evU0lVlUqS1pzblKT72zs8XIcPLYuGX+GPb50uPJkU
d86A9HIdHcO9IYvKbi2r+jF7X1y2LlbfJo55Xb2dPHtm6OR9Kukk+keJliJZQj5NKPD9bXxdsrHS
TTy55912K5qqPkvZHOXN8Pd3vYVzHUPBt0SemavyuuvooPJbpNbupb+WVmmc8rp6elhvyCeELpWt
O1nh6b/ZaDvNp/vJ7LJ8Ny/FLNIYzR1c+7x6Qc08a6adaXnzuoclscly9GPbazijbgJ/QHR2pput
HBU8m7Srz+qlu61w3zdn5tyW6bxx7vH4jr3TPTFLo/h46Nwr1EofSNbYUtj/ABzeS5u7tdMxjN+X
p6mXbNQcIpyWIlLEVEtSFlGG5v0YdSSu+Sed2jo8fPkHwFOpUl45JzrVJatJb3N7Zdl8vtNP0WFk
HeKMKPgv0a5StLET2/anbJfdj8XtZy9qvZP5KfeOE47FzjGU6jcsRiPKm3tUHmly1tvKKillJo6v
Hb+NDfEf1dS8V/aVEpVOUdsYduUpfhWTTBfA3i/6upeIX7ydpVeW+MOzzpfasnnEF8eBvGf1bS+T
r95K0qvLfGHZtl9qyecAXx4G8X/VlLxC/eTtKryW2MP80ueqtsQXx4G6/wDVdHxX9rVSlU+zDbGH
W8pS5aq4oF8BT/qqhb+2rrP7NL4z/wAC4TBxPiN4dfNVDxr/AHtVONP7MNkp9ucI/ie5A4g3oyPz
bTeLl5ybjRX298+qF7r7TjwZKTx5CNE0Ix1sTVV6dK2T9Ob82PVvl9lPe0KmM9RrBUHpetKpWk9R
XqVp77Xz7W2ox5tbgSb5GTdTpDiUopJyaUV6MIpZLlGMVm+CbY4PaozSuKji5xpUbulTWpTVs3nn
JrjJ58so7kIuV2HOlpLR0Fg47YvWrNb6lravVBeT95yexoRcvHgK/wCYNhv+PYiPbGl8ZtfwLhIn
JxPj+Q1oaC0fCWNmvMerRT9KrtT6oLynz1VvLTHx5DPRWB+c6rdWTVOKc6s96itva3kuMmhWcZsI
xtepp3EXjHObUacFuWyMV1Ky9Y4Le6h1p2vGjq4Sk06dG+tJbJ1H58urLVj9lJ72IuV9PcDS/qTC
auyviUm+MaN8l1zav91LdInK+zPj+QHoGhHDKWNqpOFG2pF7J1X5keaVtaXJW3lqYzXn3CNwWDqa
dxChe86km5Te5bZSfJK7YSfaoLp3SMcdUUaWVCktSkvsre+cneT5sSLldiR0ivmTCxwiyq1tWpX5
LbTp+vXkuLitxFvia/EI6P01o2E8fNfunq0U/SrNZPqgvLfPVW8tMfHn97ENo3R9TTWIjST8qbvK
T3LbKTfBK7ZazJ3UOekGkoaQqqNLKhSiqdJfZW985O8nzZIuV2JLGf1Fgo0NlbEqNSrxjTWdOH4n
5b5apOVv2Zr3hv0ZwsKUp4ysr0sMlKz2TqP93Dteb+ymWmHvvoIP6XTNffOrVn2uUn8WXhnkTfSj
EwpShgqLvSwycbrZOo/3k+15L7KRmNZ+73A+jl8w4KeKeVbEa1KjxUNlSf8AkT5y4F5J9mb94hNA
aJ+ecRGk3qwV5VJ/VhHOUuxbOdkL4Zxx7qE9IdK/POIlVitWmrRpw+rTjlGPdt53ZYZZbomdIf1B
gIYZZVsVq1a3FU1+7h2+e190nLV+zNe8M+ieAhUqyxVdXw+Gj4ya+s72hD8UrLquKYT1voK/j8ZU
0tWnWqeVUqScn1t7vYkac7di0dKmtD0aWjIbaf0le2+tNbPwRtHruZnny6Z+PH4/EJ6I01oyNXSd
RK2HWrRT9KvPzevVV5vqQph48+78xR6k3Vk5Sd23dt72zbkBNBAkoENWA1CWgBAAloAQ0AIYAhoo
ENACGggQ0ADaABtAA2gAUkABaCBJQJaIBJQJaAEAWNNBGiQo0AYAYAYAYEGggwA1YKEhQqIEpQGS
0rAGwDADABSQDZRBNsKIWiA//9P32el8d+VTCgwAwA1YgEhRoIMAMAMAMAMANWuAJasAaKDADADA
DADADADQQYEGrBQkijCgwAwAwA0EGBBgBgBgBqxFCbAGBRgBoqDADAgwAwAwAwAwKNEAhlQYAYAY
AYAYAYAYAYAYAYAaANBBhAasFGig0AYAYAYAYAYAYAYAYAaCDADADADADADCA1YKNFBgBgBgBoAw
INAGAGAGAGAGAGAGAGAGrBQmwQYAYAYAYAYAYAYAYAaAMKg0QGmgo0AaAMAMAMANFQYAYAZYA1YA
0VRgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgAMAwAwAwAwAwAwA2RRhQbA
MKDADADLEBuwQbAMAMAMAMAFBRhQYAYAYAYAKiAKIoUgDZUCiKMQAtAGwDABaIDZQbQULIgwqhSI
BQBsqhZEGwoUggURRtFAogFIoFkBtBQsINoKCAGIAIAYgBYBtBQQINoKFhBsihSCBRVCkQGyg2AY
AYQCgg2RRsKMKDABSCDZAbCjADADADdwg0FGAGAGAGAGgg0VBgBjIoQFGBBoqDADABMgoSEGAGAC
WAJAMYBoIEsKNMA0EGAGACGAaAMAMAMAFoA2AbChYQKChYAtBQSJALQAsAIgoKmAFQAWIUFiQBUw
oMmAFRFBYgBYgBUFBUwAqIAsQoLEAMmFBUwAqCgsQAsQoNEKCoAKmQBUFBYgBYhQaIUEQARABIhQ
SIAREUEQAQAwAWgo2EGIKFNACQgwAwA0AIeQBgBgAhqwBoA01cAQAIaAByQQCaKAbQQDaABNBANo
AQ0VAJoAFJBAJoAFJBAGSKATQQDaABNBANoAG0EA2rFANoIBtAAmgATQANoIBtACGgAbQAhoIBtF
ANoIBtAA2ggQ0ECGigG0AJaAEMAQwBDQQIaAEACGigQ0QCWigQ0AIaAENBANoAG0AIaABtWAsDaA
pDRUA2gAbQAhoAG0AIasAaAEtFQJIDTRQIaArREaJaKoSRAlooEkAlooEgCWgg1YKFBAoKFkBtFA
tEUEQAZABEFBYgBYgBYgB4kUGiAHiAGiFB4gBokUGiBgeIUGiQB4hQaIAaIUHiQBYhQaIAaIUGiB
KNEggsQoNEANEAMiKDRACxCgyADRIAsQoJEAJEAIgoWgAgAQAIgBSIoUVBsijAoWVkbI0MANgGgD
GEGmUCGQGioEMAGwBDABsAGwAcggCwALAAyKgDIACwgFIAs/RrQXy+Xjai+ji8l9Z/Bb+7iS11ww
2NdKtPfLH4ik/o4vymvSa9y9b7BIdTPfgUdmnAS2gtCy01V1dkFnOXBcOt7u8lum8ce4XDpTpqOi
qawmHydrO3ox4db9nNmZNu2eWvEHJ5I6PKD4HR9TSdWNKmryl6uLfJC3SybHV9IYul0HwipUrOrL
Zze+T5LcupcTnPtPVb9XBxGvVlXk5ybcpO7b3tnV46G6puo1GKu27JLa2wg7dobRtHoNhJYjEW8b
JZ8eUI+/v2I5W9z2Yz6ubo4ppnStTTVaVaq83sW5LclyX5nWTTyZZdwhpIrA7J0B6LxwEPnDFWjZ
N01LZGO+b93LPerc8r6PX0sNeaOfdNOlMukte6uqMLqnH/M+b9Sy694zTh1M+4UpmnIdF8H3Q35/
q+PrL9npvZ9eXDqXpd2/LGWWnfpdPu8+gfeEvpl84SeCw7+ig/pGtkpLcvsr1vqRMMV63U34g47I
6PMLF0U6MVOlOJVGGUFnUn9WPxexLjyTM26bww7qOwdPuk9Ponho6NwXkzcbO3oQf+aXHbte1pnP
Gb8vV1M+yag85M7PCHWjtHVNK1YUKMdapN2S/W5bW9yG9LJseksTWw/go0aoQtPET2fbnbNvfqx+
C2u5x9qvfddKfePMmLxU8dUlVqycpzbcm9rbOzwW7DdK+wqD0x0L6PUegGCnpDG+TWlG74xi9kF9
pu1+dlubfDK9z3dPH6ubo4L0l6Q1ek+JliKu/KMd0YrYl7+LuztJp5M8u67EAVzHcvBX0LVV/OWK
VqcM6SlsbW2bvuW7nnuV+WeXo9nR6frRU/CL00fSmv4uk/2ak3qL6z3zfu4Lm2axx05dXqd1+4c5
NuAv/g/6Gy6V4i801h6bTqPjwiub38FzsYyy079Lp91+4Xrwp9Mo0o/NmFaUYpKq45JJbKatuXpd
keKM4Y+rr1up6QcFsdXkEzoDQNXpHiIYeivKk83ujHfJ8l69m1kt03jj3XQ9CdKtNUfBvgIYLCfv
5RtF71fzqkubeznyjY4ydz2Z5fVzUHmKUnN3ebe1nZ4QqjRliJKEE5Sk0klm23sSBoen9DYCh4K9
GyxFezxE0tbi5ejTjyW99b2WRxt7q92M+qmx5t0tpSrpuvPEVnrTm7vlwS5LYuR2nh4sr3eRHFZH
obwX9EoaJpPSmMtHyW6et6MLZzfNrZyz3q3HO78PZ0cNeaOZdN+lk+lmJc81RhdUo8FxfN7X2Lcb
xmnn6mffRTSuY6d4Nehf+0dbx9Zfs1J5/bltUerfLlZb8sZXTv0un3fAS/hT6afOM3gcO/oab+ka
2Skt3VH1vqQxjfW6m/EHG0jo8osfRjo7V6TYmOHp5LbOW6MVtfuS3uxm3TeGPddDuHTvpDS6GYOG
jsF5NSUbZbYQ3tv60s89u18DnjNvX1Muyag83nV4QfDYaeMnGnTTlOTSiltbexBZNj0xhqNDwWaN
c5WliJ7ftztkl9mPxe12OPtV75rpQebsdjamkqsq1WWtObbk+f62Lcjs8Fuw1Kg9CeDnoxT6P0Ja
Txlotxbhf0IW87rlu3267HHK78Pb0sO2bo5L0v6TT6U4l1pXVNZU4/Vj8XtfdsSOkmnnzz7qIajT
1Fsu3bLjfzV27XySzzDI6b4OuiPz5W+U1lehSeV/Tnv61x5WW0zldO/Sw7vId+Erpd86VPkdB/RR
b1mtkmsm/urNfxPdFkxh1s9+IOUa1s1uygvf+t7y2HR5xO9G+j0+keJjhqfmrOpPcktr90eee9mb
dN4Y910OydOtPw6L4aGjcFlVnFRSW2MHl/FLYu15ZGMZt6upl2zUHCFSjUfik/o6flTkt73tcfqx
3b8rs6PGHOFjLFTVVRvJyUKMFneWSSXFRy63a97sE8jveEo0vBno5znaeJqbeM6j2RW/VXxe12OX
tV7ZPqp944XpKvV0jVdNvWqzlrVZcZ8L7FGCuuC8p31bW6x475DVwjjZqlB2o0025W3elNri8rLb
5sdoOR2zoJoGGCg9KYpKEVD6GMvQpr0nzebvvu36Rzyvo9XTx15o5v0g6QPpRiZ4qqv2ejlTg99/
Nj1yteXCKavkjcmnDLLuu/QV3DS13PF1vKs8k9k5vNK3BbZLZa0ctZFYnvGYN6mti6vlNSerfPXq
PO74qPnS4vVT84E94zA/QqWLq+U1LyE89aptu77VHzpcXqp+cCe8bwEfF62Lq+VqvyU89eo8877U
vOlxyi/OCT3jeAppueKr+VGLvZ569R5pPivSlyVsnJEJ76MwVP5ZOeJxF5Qg9ad9s5PZHrk9vCKk
9wJN+aMw0HpetOrXdoLy6kluXCO67yjFbFluQJ55GRUtP4jO0I2z+rTpxXsillvfNscL7VGYmpLT
NeNOjFqKtClDhHnuu85Sey7b2AvkZpXERm44ei70qV0mvTk/On22svsqK23EMr6A+lH8201hI+cm
pVnxnuh1Qu195y3JCF8ePxCpf1Ph7f22IjnxjSexdc9v3Et0xyvE+P5DNFr5rpvGS8+7jQX298+q
F8vtuPBgx8efwDbQ+DjiZSq1r+JpLWqcZcIJ8ZPLkry3CpjBpRq9IsTu16j6oxS9kYpdkUXhPaoV
pnGRxU406N/E0lqU+L4yfOTzfDJbEiQyuw70p/VFFYNfvG1Ou/tejT/CneX2216KDV8ePxG8B/U2
HeKeVWrrQo8lsnU/yx5tv0SE8Tf4BnoTAQxM5Va37iitepz+rBc5PJcFd7i1MZsN60q3SDE3S1qt
WSSS2Z5JLgkrJcEhwnnKh1p7FQTjhaLvRoXSa9Ob8+fa1aP2UhFyvp7g5l/UeEt/b4qN3xjRvkuu
bV/upfWJyvsz4/kG/R/CQi5Yusr0aFnqvZOb8yHa85fZTLUxnr7hGwp1tPYm3n1q09vFye18F7EO
E9qh90hxsKko4eg70KCcYP60vTn+J7PsqK3CNZX09weL+ocFfZXxce2NG/tm1/CvtE5PZnx/IMej
uj4YipKtXX7PQWvU+19WHXJ5dV3uLamE9/oIzG4qrprESqS8qpVlsXF5JJdyS4ZDhLe4TnSSrHAR
ho+m040buq1slWfndaj5i6m95I1n48e78wTQq+Y8NPHvKpK9LD/ea8up+FOyf1pchfJj9mb/AAEB
obRUtM14UYu2s7yk9kYrOUnySuy1nGbocdI9KR0pXvTVqNNKnRjwhHJdr8582xFzuxKV1/s/gFT2
V8YlKfGNFPyV+NrWf2UuI5X2Z8fyEd0Y0ZDG1nVr/wDE9CPjKvNLZHrk7RXW+AqYTfyETpbSNTTN
edep51SV7cOCXJKyXJFnhm3dFj6Q/wBR4alo5eflVxH35LyYP7kXmtms2SeW8/szX4gPRLDxwbqa
QqpOnhknBPZKs/3cex+U+CQph7/d+YqsnU0lVu7zqVJdspSftbZpz5Fp6X1Y6PVLRtJ3hhk/GNbJ
Vpee/wAOUFwsyT3umfjx7vzFHauacgkAQ0ECWrlCEMDRLQAgAQ0AIaAENACGUCGgBDQQDaAByQAN
oAHJADd5BAloASUCWiASUCWrACQNRgRWmgBNgDQUYAYAYAaCDCoMIDEgqURKwVnbYE2wBtgDbYEL
RAYUGwBZAf/U9+HpfIflU0EGFBgBgBq1yASFGBBoAwAwAwAwAwAS0AJAMKDADADADADADQQYEGgo
1YgNFUYAYAYAYEGgDAgwAwAwijVgBNgowAwA0VBgQYAYAYAYAYAIYUaCDADADADADADADADADADA
DADQBoIMIDVgo0UGgDADADADADADADADADQQYAYAYAYAYAYQGrBRqxQYAYAYAaAMCDQBgBgBgBgB
gBgBgBgBqwUJsEGAGAGAGAGAGAGAGAGgDCoNWIBNgo0AYAYAYAYVBoAwAwAwA1YA0VRgBgBgBgBg
BgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgAiQBoAwAwAwA2RRgBhQbAMKDADLEBuwQbAMAMA
MAMAMANhRsoMAMAMAMAMANxAFkUKQBsqBRFGIAWgDYBgAtEBsoNoKFkQYUCkRRsAUVQpEQKCjaCB
ZFG0UCiA2igWQG0FCwgUFC0AbAFoA2ALQBsAWgDYULRAbKBSIBRQKRAbCBRVGAGAG0QGwDZFGygw
A2gg2EGyKNhRgBgBgBgBgBgBgBoINFQYAYAaZFCQoxhBoqDADABMgoSEGAGACWAJAMYBoIEsKEgG
BBgBgAMAwAwAwAwAUmAKANhQpACgBaAFxAFoigiACIAWgAkQoKmAGTACoigsQAqCgqYAVMigqACx
CgsQAyACpkUFQAWIUFiAGTCgqYAVBQWIAWLCgsQAqIoMmAFQUFiAFiFBEAEQUERAECgiACIA2AKi
FCggwKFhAloKNBBgBgBpq4UIAMCDAAbVgDADTVwAYAhoAE0VANoAG0EAmrAA2ggG0ADkioBSQQCa
ABNAApIIAtFANoIBSQQCkgAbQAhq4QDaKAbQQCaABNXABtAA2ggG0AIYANoIBtFAOSCAbQAhhANq
wAhoqBDQAhgCGgBDQAgIENWAENACWgBDKBDAENBAhgCGgoQ0EA5IAG0AIauADauBYG0VFDYANoAQ
0ADaAEgCWrACQBLQQJANNBAloqtQkiKS0UCSAS0UCSA00VAhoKNBBtBQpIAUQCkUCiKCoAKgAsQA
kQoLEAKgA8QA0SKDRADRCg8SANEKlHiBkaIUHiQBohQeIAaIUGiQBogBohQaIAWIVmjIgDRCg0QA
0QAsSKDxACxCgyACoANEigkQAiAFoKCABEAEQAuIApEULKgwijYULKyNkUYFGwDQBgQaKgQRRoqB
LAByAByAByAEMAFIIBSAAsoAyCAMgALCCU0NoiWlaltkF5z9y5slum8ce4WPpJpiOBh8loZO1pW9
FcOt7/zJI6Z5a8Qc3kbecHwOAnpKoqdNZvuS4sb0smx0jH4ul0Rw6pUs6ktnN75P3dxznl6LeyDk
Vao6zcpO7bu297OrygMabqyUYq7bskt7CDrmjcFS6GYWVatZ1ZLPjfdBe/v2I53y9cnZNjkWldI1
NLVZVajze7cluS5I6Tw8uV2ImRWR1foX0cjo6Hy7E2jZXgn6MfrPnw5Z7Xlzyr09PDXmih9LOkku
kNa6uqUcoR975v1LI3jNOOefcKhJGnIX3oL0S+eqnj6y+gg9j9OS3dS393G2MstO3S6fd5Dnwh9L
vl8ng6D+ii/La9KS3LkvW+pDHFer1N+IOTSOjzCf6L9G6nSbEKlHKCzqT+rH4vYl7kzNunTDDuHV
enHSWn0Xw8dH4PyZ6tnb0Iv/ADS47d+1pnPGb8vR1M+yag89s7PEHOj9HVNK1Y0KMdac3ZL3vktr
e5Et0sm/A9D4mth/Bbo5QhaWIns+3O2bf2Y8OpbXc5e1XuuulB5rxmKnj6kqtSTlObbk3vbOzwW7
DRLWyW0IPSPQ7o9R6A4OePxuVZxu+MYvZBfaeV+dlubfHK7e/p4/VzdHCOk3SKr0nxMsRVyvlCO6
MdyXve93Z1k08eefddivWNMDuHgt6FKq1pHFK1OGdJS2Nr03fct3PPcr8s8vR6+j0/Wiq+EXpq+l
FfxdJ/s1J+T9p75v/LwXNsuOOnPq9Tu+A5ubcRfugHQyXSvEXmmsPTadR8eEVze/gs9tr5yy069P
p91+4XzwpdMo0I/NmEajGKSquOSSWymrfzfw8UZwx9XXrdT0g4IdXjEzoDQdXpHiIYeivKlte6K3
yfJevZtZLdN44910PQvSfTNDwa4CGDwlvHyi9Xir+dUlz4c+UbHGTue3PL6uag8xzm6jbbu3m29r
Z3eAKo0ZYiShBOUpNJJZtt7EgD07oXR1DwW6OliMRZ4iaWtba5ejTjyW99b2JHC3ur34ydKbo846
Y0tV05XniKzvObu+CW5LktiO0mnhyy7vIjLFQegvBh0Qhouk9KYy0bRcqetsjG2c3za2cs96txzv
o9nRw15o5j066XT6W4lyV1QhdUo8t8nze/grLcbxx04dTqd1FJNuY6d4NehL6S1/HVl+zUnn9uW1
R6t8uWW/Lnllp36XT7vgJ/wpdNlj5vR+Gf0VN/SNbJSXorlH1vqzmOLXW6m/EHGDbyiwdGOjtXpP
iY4elknnOW6MVtb9y3uyJbpvDHuuh3Tpx0hpdBsHDR2C8mrKNstsIvbJ/alnbtfA54zb19TLsmoP
NqVzs8IcYbDTxc406acpyaUUtrb2IiybHpjCUKHgr0a6k7SxE7X+3O2UV9mPHre12OPtV7prpT7x
5t0hpCppSrOvWlrTm7t/rduS3I7PDbsMwg9C+DfotDQNB6TxlovVbhrehC2cutrZvt1nLK78Pb0s
O3zRyrpj0on0qxLqu6pxypx4R49b2vu2JHSTTzdTPvoqZpzHT/Bt0M/2grfKKy/Z6T2P05fV6ltl
2Lflzyy09HS6fd59BI+E/pl86VPkVB/Q035bWyUlu6o+t57kyYxrrdTfiDlGHpeMd7XStlxb2L9b
rnR54LT0e0FU6SYiNCnvu5T+rD0pdb2RXZzJbpvHHuuh2Pprp+l0RwsdH4TyZalm1thDjf60tz27
ZHPGberqZdk1B59flbcm1eT4R3L2epcTq8QXRpzxMoqnFuc2o04rbnll+tt3tRF5HozAYWh4MdGu
pUtKtLOX25vZFcl7Lyscvar2yTpQcBxeNq4ycsTVblXrt25J5Nr/AAxW5X+yzq8Vu/PvA/EXtQi0
kvKqS3XW3sislxbdr3QNeg7b0C6PwwFN6TxK1Ixg/EqXoU1tm/tSzfa2tqtzyvo9fSx15o530o6U
T03WeKd1FXjhocFvqPnw+1v8g3Jpwzz7vP4CqSXyCnq/2tRZ8Ywexdctr+zZek0Vz4HROhHRH51q
alRfQ02nXf1prONJco7Z88t0WYyrv08N/qH/AIRuk70vVWjcK/Ii7VGsk5LdfZqx2vddfZGM15Xq
578QcyqQ+Xzjh6L+jhe0nknvnUlwWV+UUltWe3DnwNzj851I0qXk0oJpN7orOU5c3te17Iq9kQ5G
5L52qxp0/JpQTUb+jBZylLm85PnktyByN1P63qxpUvJpxVo39GCzlKXrlLuWVkDkZWvparCjRVqc
fJhfKyWbnLhfOUnuWWxIHIzFS+cKkMPh03CL1aa2OTe2T4OTzz2RSV7RKXz4gzSFRTcMNQ8qEHZN
enN5OXbsj9lLe2IX3QK0nNYKCwsGnqu9WS2SqbLc1HNLi9Z7GhC+PAXjP6ppfJ1+9naVbktsafZ5
0vtWW2I5L48Dcf6noa39tXjlxhSe19c9i+xfdJDk4nxG9GR+bKbxcvPu40F9rfPqhu+21wYpPHn8
AHROEjUcsRXzpUrOS+vJ+bC/2nt4RUnuFpjPUaoUqnSDEOU5Ja15TnujFZt24JbF1JbicJPtUZpD
EPS1aMKUXqK1OjDa0r5LnJt3fGTYL5DnTFWOFjHB02nGm71JLZOpsb5qPmx7X6Qi5ePALP8AqXD6
uyviIpy4wpPNLrntf2EvrMnK+zPj+QToemsBB42or6j1aUX6VTbfqh5z56q3imPjyGejME9L1n4y
TUFedWbztFZyfNvYuMmlvLwzJsI0ni5aYrXhGyyhTgs7RWUYrnx4tt7wW7D7TdRaPhHA03dU3rVZ
L0qux9kF5K56z3iNZePH72F4X+o8M67yr1040uMaeyc+t5wjy1nwJyT7M37wz0Fo+GKnKrW/cUVr
1Of1YLnJ5Lld7i2pjN/IM8VWraexDlbWqVZJKK55RilwWSXBDhLe6iQ0/iIYdQwVFp06N9aS2Tqv
z5dS82P2VfeI1lfT3A+F/qLCOs8q+ITjS4xp7Jz65eZHlrPgTlZ9mfER2gNGQx9Vyq5UKS16r+yv
RXOTtFc3fcW1nGbDTSePnpmvKrJeVNpRitiWyMUuCVkhrSW91Ezp+a0VSho+Dzg9eu1vqteb1QXk
/e1mSN5ePH4/EK0FFaHoz0hLz03DDp76jWc+qCd/vOIqY+PP4CA0Xo2ema8aMX5U3nJ7EtspPkld
stZxm6HnSPSUMfVUKOWHox8XSX2V6T5yd5Pr5CLldiSf/Iv4G2yvjF2xoJ/52v4Y8yctezPj+Qje
jmi4aQrOdbLD0YupWf2V6K5ydorr5FtZwm/gI7TGk56Zrzrzyc3klsilkorklZLqGtJle4WDTn9R
YWGAWVWdquI+815FN/dTu19aXIk8t5fZmvxDfophYUJTx1ZXpYZKST2Tqv8Adw7/ACnyRamE9fcK
zWqVNJ1XKV51akrvi5SfvZWORaOldSOjYU9G02mqF5Vmtkq0vO7IryF1Mkbz8ePd+YzorTWiKdXS
c1+58ign6VaSyfPUV5PsF9y4ePP4fEUic3Ubcndt3be9mnECaKBLVwBBQJasECGrgaIAEtACGgBD
AENFAhkAhoAQygG0EA2gAbVgAbQAGaKAZECGUGiAQyg0AIYBoDW2ANsCG2mgGybWAm2gptgBgBgQ
aAjAgKGmWAGAGAC0iA2UGACkAKID/9X34el8h+VTADQQYUGAGAGEAkKNAGggwAwAwAwAwA01cAS1
YINFUYAYAYAYAYAYEGgDAg1YihNgowoMAMAMANBBgQYAYAYAaIo1YA0FGAGioMAMCDADADADTQUJ
sAaAMCDADADADADADADADADADADQBgQaAMIDVgo1YoMANAGAGAGAGAGAGAGAGggwAwAwAwAwAwAy
xFGrFBoAwAwA0AYEGgDADADADADADADADADTQAm1gDADADADADADADADADRUGgDTRAaCjQBgBgBh
UGgDADADADADVgDLAGiqMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMANSQAgAwAwijYBg
BsoMKDCA3YINgGAGAGAGAGAGAGAGwo2AYUGAGAGAGAGAGIAKRQpAGFQKIowAWgg2FGAC0QGygxBQ
siDZQKRFGwBRQKRAKCjaCBRAbKoWQGygWiA2gBaKDZFC0AKAFRAFACogGwBcQoUECkRQoqDaIoWV
BsihQQbKDYUYAYQCgDZAYFGygwA2gg2EGyKNhRgBgBgBgBgBoIMKDQQYAYRQkKNAGggwqDADABDC
jQQYAYAJYAkAxgGggSwoSEGAGAGmAIAMAMAMAMAMACAGACkFCwBSAFoAWRQRAC0AEQARBQWIAWIU
FRAFQAVBQWIAWIUGRAFQAWIUFiAFiRQVMAMmFBYgBYhQWIAVBQZMAKiKCoALEALEKCoKCpgBUwoK
gAiACIKFoAJEigkQBYBtBQsIMAFoKMCBDQUYEGAGACWgoSEGAGmrgCADADTVwATQANoAG0VAJoAG
0EA2ggE0AIaKgE0ACaCATQAKSCAMkUAmggG0ACaCAbQANoIENFAJoAG0EAmgATQANoAG0ECGgBDQ
AJoIEMoBtBANoIENAAwBDRUCGgBDQAhqwAloAQ1cIEMAQ1YAQ0AIaAENFAhoAS0EA2gAbQANqwAh
oAG0ADkgNENFQDaABtACGgAbQBoIENWANBQloIEgGggS0VWoSRFJaKBJAJaKBJAaaKgQFG0ALIDZ
QLIDaCgiACoALEALEKCIAKgA8SANEKDRADxCg0QA8SKzRogQaIUHiQB4hQaIAaIUGiQBYgBohQaI
AaIVkZEAaIUFiAHiAFiFBokAaIUFiAFQAZEUFiALQARBQQAIgBaAFxAFhQsIMANkaC0VBtEBgUbA
NAGBBoqBLIoSVAmQAiQAOQANgA2ADYAKQQBkABZUAZAB8DgJ6RqKnDftfBcRasmxd9I42n0boqlS
89rL3yfu+CMTy729s0OZVJObbbu3tZ0eYDhSlXkoxV5N2SQB03C0KXRLDupUzqS283uiuS/M58vT
J2Qcu0hjZ6QqOpUd5P1clyOkeW3YjpFQdO6L6Dhomm8Zicna6v6K49b/AFmznbt6cMdeaKJ0j07P
TlXW2U45Qjy4vm/yNyacM8u4VmRpzF56GdFvnOXyisvoovJP0mvct/F5cTGV07dPDfkI6cdKfnKX
yai/oovymvSa9y9bz4DGHUz34g5rJHRwE90Z6OT6RVlBXVOOc5cFwXN7u/cZt03hh3DofTXpHDQF
FYDCWjLVtK3oR4fefHbbPa0zGM35d+pn2+IOFyOrxhxo7RtTS1WNCkrzk7L4vktrFulk2O743E0P
BrgVTp2lXnsvtlLfJ/ZW5dS3tnL2nstnTg864rETxk5VKjcpybbb2ts7PDbsNlFzdkrt7EEHofot
oOj0Bwcsbi8q0o58Yp7IR+09/PkrnG3ue7DH6ubo4T0j0/V6SYiVervyjHdGO5L38XmdZNPJnl3U
V4rA7d4Muhay0li0lCOdJS2Zem77l6P8W5X5ZZej1dHp+tFP8IXTN9KK2pTbWGpvyF9Z/Xfu4Lm2
axx059Xqd1+4c5OjgOgeD/oZLpVX1qiaw1NrXf1nuguvfwXNoxllp26XT7r9wu3hQ6Zxpr5swjSj
FKNVxyVlspq25el/DxRnDH1det1PSDhFjq8gmuj2gK3STERw9FZy2vdGO+T5L1uy3kt03jj3XQ7/
ANKdN0PBvgYYLB/v5R8nir7akub3c+UbHGTuezPL6uag8yzm6jbbu3m29rZ2eELoUJYmcYQTlKTS
iltbexIGtj05ofR+H8FmjpYivaWImlrW2uXo048lvfW+CONvdXvxk6U3R5x0xparpyvPEVnec3fk
luS5LYjtJp4cr3eRFlZHoTwZdEIaIpPSmMtG0XKmpejG2c3za2cs96txyy34ezo4a80cw6c9L59L
cTrK6owuqUeX1nze/grLcdMcdOHUz76KUacR1Dwa9CP9pK3j6y/ZqTz+3L6vVvlyy35c8stPR0un
3efQTPhT6bLHyeAwz+ig/pGtkpL0V9mPrfUrzDFvrdTfiDix1eQWLov0bq9KcTGhTyW2ct0Y737k
t7M26dMMO66HdOnHSOl0GwcNHYLyarjbLbCL2yb+tLO3a+F+WM35evqZ9k1B5qW07vCHWFws8bON
OnFynJpRS2tsySbHprCUKHgp0a5ztLET2/bnbKK+zHj1va7HH2q98k6U+8ebdIY+ppWtOvWlrVJu
7f63LYluWR24eG3YaBB6F8HPRWn0foPSeNtGWq3DW9CFvO+9Ldvtltdjlld+Ht6WHbN0cn6ZdKqn
SvEuq7qnHKnDhHi+b2vu2JHSTTzdTPvoqZWB1Lwa9C/9oK3yiuv2ek9j9OXDqW2XYt7tjK6ejpdP
u8iQ8J/TP50qPBYd/Q035bWyclu+7H1vPcmMcTrdTfiDkB0eYWHox0dq9J8TGhTyW2ct0Y737kt7
M26bww7qO29OekVLoZhI6OwXk1HG2W2EN7b+tLPPbtfA54zb19TLsmoPOkIObstrOrxCZw2FdeUa
VNOUpOyS2vWyy5y2LhHOxGpNj0LhqVHwaaPdSdpYipa6XpTtlBb9WPsu9rscvae2T6qfePPmkMdP
SFSdaq9eUpXk/rS4dS2Ldbhc6vFbsM2tqb5zfPh+t/JXCDu3g46Lx0dTek8UlGTjemnshC3ndbWS
5dZzyvo9nSw15o570t6SPpXiXUbaw1HKK2X/ADlbsSvbJm5NPPnn337hWPGukvHS/eTygl6KWWsu
FvNjws3lqq9YHQugvQ/52qfSL6Gm0632pLNUupbZ88tyZnK6d+n09iV8IXSdaUqPBUpWw9HOvJb2
tkV1PJbtblG5MY11c9+PT1HK4TVdvEVEtSNlCG5tebFcltly2u8kzbz/AHib6NaHraarqSzq1G3F
v0c/KqvlH0dl52t5rRLdNYY7o630t01S6CYKGCwmVWUbJ74p7Zv7Td7c7vdY5ybenPL6uag4ZP8A
q2nq/wBrVV5cYweaXXLa/s2XpSR1ePgbxH9W0/Er97NJ1PsraodeyUudlk07lvgbxX9W0/EL95Kz
qvhvVPs2y+1ZejmL48DeL/qyn8nX7yVnVfDeqfZtl9qy9HMXx4G8V/VdLxC/ezs6v2VtUPZKXOyy
cXcXx4G639U0fF/21VJz+zB5qPXLKUuWqt8kDgbX9UUb/wBtWjl9im9/XP8Awcpqzk4+Y3hP6ppf
KH+9mmqK4LZKp7Yw53e2Ku5J48jWjKawUHi5pPVdqUX6U+LX1Y5N8XqrY3ZSePITo3DLESniK93T
h5U885yeyF+Mne73RUnuJaSetGUKc9O15TqSss51JWyjBcFyyjGPG0UOCfaozE1ZacrxhSjZZQpQ
+rFbFfvcnvbbHBftBWlsTBauHou9KlfyvrzfnT7dkeEUt7YhlfQOMf8A1PR+Sr97O0q74b40+zzp
fasvRIt8ePxG8H/U1D5Q/wB9VTjR+zHZKp7Yw56z2xQ5J9mbDfQ2Eg9bEVlejSs2vryfmw7bXlwi
m9ti1MZ6gVGnV6Q4l6zWvNuUpPZFLNt8IxXclZDg9qhWmMdHGTjCkmqNNalNb7b5P7Unm+u2xIQy
uw90m/meisHH95K0q75+jT/Dtl9t29FEW+PH4hWjF8zUXjJfvJXjh1wfpVPw7I/ad/RY5J48/gI/
Q2j1pCo3UbjRprXqy4RW5fabtGPNlqYzYFpHFz01X1lHOTUYQW6KyjFdSsue3axwlvdRIacqR0fC
OBptNU3rVZL0qux9kPNXPWe8kay8eP3sE0f/AFHh3in++q60KH2Y7J1P8sees/RHKz7M3+AjNCaM
jpKr9I9WjTTnVlwgttubyjHm0W1nHHYBpfSEtL13UtZO0YQWyMVlGK6llzee8RMrsS+m5LQ9GOAj
591PENb52yh1QTz+05cCRvLx4/EZoGC0VTlpCaV4PUoJ76tvO6oLyvvaqFMfHn8PiIPR2j6mmq8a
UXec3nJ7t8pN8ErtsrEm6HvSLSMMZUjTo5YejHUpLiltk+cneT60twi5XfyEgv8AkX8FfZiMXHtj
Qv7ZtfwrmTlr2Z8fyEb0e0XDSNVyrZUKUfGVX9lblzk7RXN8i2s447DDTGkp6YrzrTVtZ5RWyMVl
GK5JWSEiZXYn9Nf1DhoYBZVZ2q4jk7eRT/Cndr6z5EnlvL7M1+IB0XwsKLnjqyvSwyTUXsnUfmQ7
/Kl9lPiWphPX3CuValXSlZyledWrLtcpP3srHIsnSmrHR0KejqTTjQu6rWyVZ+d2R8xdT4kjefjx
7vzG+jFNaJp1NJVF+68ign6VaSyfVBeU+dhfK4ePP4fEVKhh6mk6sYQTlUqSSXFykyuU8iydLsVC
jKGBoO9HCpxuvTqP95PvyXJIR0zvp7hTGiuQSUCGgBLQAgqBDVgLCWgKQAIaAENACGgBDAENFAho
AQ0ADaCAbQAJgApq6KGwWECWQCSgS0QCSgS1cASAaAMAMAMsECbAGrAGgowAwAwICIKywAwAUkAK
IDCg2AKRAbAP/9b360el8h+VTQBgBoIMKDADADCAS0FGgDQQYAYAYAYAYAYAJaCBIUYUGAGAGAGA
GAGggwINEBpoKNFUYAYAYAYEGgDAgwAwAwijQBqwBoKMANFQYEGAGAGEUaANWANWKDQQYAYAYAYA
YAYAYAYAYAYAYAaAMCDQBhAYAJsVRgBoAwAwAwAwAwAwAwA0EGAGAGAGAGAGAGEBqwUaKDADADQB
gQaAMAMAMAMAMAMAMAMANWAEgGAGAGAGAGAGAGAGgDCoNWIBNrBRoAwAwAwAwqDADQBgBgBgBgBl
gDVgDViqMAMAMAMAMAMAMAMAMAMAMAMsAbsAZYAyxQZYAywBlgDLAA7EBhFGAGAGygwA3YINgGAG
AGAGAGAGAGAGyKMANlBhQYAYAYAYAYAYAYQBAoWggwoFEUYALQQbCjABaIDZQYFCyA2VBtBQogNo
oFIgFIA2VQtEQbChaANkApFAogFIAUgoUgBYBtACwDaAFACkALANoKFhBsihSCBRVG0QGwg2VRsA
wA2iA2EGyKMCjZQYAKCDAg2RRsKMAMAMAMANBBoqDADADTIoSFGBBoqDADADAoQAaCDADABDANAG
MA0ECQoSEGAGACZACQDADADADADABUWAKANhQtBAoKFgC0FBIkAtAC0AEQUFQAaIAWJFBEAGTCgq
ACoigsQAqACphQZABERQaIAVABUFBUwA0QoLFgBIhQaLACoKCpkAVBQVABYsKDRCgiACIAJEKCRA
CIigiACAGBQQIMAFRChQQaaChABgQYAYAIaCjQQYAJaChIQYADaAENAApIqAbQANoIByQAJoIBtA
A2ioBNAApIIAyQQCaABNFQDaABNBAJoAQ0ADasEA2igG0EAmgATQANoAG0EA2gBDQANoIBtFANoI
ENAA2ggQ0AIYQIaKBDQAhoAQAIaAENBAgAQwBDQAloAQygQ0ADaAENBANoAG0AIaABtAWBtAUNoq
BDQANoAQ0AIaANBAloASFGmggQAaCKS0VWiSIEtFAkgEtFAkgNNFQYgDZFC0ig2QC0FC0AFiAEiA
FQUFQAVABokAaIUGiAHiFB4gBokVgaIAeIUGiQBohQaIAaIUGiAGiQBohQaIAaIVkaJAFiAGQUGQ
AaJFBUAGQAWIUFiQBkVQVEARABABaCgiAFxACRAFhQsiDCg2RQpFApEBgUbQBoAwA0VkJZFCQg0y
gHIAGwBDABgA2ABkEApAAZFQapUJYiShFXk3ZIGti+xjT6MULvOpL1v4L9Zsxy9HsQc5xeIli5uc
3eT2m3nt2GTVyoOi6D0VDQtN4mvlK18/RXxf5cTnbt6Mce3zRRdN6Wnpeo5PKKyjHgvjxNyacMsu
4QcisC79E+jvylrE1l5C81Pe1vfJet8jNrv08N+aI/pb0i+dJeKpv6KL2/WfHq4d/VcZpnqZ7FGk
acRPdGuj0tO1bO6pR8+XuXN+raS3TeGHcLb0y6RR0fD5FhrRsrTa9FfVXPjy5vLOM9XXqZ68Qcgk
jo8odaM0XU0xWjRpK8pb9yW9vkhbpcce4di0pj6PQHCKjRs60llfa3vnLlwXZsTOUnc9eV+rmoOC
4irLESc5tuUndt7W2dnivkN40nWajFNybsktrbAO9aD0VR6AYOWKxNvHSXlceUI+/v2I5W9z2Y4/
VzdHDNO6Zq6eryr1Xm9i3RW5Ll7du06yaePLLuuxByKyO1+DrohHCx+ccXaKS1qalsSXpv8Ay9/A
5ZZej19Lp680UTp30vl0nrWhdYem3qLj9p83u4Lnc1jjpx6nU7hQZG3EdB8H/Qp9Jq3jaqaw1N+V
9p/VX+bgubMZZadul0+74Cy+E7poql9HYVpU45VXHY7egrblv55bnfOOPq6dbqekHD2dXkE50b6O
1ek+Ijh6WV85S3Rjvb9y3vIlum8cO6ju/S7pBR8H2DhgcFlWlHLjFPbOX2nu557FZ8pO57M8vq5q
DzTKTm7vNvazu8ANhcNPGzjTpxcpyaUYra2yEmx6Z0fhMP4KtHOrVtLET222ynugvsre+t8Ecfar
3yTpQeb9K6Uq6arTr1nrTm7v3JcEtiXA7SaeG5b8iNsVB6H8G/RGGgKL0pjbRlquUFL0IW85/ae7
elzeXHK78Pb0sO3zRynpt0tqdLMS5u6owuqUOC4vm9/Ytx0xx08/Uz76KYVzHVfBp0H/ANoavymv
H9mpvY/Tkt3UvS47ONsZZaejpdPu83gSHhR6cfOk3gcNL6GD+kktk5Lcvsr1vPcmTDFet1N+IONH
R5hZuinRir0qxMaFPKKzqT3Rjx69yW98rkt03hh3Udt6d9JqXQvCR0bgfJqONstsIva2/rS47dsu
Byxm/L1dTPsmoPNh3eEOcHg6mkKkaVKLlObSilvbIsmx6ao08P4J9GuUrTxFTb9udtnHUj7M9srH
H2q93jpT7x5n0hj6mlKs69aTlUm7yb/WzcluWR2k08NuwzKyPR/g76K0+jGHlpPG2jPVbjf0Icfv
S4bbZbW0cMrvw93Sw7ZujkXS/pRU6V4l1ZXVOOVOH1Y/F7W+zYkdJNPNnn30VUrmOreDToT8+1fl
VeP7PTeSfpyW77q38dnG2MstPR0en3eaD+E/pr88VPkeHl9BTfltbJyX+VbuLz3IY46XrdTfiDkZ
t5xZuinRqp0oxMaMMo7Zy+rHj17kt75XJbpvDHuuh2jp30kpdEMLHR2C8mo42dtsIPff60uO3bLb
Y54zfl6upn2TUHnQ7PCHGEws8dUjSpxcpzaUUt7ZFk2PSlCnQ8FmjnKVpYie37c7ZJb9WPxe12OP
tPf46UHnDHY6ppOrKtVk5Tm7t/rduS3LI7R4bdguHpaqu9ryt17F1v2X4oJB3zoD0ahoOi9I4u0X
quUb+jG2cutrKK3R5yaXLK78Pb0sO3zRyvpZ0lqdJ8Q6r8mFmqUX6MN8nze/b6om5NPPnn3UVi+x
x6oL39/r35WK5jong+6HfP8AV8bVX7NSefCpPh1Lfyy9J2zldO/S6fd8BYfCR0seNl834Z5em1kn
yvw47rZ5omMa62e/EHJ1GFTK/wBDTzb2OTfDm7WXCKvbKRt5xO9HND1tP4iOqrTl5uWUIxyc+qOy
C3ytnkyW6bwx7qOt9LdNQ6HYWno7Ar6ea1Y22xT2yf2pO9ud3uRzk29OeXZNQcJlT8e1h6bWrHyp
z3NrbJ/ZirqO95tK8rHV5PuB6FD50qKEFJUYZJLznd8N85v1/ZjkJ5HoDB0qXQDBSxNdLx0klqp7
7eRSjyW9538qTucvae2fyc3Rwetjp6SqTx2J8puXkxeyUt0bfVirX5Wj6Vzq8e9+aG2Hk6SeLq+V
JyeonnrT2uT4qN7vjKyzWtYk94zCP5JF4qpnNt+LTzvLfN8VH1yttSkgTx5GYP8AYo/Kp5zbfik8
7y3zfKO7jK21KSBPHkZgV8ji8VUzd2qSeetPfJ8VHbzlZZrWsJ48jMDBUk8XW8pJ+Qnnr1NufFR8
6XHKPpXQnvGYKn49zxWIvKEXd321JvNRvz2ye6N97VxPfRvC0npSpOviG/Fx8qo1le+yMd13siti
WdrRZCefNG4Rlp6u5SahFK8n6NOnHLLklZJbW7Laxwe1RlectN1o06MbRXkU4382Kzu3s4yk9l7v
JDgv2hmksRGpq4ehd0qbsmlnOb2ztz2RW6KS23uLfSA2kpLRlP5JDzrp1pLfJbIdUd/GV9qUQt8e
PxC1/UtD/j9ePbCk/fP1Q++OT2Z8QnRVNaPg8ZNXadqMX6U/rfdhk3xlqrZcGPjyG+jMH84VJVKz
fioeXVlveexfak8lzd9iYTGbGqs6vSHEJRS1ptRhFbIxWSS4Rit/BNveOD2qC6YxcHq4ei70aV7P
68n50312suEUltuJDK+gd4pfMlDxCyr1knV4xhtjDreUpfhXEcrfszXvGtEU1oym8bNXaerQi/Sq
fW6obectVcRTHx5/AMtGYF6WqvXlaCvOrN52itr5t7Fxk0t4qYzYTpTGvS1a8I2gkoUoLPVisorm
974ybe8cGV2H+mJrRdNYGD8pNSryW+puj1Q2fecnwJFy8ePxC9Gf1LQeMl+9neOHXDdKp+HZH7Tv
6I5J9nz+AjND6NWk6tpvVpQTnVn9WC29r2RW9tFqYzYFpfSD0tWc1HVirRpwXowWUYr38Xd7xDK7
Erph/M1FYGPntqeIf2/Rp9UE8/tt8ESeWsvs+PxGaDprRdOWPqK7g9WhF+lV+t1QXlP7WqhTHx5/
AQuj8BU03XjTi/Lm25Se5bZSb4JXbZeGJO6h10g0jDGTjTo3WHorUpLit8nzk/KfYtwi5XfyEj/z
L+D4YjFx7YUfjNr+FcyctezPj+Qjuj+jIY+o51ssPRWvVfJbIrnJ2iuu+4tZxmww0tpGemK8q0ts
nlFbIpZRiuSVkhPCZXYndNv5jw8cBH942qmJf2reTT/And/ab4EnlvL7M1+IF0Zw8MKp4+sr06Ft
SL2TqvzI9S86XJcxTCa8+78xXpeN0tWvnOrVn2ylJ+9lc+RYOk9eOCUNH0WnChd1JLZOs/PfUvNj
yT4kjpndePd+YJ0dgtDUZ6SmvKj9Hh099VrOXVBZ/eaFMfHn8BVsHg6mla0aUE5VKkklzbe/2tmn
OTYneleNg5wwlB3oYZOEX9eb8+fa9n2UiRvO+nuDrQK+YMLPSMsqsr0sN95ry6i+6nZP6z5C+Vx+
zN/gKKzTkEBAhooEtXAEACWgBO0qBGwDWyJIBshoBsgCbIYDZDQDZDQDZDKGw2gJshoAG0EAmrAA
2gADQGiQgS0AJKBLRAJKBLQAgAwAwAwAwAwINNACbAGgowAXECVsCNpACyAwoMANoAWQGFB//9f3
+el8d+VRLQUaAMANBBhQYAYAYQCWgo0AaCDADADADADADADTQQJsAaKowAwAwAwAwAwINBBgBoij
VgDRVGAGAGAGggwIMAMAMANEUYAasAaCjRUGBBgBgBgUaIDADVgBNigwIMAMAMAMAMAMAMAMAMAM
AMANAGBBoAwgMANWCjRQaAMAMAMAMAMAMAMANBBgBgBgBgBgBgBhAasFGigwAwA0AYEGgDADADAD
ADADADADADVgBIBgBgBgBgBgBgBgBoqDQBqxAaCjQBgBgBgBgBgBgBgBgBgBgBgBgBlig1YKMANA
GAGAGAGFBsAwAwoMAMAMAMAMAMAMABsyDQBhQbsAbsEGwDADADADADADADADZFGAGAGygwoMAMAM
AMAMAMANpEApIA2FC0EGFAoijABaCDYUYAKRAKKDABZFGyoNhQogNooFIgFIA2VQtEQbChSANkAt
FAogFIKFBBsKFoA2ALANgCwDYAsA2ALRFGygUiAUUGyAUEGACiqMAMIBQBgBsijYBhQbTCDYQbIo
2FGAGAGAGgg0VBgBgBgAlkaGgDAg0VBgBgBjIoGVBgBgBgAhgGgDADQQICjQQYAYAIkAaAMAMAMA
NBBsKNoAWAYFCkALQAtAC4gBERQtABEALQAVBQVMAKgoKiALEKCoAKmAGRFBYgBIhQZABUAFTIoL
EALEKDRACphQVMAKmFBYsALFkUFiUBURQVMAKmFBosALEKCIAIgoIiAIFBEAEQBsAWgo2EG0FCwg
wAS0FCQDAgwA08woQAYEGACGrAGgDTVwAbABsAE0VANoIBtAA2ggG0ADaKgFJAAmggC0ACaCAUkU
AmggHJAApIIBtACGrhANoAE0UA2ggE0ACkgAbQAhq4QDaAENAA2ggG0UA2ggQ0EA2rACGggQ0UCG
AIaAENACGAIaAENBAhq4AkAQ0AIaAENFAhoAG0ADaCAckAIaABtACGrgaDaKgG0ADaAENACQBLVg
BIQJaAEhRpoIEtACQiwloqtEkQJaKBJAJaKBIBhAbSKBZAbSKoWRApBQWIAWIAVBQVABEAGiQBoh
QaIAeIUHiBKNEisjRADxCg0SANEKDRADRCg0QA0SALEKDxAUWIVkZEAaIAaIUGQAWJAGiFBUAFiF
BogBURQVABAAiACIAXEKCIAWgAgAtEBhQbIoUgBRQYRRsAxgGgDRWRpkUJAEsqBDABgAwAbAEMAF
IIASAB6rk7LawgvOjsFDQVJ1qvntZ8uS5/rYZvl6MZ2+RSNJ4+WkpucuxcEakcMrsRcisi6dG9CK
P7TWySzin/ifu7+Bm13wx9aIPpHpx6Unqw/dReXN8X7iyac88tirSNOYsPRzQD0vPWnlSi8+b4L3
8iW6dMMO4THS3pAoL5LQySym1/hXv7uJmRvqZ+kHNZI6PMHmitE1NM1VSp9be5Li/wBZkt01jj3D
pemtKUuiGHWHw/71rLiuM3z4fBWMSbejLLsmoOLVJOo227t5ts6vIEUsPLEzUIJuUnZJb2wa2O04
LC0egWEdWraVaW222Ut0VyW99vBHL2nrk+rg4npTSNTS1WVaq7yl3JbkuSOsmnkyuxFSRWR2boR0
Yhoem9IYu0Wo3ipehH6z5vcty5vLlld+Hq6eHb5o5x0w6Tz6S1r5qlDKnH3vm/VsOmM04dTPuFNk
ach0XoB0M+fanyiuv2eD2P05Ld1Lf3cbYyy079Lp93mh54R+mfy9vBYZ/RRflyXpNbl9let8lnMc
Wur1N+IOPtHR5RYOi/Rmr0oxCowyis6k90Y/F7lvfK5m3Tphh3Udi6bdJaXQzCx0fgvJquNstsIv
e/tS3b/S4X54zfl6epn2TUHnFu52eIOMDgamkqsaNKLlObtFLj+tr3LMbWTY9JQjhvBRo67tPEVO
+c7bOOpH2c2cfar3eOlPvHmrSOkKulas69aWtUm7t/rctiW5HaeHgt35DIqD0b0B6K0+iWHlpLHW
jU1bpP8As4vl9aWy230draOOV34e7pYdk3Rxzph0qqdLMS6srqnHKnD6sfi9rfZsSOmM08vUz76K
oacx17wZdBvnqaxmIj9BB+TF+nJf5Vv4vLic8stPT0envzQnwm9Ofnuo8Jh5fs9N+U16cl/lW7i8
+Axx0dbqd3iDkZ0eYWzof0UqdLMQqUbqnGzqT+rH4vYl27EzOV06dPDuo7B4QelVPorh46MwNoz1
bScf7OD/AM0uO2zvtaZzxm/L09XPtmoPONjs8QeaP0fV0rVhQoxcqk3aK/W7e3uWZL4ak2PS9SeH
8E+jbK08RU75ztt46kfZzkcfar3eOlB5lxuNqaRqSrVZOU5tuTe9v9dh2eG3YbBB6R6B9GKXQzCy
0ljvJqON1fbCL3W+tLht2R23OOV34e3p4dk3RxXpb0nq9K8S608oLKnD6sfi9re98rHWTTy5591F
XKwOw+C/oN88VFjcRH6Cm/Ii9k5L/Kt/F5bmc8stPR0unvzQPwl9N/n6p8lw8v2em82vTkt/3Vu4
7eFmOOk63U7vEHKTbzi1dEOi1TpXiVSjdU451J/Vj8XsS7diZLdOmGHfR1/whdKafRjDx0ZgrRnq
pSt6EOH3pcdts9rTOeM35enq59s1B53Orxh5gMDU0lVjRpRcpzdopcf1te5Zgk2PSbeH8Fejt08R
P+edu/Uj7Ocjj7T3eOlPvHmzG4yppCpKrVk5Tm25N72/12HZ4bdhsEHonoB0Yp9FsPLSWNtGerdX
9CH/AApcNtrLa2jlld+Hu6eHbN0cg6WdJqnSrEutK6gsqcPqx+L2t+5I6SaeXPPuogMPS13d7F6+
Xxe5XKxB1vwe9EPnup8prq9CDyTXny6uGy+61lnd255XT09Lp93kb8JPTBaVm8JRf0FJ+W0/PmvR
6l7bvchjNHV6m/A5XLepfjfsiv16kbecT3Rvo/V6SYhUYZXV5y3Qhx63sS39t1LdN4Y91Ha+l2nq
PQvCRweFylq6qS3Li+b2t7c9zcWc5NvVnl2TUHA9Saeos61TOT4J52b3X2ye6OV/OR1eMHw2F+cJ
xo003Ti1s2zk8suctkVuSu9kmFk2O/0lR8HOBlWq2dedlZb5W8mEfsxW/re1nL2ns/tuDgmkMfVr
ylWqvWxNfN/ZjLcuDkskt0OOtl1eO38aAyoujbDU86kmvGNcd0L8FtlucuUUwfcO4dBOjVPRlL5Z
WsoRTlBvJPLOq77rXUL7I3la8nbnlXr6eGvI5p0o6QT6Z4ptPUw9NPVv6Md83zeVl92O3buTTz55
d9+4VzLSlT6lClHr1YJ+uUm+V5PctlY5G4/1rUcpeRRprd6MFsiuMm++TcnvYORkF871HOfkUaaV
7ejBbIx4t7Fxk3J72ODkZFPTNVyl5FKCztmoQWSS4vcvrSd3tbHByFKL03W3U6UI9ap04+159cpv
jInByMnfTVaNOmtSnFWinshBZuUn3yk97vZbEOD2hmJm9JVIYfDp6kfJprY23tlLm9r4JJXtEF8+
IM0hWi9XDUPKhF7V/aTeTl1boLhna7YL7gTSElo6HyWDvK6daS3yWyCfCO/jK7zSiC+PAXU/qajq
f29aPl8YU3mo/eltlwjZelJDk9kbwK+aKSxMv3s7qguG51OzZD7V36Obknjz+ADorCwSliayvSpv
zX6c3sh1b5cIri0WmM9QnDUZ6drynUlZZzqzeyMVtdvVFb3aKHBJ3UZjK8tM1owpRairQpU1nZXy
XNtu8nvbbHBftA+lq0cNFYSk04Qd5yWydTY392Pmx7ZekSLldeAeS+Y6Fv8Akorxz4wpPdylPfwh
95jk9mfH8gjRFCOEg8ZVScYO1OL2TqbUvux86XZH0hTHx5DXA4Wem67c5bbzq1HujtlJ+5b20t44
STuozSuO+cqiVOLVOCUKUNrUd3XJvOXFtiGV2H+lZLRFL5FHz21Ku19ZbKfVDfxm3wRIuXjx+IVo
tfM1H5ZL95K8cOufpVOqOyP2/usXyY/Z8/gI3RGjvnSq9d6tOKc6s/qxW19b2Jb5NItTGbA9LY96
Wra0Y6sUlCnBZ6sVlGK58eLbe8QyuxKaXktD0VgY+e2pYhr63o0+qG/7bfBEi5ePH4jNCwWiqbx9
RK8Xq0IvfU+t1Q285aq4imPjz+Ah9HaPnpquoJ5ybcpvYks5Sk+CV2y8Myd1B9PaSjjpxhRuqFJa
lJPhvk/tSflPrtuEXK7EjU/5F/CamzEYqKcuMKO5dc9r+ylxJy17M++/kGPR/R0MVOVav/xPQWvU
5/Vgucnl1Xe4tTGb54gjtI42ppmvKrLOc3klu3KKXBKySHDNvdROadmtD0o6Pg/Ki9fENb6lsodU
Fl95yJG8vHj8Qno7Rjo+E9IVUnGk7UovZOs/N7I+c+xbxTDx5/exXqNCrpisoxvOrVl2uUntfvZW
ORNdJcXCnqYKg70cPday9Oo/Pn35R+ylxJGs76e4OtCL5hw8tIS/eSvTwy+1a06n4U7L7T5C+Vx+
zN/gK3o3RtTTNeFCnnObtfhxb5JZvkViTYkuk+koYqpGhQ/4nw61Kf2vrTfOTz6rcBGs7vxPQSGi
1/s7g5Y15V6+tTw/GMdlSp/ki+LZOVn2Zv38CsaH0VPTVeGHp+dN2vuS2uT5JXbNXwxjO7wJHpTp
SGPrKnQyw9CPi6S4xW2T5yd5N81wJFzu/hBWDTAQ0AJYQIaKBLQAgAQ1YAS1cqBAAhqwAhoAQ0AI
YAhooENEAhooBtAA2ggG0ADaAASQRqBtBQkIEtACSgS0AJANWAEtWANAGAGAGAGAGBBoATYA3EKl
LAhaQBgBgBsAUiA2UGAH/9D3+ep8d+VTCAS0AaCjADQQYUGAGAGEBpoASFGggwAwAwAwAwAwAwAS
0ECQowoMAMAMAMAMCDQQYAaIoywAkKMKDADADAg0AYEGAGAGEUaAMANWANNAGigwIMAMAMIo0AYA
asAJKgwAwAwAwAwAwAwAwAwAwAwAwA0AYEGgDCAwA1YKNWKDADQBgBgBgBgBgBgBoIMAMAMAMAMA
MAMIDVgo0UGAGAGgDAg0AYAYAYAYAYAYAYAYAJaANAGAGAGAGAGAGAGgDCoNWuAJtYijQBgBgBgB
gBgBgBgBgBgBgBgBgBsoMAMANWKDLAGrBRgBhQYAYAYAYAYAYAYAYAYAJkiA1YA2EGAGAGAGAGAG
AGAGAGyKMAMAMANlBhQYAYAYAYAYAYQG0ggUFGygwihaCDCgURRgAoIFBRgApEAooMAFoijZUGwo
UQG0AbRQLIDYUKQQKCjaAFEApFAogFIKFhBsKFoA2ALQBsAUgDYAtEAooFIihRUCkRQoqDYUbRAb
CDYUbKDADaIDYQYRRsKNgGFBtBBsINkUbCjADQBorIwAwAwA02RQkKMANFZGAGAGAGpEUIKgwAwA
wIEMKNAGBBoAQFGggwAwAQwDQBgBgBgBoqDZFGAC0AbANhQtAC0ALQAQigiAFoAXEAJEKCxADIKC
pkAVABYhQWIAVBQVMgCoALEKCxACoig0WAFQUFQAWIUFiwAqCgqYAVMigyACxACxCgsQoKgAqYUF
QARABEFBEFC4sgCRAFgCkFCggwKCBBgBgAloKEgGBBgBpq4UIAMCDTzChAQYAIaABNAA5IqAbQAN
oIBtXABtBANgA2ioBNAAZIIBSQAKSCATRUA2gATQQDaABtAA5IIBtAAmioBtAAmgAbVgAbVgBDQQ
DaABtXCAbRQDasECGgBDQQDaAENBAhooEtAA2gBDQAloAQAIasECGgBAAhooENACGgBDQANoAG0E
A2rACGrAA2rAagbQAhoqAbQANoAQAaAEtACQgS0AJCjTQQJaAEhGoS0VVJIgS0UCSAS0UGgBSANk
ARAG0FC0gAiACoAKgoIgAqACxIoNEANEAPEKDxAzRokVBogB4hQaJAGRVBokAWIAZBQeJAFiFBkB
KNEKg0SANEALEKDIALEgDRCgqADRCgsQAsSKCoAKAEQAtABEFC0AEAFgC0RRsqDaIo2gBRQbIowA
2wDQBhUCWAJIDRUAwAYAhgA2ADYANhACQBb9C6LWEj4+tk0rq+5cesza7YY680VzTOlHpKfCC81e
98zUmnPLLYgpFYFj6P6D+Xy8ZUX0a3fWfw49xm10wx2CdJdOfKL0KT8hec1v5Ll7RIuee/Ao8jbg
JLRGiJ6XqascorzpcF8eBLdN449wuen9Lw0FSWGw+U7bvRXHrf58DMm3XPLt8QcqlmbeYKw2Enjp
xp01eUnZILJsdWbo9CMLulVl3yl/wV+s2Y9p6f7bg45jcVPHTdSo7yk7tnR5Ldhi1cqDsHRrQVPo
zReMxWU9W+foJ7vvP8uJyt29WGPbN0cw6R6eqafrOpLKCyhHgvi9791jpJp588u4VuRpgdI6C9Ef
l0li8Qvoou8Iv0mt7+yvW+Sz55ZO/S6e/NDDp50u+eZ/J6L+gg82vTa39S3cdvC1xx0nV6nd4HM5
I6POLL0T6LT6TV9XNUo2dSXBcFze7htM5XTphh3UdG6d9KYaAorR+DtGWraTj6EeC+0972pZ7Xdc
8Zvy79TPt8QcEZ2eMO9GaLq6YrRoUVrTm7Llxb5LayW6WTuHoDG4nD+C/AKnTtKvPZfbOW+T+yty
6ltbZx9p7bZ0oPN2MxU8dUlVqycpybcm97Z2eG3YaKLk7LNvYioPR/RDo7R6BYSWPxtlWcc+ME9k
F9p7+eWxNvjb3Pd08Pq5ujhfSjpHV6UYiVepktkIbox3L4vezrJp5M8+67FbKwO1eDDoOsW1pDFK
1KGdOL2Sa9J/ZW7i89iz55ZPV0unvzRB+Efpu+klXxFF/s1N5fbl9bq+r378rjjpjq9Tu8eg5gbc
Bdug/Q+fSzEWd1QhZ1Jcvqrm/Us+Tzllp06fT7qOm+EjphDQtL5rwVotRUajj6EbeYubW3gubyxj
N+Xo6ufb4g89nZ4hJ6I0TV05Xhh6KvObtyS3t8EtrJbpcce7wPRuksbh/BXo9UaNpYid7X2ylvnL
7K3LqXFnGfar3WzpQeZsTiZ4ycqlSTlOTbk3tbe87PBbsCjFydlm2UHpXof0eo+D/Byx+NyrOOfG
KeyC+09/PLYm3wyvc92GP1c3RwnpN0iq9KMRKvVyWyEd0Y7kve97zOsmnkzz7rsV2xpgdr8F3QdY
trSGKX0UHelF7JNek/srdxfJZ8s8vR6+j09+aILwkdN30lreIov9mpvL7cvrdX1eWe/K446Y6vU7
vgOYG3AXToR0Qn0txGrmqMLOrPlwXN7uGb3Gcrp16eHdR1HwldL4aEorReCtF6qjUcfQhbzFza28
FzeWMZvy79XPXiDz7A6vEJLRejKumK0KFGOtObsl7W+S2t8CW6WTfgej8dicP4K9HKlTtLET2X2z
nvk/srcupbW2cfae62dKDzTicTPGzlUqScpybcm9rbOzw8gSVwg9IdCujlLoThJaQxvk1XG+e2EX
sil9aWV+yPG/LK7e7p4dk3RxLpR0jq9J8RKvUyWyEd0Y7l17297Okmnkzz7rsV0rA6/4MuhXzrNY
3EL6GD8hPZOS3/dXreW5nPLJ6ul09+aGnhI6afP9X5NQf7PTebXpyW/qW7jt4WuOOmer1O7xBzGE
HUdkbecXjop0Zn0krqlG6pxs6kuEeH3pepWV8mZt07YYd1HVOnfSWHRuhHR2DtGo42dvQhvfW+O3
a9pjGbenqZ9s1BwBZW1fw++T/WVtuWfR4gfBYOWPnGlSi5Nu0Y/Wk/ct/BcL3CybHo3D0KHg3wDc
mpV55yl9aX/BjfLZe9vOkcvae6T6uDgOO0jPSFSWLreU23qJ53fF7rLfubyStdLq8Vu/Ib+LlF+K
Wdap57b81bWm93GbezY7WlcDunQjo7S0BQ+XYnyYxi5Q1tyazm1xlsitqjZedKRzyu3r6ePbN0cu
6SdI5dJK7xVVfQwbjRpve+fqc+yO9Nbk08+efd5/AQEajwi8fN3rVLuHFcZ9e6PO8srRvWOPI6N0
A6HfL5eMrLyF5/U81DraznwjaPpSSxlXfpdPYceEjpY9IT+bsLnFNKer6Ur5QVtye3jLLdmxnqdX
PfiDmdaLVsJR8ptrXa9KfBP6sdi3N3lstbbh90G60fGuOEoeUr5tenPj91ZqN9ivLLWaQ+6DddeP
ccLh/KintWWvPfLP0VsjfZG7dm5Bfug3iPpnHCYfyoqW1f2k3lfqWyN9iu8nJkS+6DMXJLVwtDyl
rLWaz8ZU2ZcUr2h2v0rIX3DeOmsJH5LTd3dOrJZ601siuMY7Fxld5rVsL48BeMfzVTeHj+8lbxz4
WzVNdTzlxlZejdi+PAVP+pqWr/b1Y+VxhTfo/eks3wjZelJJyeyN4X+p6Srv99UT8Uvqx2Op17VD
neW6N7yT7PkD0bRjhYPFVUnGLtTi/Tnz+zHJy45R3uyk8eQnA4f5xnOviJPxcXrVZb5NvKK+1J5L
hnLYmCTfmjLVOkOI3Rv2RpwivVGKXXlvbHB7VGaRxSx04UaCfioeTTjbOTe2TX1pPuyjsSIW74Dn
SU1o2n8kptN3TrSXpTWyKf1YeuV3sUQuV14/EEpf1HQ1/wDkorR8jjCm8nL70tkeEbvehyez8aA6
IwsKUZYqsr06btGL/tKm1R6ltnyy2yQqYz1AcNQqafxDc5ZyvOpN7IxWcpPkty6ktw4J9qjNK45a
QnGFJNUoLVpR324v7Unm+btsSEMrsPtJSWh6XyOP7xtOu1xWyn1R2y4z+6iLfHj8RvRkVoel8sl+
8leOHXNbanVHZHjP7rBPHn8BH6J0f851G6knGlBOdWfCK29cm8ore2i1MZsa0njpaXrXjG0coU4L
PVisoxXF8eLbe8FuxI6XmtE0lgoPyrqVeS3zWyHVD1yu9yJFy8ePxCtERWiKTx015d3HDxe+a2z6
obuM7cGL5XH7Pn8BE6M0dLTFbU1rLOVSb9GKzlJ9XreW1l4ZxncF6b0ktIVEqa1aNNalKPCK3v7T
flSfFiGV2JPFf8i/hvELLEV0pVeMKe2MOuWUpctVcSctX7M160NNAYGnJyxNdXoUbNr68n5tNdb2
8IpsVMZ630EZia1bTddzd51asti3t5JJepLci8M37VExp+tHAQjgKTTjTetVktk6ux9kfNj2veSN
5ePH72F6DgtD0paQmvKTcMOnvqb59UFn95pbhfJj48/gIDAYCppmvGlDOdSW197bfBZtvgXhiTuE
j0i0hDESjQof8T0Fq0/tP0pvnJ59VluJGs76TiB/o/8A5F3CPFPKvXUoUFvjDZOp1vzY/iY5WfZm
/fwIHQuipaZrxop6qd3KT2Ris5SfJL4FrOM3QfpFpSOk6yVJatClFQox4QW9835z5sRcrsS1H/kW
8E6mzEYuLjDjCj6UuubyX2U3vJyvsz77+QgdBaIem68aV9WCvKpPdGEc5SfUtnOyLbpnHHYV0i0s
tL13KC1aMEoUofVhHJLre182xJoyy3RMU/8AkW8A57MTjItR4woXzfXN5L7KfEnLXsz4/kKMbcgh
oA0AIaAENFQJYAhoASAIasUCGgBLVwgGFCGrBAhoAQ0AIaAENFANoAG0ADaCAbQAGaAsCaCKSVQl
oiBLRVCQgQwDQBgBqwAlqwBoAwAwAwAwAwINABUgrLADADABSChREGFBsA//0ff56Xx35VMKDCA0
0AJCjADADRUGAGAGEBoATYKNBBgBgBgBgBgBgBgBqwQJsAaCjCgwAwAwAwINAGBBogMCjVgDQUYU
GAGAGggwIMAMAMANEUYAYAasAJasUGBBgBgBgBhFGgDADVggSUGAGAGAGAGAGAGAGAGAGAGAGAGg
DAg0AYAYQGAGrBRooNAGAGAGAGAGAGAGggwAwAwAwAwAwAwgNWCjRQYAYAaANBBgBgBgBgBgBgBg
BgBpoATYAwAwAwAwAwAwAwA0VBoA1YgNBRoAwAwAwAwAwA2UGAGAGFBgBgBgBgBgBgBgBgBgBqwB
lgDVgowAwoMAMAMAMANEBoIMAMAMAMAMAMAMANkUYAYAYAYUGwDCgwAwAwAwAwAwgFBBsijZQYUG
AC0QGFAoijABQQKCjABSIBRQYAKRFCioMChaIDYBsqhZEGwo2ggWRRiKBZAbRQLIDaChaCDYULQA
oAUgBQBuIAoAVEgFlBtEULKg2RQsINlUYQCggwA2go2UGACiAwINkUYFGwDCgUEGBBsijYUaCDRU
GAGAGMihIUaAMYQaKgwAwAwATIKEhBgBgBoIEhRoA0EGMAQFGggwAwAGAYAYAYAaCDTANoA2FG0A
LANhQpAC0ALACBQtEARAC0AEQUFiAFiFBUQBUAGQUFiAFiFBUQBUAFQUFiAFiRQWIAVABUFBUAFQ
UGiFBIgBogBUFBUyKCpgBUAFiwoNEKCIAIgAkQoJEAIiKCIAIAbQULCDAoWgDYQYAaAEtBRoAwIM
AEtBQkIMAEtBQkINNAA2ADYAJlQDaCAbQANoAG0EA2ioBSQAJoIBNAAmggE0ACaKgG0ACaCBDABs
AG0EAmigE0ADaCAbVwAbQANgA2ggQ0ADaCAbRUCGgAbQQIaABtBAgAS0UCGgBDQAhoAQ0AIAENWC
BDQAlq4ANgCGigQ0ADaABtBAhoAG0ADaAENAaDaABtFQDaAEtACGgDQAloASEGmgBABpoAS0AJCN
ktFAkgEtFAkgNFQbIoUkUCiAWkVQogFoAKgAqCgsQAiACxIoNEANEAPEKDxAwNEig0QA0QoNEgDR
Cg0QA0QAyCg0SANEKDICUaIEFiRQaIAaIUFiAGRAFiFBUAGQUFQAaJAFiFBUALQARAC0FBEALACA
C0AbANkUbQAoqDZGhgBsA0AYwg0ygQyA0VAgAGwAbAEMAGwAUggsWhNE+M+lqLyV5qe/m+Rm11wx
9Qy05pf5a9SD8het/Dh3lkTPLYrMjTkJTQ+iHpOeeUF5z9y5+wlreOOxOdINLrBx+T0csrSa3Lgu
fH47JI3nlrxBz+RpwBsFgZ6RqKnBZvuS4sbWTY6DjcVS6KYdU6edR7Ob3yfLh3GOXot7IOV16sq8
nKTvJu7bOjy0AjTdVqMVdvJJbwg6novR9Lonh3Xr/vGs/dFe/wCCOdu3qxnZN0cv0vpSppeq6tTs
W5LgjpJp5ssu4Q0kVkdL6HdGlSXyzEZJK8E9iS9N+7v4GMq9HTw9aKv0u6SvTtTUhdUYPyV9Z/Wf
u4LrZrGac+pn3ClSNOItvRDoq9P1Ned1Qg/Kf1n9Ve/gubRnLLTr08O4WLp30qVGLwOFaUUtWo47
El6C9/dxJjHTq5+kHHZI6PIJHQuhaunq0aNJZva90Vvb/WbyJbprHHuuh2bTulqHg/wkcNhreOkv
J43e2cvcuzYjnJ3PXll9XNQeea1SVeTlJtybbbe1t7WdnhA6VGWIkoQTlKTSSW1t7gD0NoXRdDwc
YKWJxNnXkvKttvupx977diVuNvc92OM6c3RwPT2mqvSCvKvWflPYt0VuS5L89rOsmnjyy7vIg2Vg
dz8HHQyOEj85Yy0VFa1NSySS/tHf+X+LgcssvR6+l09eaKH096ZS6U1tWDaw9N+QuL+s+b3cFzbN
446cer1O74DnzNOQ6F4P+hMulNbxlVNYam/Lf1n9Ve97lzaM5Zadul0+74C4eE3ptGmno3BtKEVq
1XHJWX9mrbl6X8PExjj6uvV6npBwo6vIJvo9oGt0kxEcPRWbzct0Y75PkvW8t5LdNY4910PQHSPT
NDwaYGOEwlvHyXk8c9tSXPguOWxHKTuezLL6uag8z1asq0nKTblJttvNtva2dnhG6NGWIkoQTlKT
SSWbbexIA9MaA0Rh/BjgZYrFWdeSWtbbd7Kcfe+3Ykcbe57scZ05ujz3p7TdbpFiJYis7ylsW6K3
RXJfntZ1k08eWXddiGsVgd48GXQqOHitJ4xKMYrWpKWSSX9o7/y/xcGcssvR7Oj0/WikeEDppLpV
X1abaw1NvUX1n9d9e7gubZvHHTj1ep3fAc9NuI6B0A6Fy6VV9aaaw1NrXf1n9Rc3v4Lm0Yyy07dL
p93wF58J3TOOGj82YNqMYpRquOSSX9mrfzfw8UZwx9XXrdT0g4MdXkEvoPQtbpBiI4eiryk83uit
8nyX5bWS3TWOPddD0Pp3SuH8GGAjhcNZ15p6t9rb21Je5dS2J24ydz25ZTpTUHmWtVliJOc25Sk2
23m23tbOzwbGqVN1GoxTbeSS2tgHpnovoOh4OcFLG4u3j5R8rir7Kceb38+Sucbe578Mfq5ujgfS
HT1XpJiJYis83lGO6Md0V+s3d7zpJp48su67EMkVgds8GPQtVraQxStTjnSUtja9N8lu557lfnlk
9fR6frRW/CH00fSWt4qk/wBmpvyfty+s/wDLyz3mscdOfV6nd8Bzg04C6dCeiU+leI1XdUYWdSXL
6q5v1K73Gcrp26eHdR0zwj9LYaIpLRmDtG0VGo4+jG3mLm1t5ZbXljGb8u/V6mvEHAzs8Qn9E6Kq
aQqRoUo61Sbtbhbjyjtd9rytkzNreOOx6CxmJw/gz0eoQ8qtLZxnN7ZPkvy4nL2nutnTg86YvEzx
c51KrcpSd5vi3nq/H8lfq8NuwCzd08n6T4Lgvh1LLMIPQfQno3Doth3j8WtWo4+TF7YRexL7ct/N
2yzOeV29vTw7ZujlfSfpBLpRXlObtRhw9SXF7bcXeWSyjuTTz55d1Fe8bqWrSVm8qUdySyv1Ldxl
du9neuY6h4PuhvyyTrV1eEX5V/Sks9TqTznxlaG6V8ZV6Ol098hv096Vf7RVXhaMrYWk71Jr0muH
FXyitjlnss0xmk6ufd49BzyLjiH42atRh5MIX271Fe2b5t7Wk9uPIsXRbQNXpJiFOW93V1kksta2
zVjsjHY5Wj5qlaW6bwx7qOpdNukkOiGGjgsK7VpR23zjF7ZN75Sd7Pbe8uF8Yzb0dTPsmoOFr+q4
X/tqiy+xBrb96S7o5+krdHk4Cpf1VT1f7aovK+xB+j96S87hHyd8khwFVV8003T/ALaa8v7EX6P3
n6XBeTvkhycBVX+qKbp/21ReX9iL9H70vS4Lyd8kTk4G5f1RTt/b1I5/Yg1s+9JbeEcvSaV5OBun
/U9PX/t6kfJ+xB+l96S83hHyt8WnJ7I3hF8001iJfvZfuVw3Oo+rZD7V5eiruSePITgKSwkPlVVJ
2dqUX6c1vfGMdr4u0eNhPHkawVFYpzxOIbdOLvK7znN5qKfF7ZPdG722TEm/NGUYS05WlUqy1YJa
1SVsoQWSSXdGEeNkODXcMrTnpytGnSjaK8mnC+UYrPN98pS43Y4X2hvSWJjLVw9DOlB5O2c5vJza
57IrdG29u8S30gc45rQ9N4WP72VvHvhbNU11bZcZZejm5W+PH4hWF/qSkq7/AH9RPxS+pF5Op1vN
Q7Zbok5J9nyG+icJBKWJrq9Gm/N/vJ7oLlvk90ebRamM9aB0adXpDiG5SScrynN+bGK2t8ElsS5J
bhwe1RmlMasdONOimqNPyaUd74yf2pPN9i2JCGV2HukZLQ9J4SH7yVnXkuK2U1yjtlxl91EW+PH4
hWjorQ1L5XL97K6w65rJ1OqOyPGWfoscrPs+fwDHROj1pGblVbjSgterPelwXGUnlHm+Fy1MZsJx
+LnpqstWNr2hTprPVisoxX6zd3tY1ot2JDS9SOjqawVJp6r1q0l6VReinvjDYuMrvgSLldeAXRsV
oSj8sl+9neOHXDdKp2bI/az9Eck+z5/ARmidG/OlW0patOKc6s/qxW1829iW9tIt8M4zYTpfSPzp
VvFatOKUKcPqxWxde9ve22IZXYlNJP5iofJI/vqlpYh8N8afZ50/tWXok5av2Zr8QHQeFhh4yxtZ
J06TtCL2VKm2MepedLllvFTHx5ETCnW07iLK861WW3i3vfLjuSLwntUSOnsZCKjhKDvRo38pf2k3
50/dHhFLiyRcr6T0DvRv9QYd4t/v6qccOt8VsnU7PNjzu9w5WfZm/wABCaI0XLTFZU09WOcpzeyM
FnKT6l3vLeW+GcZsF09pSOkqiVNatCmtSlHhFb39qT8qT4sRcrsSv/MuYThicVHthRfvn/hXMnK+
zPvv5CJ0DopaVq/SPVo0051Z8ILb2vYubLWcZsN9OaUemKzqW1YpKNOC2QhHKMV1Lvd3vE8GV7hO
Yv8A5FvBqgssRiYqVXjCltjDk5edLlZMnLV+zPvoi+juio6SquVZ2w9Ja9aX2VuXOT8ldfItrOGO
wz01pSWmq8q0la+UYrZGKyjFckshJoyy2J/Hf8i3g1hlliMSlOtxjT2whyb86XKyZOW79ma94iej
miI6UrN1Xq0KS8ZWlwgty5yfkrfd8i2s4Y7DHTmlpabxEq0lZPKMVsjFZRiuSXxGtM5Zboh2ishJ
QIaAEtACGgBLRUCGgBLQAloAGUCGrACWgBDVwgQADasAIaAENAA2igG0ADaABtBAKSuAgAGmmggQ
VRpoiBDKDTQAgA0AYAYAasAaaANAGgDADADAAiAywAwA2AKRAbKDYBsij//S+gB6XyH5VNBBhQYA
aZAJCjADADRUGAGAGAGEAmwUaCDQBgBgBgBgBgBgBgQJsAasAaKowAwAwAwA0EGBBgBoijADVgDQ
UYUGAGBBoAwIMAMAMIo0AYAYAIKgwAwAwAwAwA0RRgBgQasAJsUGAGAGAGAGAGAGAGAGAGAGAGAG
gDAg0AYAYQGAGrBRqxQaAMAMAMAMAMAMANBBgBgBgBgBgBgBhAZYKNWANFBgBoA0EGAGAGAGAGAG
AGAGAGrACbAGAGAGAGAGAGAGgDRUGNXAEkUYUGAGAGAGFBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgB
gBgBlgDVgDVgowAwoMAEkQYAYAYAYAYAbIowAwAwAwA2UGFBgBgBgBgBgBhAbsEGwDZFGFBsoMAM
AFogMKBRFGIAUECgowAUiAUUGACokUKCDCqFIgNgCiqFEQKCjaCBRFGygWQGygWgDZAKQApBQpAC
wDaAFgGIAWAbQAQAxBQsiDaKoWiA2UGwDaIDYQYAKKowA2iA2EGAGyKMCjYBtFQbCDADZFGioMAM
AMIoSwo0AYAaCDCoMAMAMAEMKNBBgBgBoIEBRgBoIMYAgKNBBgBpgCADADADADQQJYUYggWFGAC0
AbAFIKFgBEALiALiRQRACwAiCgqACxACxCgqIAqCgqADIigsQAsQAiCgyYAVEAWIUFiAFQUFQAVB
QVABYhQWIAaIUEiAGRFBUAFQUFiAFQUEQARBQREAQKCIAIgDaCggQYAKQUKCDADADTzChLANBBgB
gUIaANBBgAhoKNBAhoAG0ADkioBNAA2ggG1cAGwgG0ADaKgE0ABkggFJAApBAOSKgE0ADaABtBAN
oAQ1cIBNAApIoBNBANoAHJACGrgA2rgA2ggG0ECGigG0ECGgAbQQIaAENBAgAQ0UCGgBAAhgCGgB
LVwAYQIasAJaAENAA2igQ0ADaABtBANoAQ0ADaAsIauBQ2ioBtAAwo0ECWgBIAloA0ECWgBLAEgC
WgKSEaJaKBJAaaKBBAbSKBZAbSChYQbCgiACoAKgoJEALEAJEig0QA0QA8QqUeIGRokUGiAGiFBo
kAaIAaIUGiAGQUGiQBYhQZAZo0QA0SKDIALEALEKDIALEig0QAsQoMgAsSALEKCoAIgBcQAiChaA
CIAIgBcQDYBhFCgoUVkbIowKNgGgDGEGioEEUaKgQwBDAByAByAEMAltE6L+WvWl5i9fL4ktbxx2
HGnNK3+hp+aspNexciSLnl6CotG3IOtH6OlpKerHZvfBfrYTelxx2LXpTSENCUlRo+fbu5vmZk27
ZXt8Qc6m3JtvabeYapUJYmShBXk3ZILrY6LTp0uimH1pZ1JfzPguSMcvR7EHM8bi546bqTd5P9WR
0ea3YYMIOk9HdCw0RTeKxGUrXV/RXxf5bTFu3owx7fNFI6QabnpqpfZTj5kfe+b/ACNSacc8u4Vu
RpzF06JdGPnKXj6y+ii8k/Sa9y38dnEzldO3Tw35G+mfSf5a3hqD+jj5zXpNblyXrfIYw6me/EHO
JG3ATHR/QFTT9bxccoLOcuC+L3L3Et01hj3Do3SnT9PovQWDwmVTVtl6Ce/7z/PhfEm3ozy7ZqDh
03c6vGCYTBVNIVI0qS1pydkv16+CCybHcoxw/g4wV3aVaffOXDlFfrNnH2ns8dODgeksfU0pVlWq
vWnJ3b9y5LcjtJp4rdiMaKyO79Cui9PoxRekMbaM1G6T9CP/AAnsttWza2ccrvw9nTw7fNHKul/S
mp0or67vGlG6pw4Li+b39246SaefqZ91FPZpyHT/AAd9B/nyaxWIX7PB5J+nJbvurfxeXG3PLLT0
dLp93mg/hJ6b/OcngsM/oYvy5L02ty+yvW89iV2OOl63U34g46dHmFl6KdF6vSrEKlDKCzqT3Rj8
XuW/qTM26bww7h2fpr0npdCMNHR+BtGrq2y9CL9J/be1b/S4X54zfl6upn2TUHm5+Vmzs8Ic4LA1
NI1I0aUXKc3aKW9/ra9yCybHpXDUMN4KdHuc7TxE9vGc90VwjHj27Wkcfar3yTpQeb9KaUq6ZrTr
1pa05u7fsS4JbEuB2k08Nu/Ijwg9D+DzohT6O0XpPHWjJRcoKXoR+s/tPctqWW12XLK78Pb0sO3z
Ryrpr0vqdLMRr5xowuqcOC4vm9/DZuN4zTz9TPuopppyHUfBx0GfSOr8orr9mpvZ9eS9HqXpPs42
xllp36XT7vPoJfwndOFjW8BhX9FB2qSWyTXor7K38XyWcxxb6vU34g4udHlFh6MdHKvSjERoUslt
nLdGO9v3LeyW6bww7qO69L+kNHwf4OOAwVlWccuMU9s5fae7nnsST5Sdz155fVzUHmqUnN3ebe1n
Z4QXDYaeLnGnTTlOTSiltbexAk2PTGitH4fwWaPlXr2liJpa1tspboR5Le+t8Ecbe57sZOlNjzpp
nS9bTteeIrO85vsS3Jclu+J2k08WV7rsRZWR33wZ9DI6Ph854y0Uk5U1LJRj/eP/AC8Fnwtxyy9H
s6XT15ooHTvpjLpXX8m6w9NtU48ftPm/UsuN9YzTj1M+6ijpGnEdC6AdDJdKK2vUTWGpvy39Z/VX
v4Lm0Zyy07dLp93wFx8JvTOMF824RpQitWq47Mv7NW3L0v4eKM44+rr1up6QcNOjyCY0HoWr0grx
w9FXlLa90Vvb5L8trJbpvHHuuh6C07pSh4NMDHC4azryXk32331Je5dS2JnKTuezLKdOag82Vasq
8nOTblJttvNtva2dngDvCUG2nZtvzUtt3krc9yXHPdmakHo7o1oWj0CwcsXirKtKPlfZW6nHnx4v
Pdc427e7DH6ubo4bp/TtXpFiHXqOzfmLdCPH4b757bX6SaeTLLuuxCR3W/CvbJ/r1I0wOv8Ag36H
LFNY3EL6GDvTT9OS9N39Fejzz4355V6ej09+aGXT7pZLTtX5NQf0cb3e7ZnJ8Mr9Ub75SSYzSdXP
u8Qc6WpNb/EU+xzk/e/5Y8X523AW7oh0bq9I8QpyyWTuvQjsTXB5WprdZy2RV826dcMO6i/9OukU
dFU46KwNozcdWVnbUhbZfc2s5N7FdvbdZxnq7dTPX2YOMKmsR9DTdqUPKnO222Tk/ZBc7bZM6PKH
eAwUtPVY04RfiotRjFbXfYr7NaWbk9iSbtqxsOFk7h3vE4mh4OsDrStKtPJJelJLJLeoR9mbvKWf
L2nstnTg4BLEyxMpY3EvXnOT1U/Tlxa+pHhseUVle3V49780IovxC+VVfKnJt0089aV85vik9m6U
ss0pIhx5CsP+xx+U1PKqSbdNPO7vnUlfak9l/OlxUWnU48jMMvkUflNTypyb8Unnd75u+1J7L+dL
ilJAnjyMwsVho/Kq3lSbfi4yz1pb5O+2K3386WWa1rCePIzCwSUsXiPKWs9VP+0ntd/sq95PflHb
K6E99GYan8slPFYltwTvLc5yeaguve15sedkxJvzRujB6YqyrVnq04pOckti2KMVsu/Nit3Um04W
TY15enqyStCEVl9WnTj7ltb2yk98mOD2hmKqvSc4YfDxfi4vVpx3tvbKX2pbXuSsr2SBfPiBWka8
aEFhaLvCLvOS9OfH7q2R7ZelZRLfQOMT/UlJ0F+/qL6V/UjtVPre2fZHdK7lb9nwMwa+ZqaxMv30
/wByvqrY6j6tkPtXl6Ku5J9nz+ABovCRmpYivnRpvNb5zeagnz2ye6N3ttdUxnrQmnCr0hxDcmk3
nKWyMIJZvlGKyS6ktw4PaozSeMWOlGlRTVKHk0473fbJ29KTzfYlkkJC3YeaRktEU3hIO83Z15Li
tlNPhH0uMuUUOWr48fiFYCK0JSWKl++ndUFw3Oq+rZD7V36Obkn2fP4BnonARxspVKzao01rVJb3
wivtSeS7XsTFTGbCcTXq6errVj5Umo04R2RWyMVyX5veOEt7qHmlsRDCwWDotOEHepNf2lTZf7sd
ke2W8RcrrxA4wn9Q0PlD/f1U1RW+EHk6nW84w7ZbkTkn2fPqI/Q2jo42Up1W40KS1qkt9t0V9qTy
XfsTLUxmwPSGNnpqtdR22jThHZGKyjGP6zee1jhLe4Sel6kdFU/kNNpyTUq8l6U1sgn9WGznK74E
jWXjx+IzRFKOiqbx1RJyTcaEX6U1tm19WG3nKy4irj48/gIjAYGppquoJ+VJuUpy2JbZSk+CzbLw
zJ3BxpzSMMXKNKjdYeitWmntfGb+1J5vgrLcIuV3xwJGH/Iu4bW2YnER8njTpPa+Up7Fwjf6xOV9
mfffyEXoPRcdI1HKo9WhTWvVlwity+1J+TFcWKmM2G+mNJy0vWdRrVjZRhBbIwWUYrqXe7veWJld
ia0j/wAi9h/ki/f1UpV3vjHbGn/mnzstxOWr9ma/EMuj+jqdZyxGIX7PQSlNfXl6NNc5Pbwjdiph
PW8QRWkMbU0xXlVnnOb2LuSS4LJJcC8Jb3Cf03JaDoLR8H5baniZLfP0afVDf9pvgSeWsvs+PxDb
o5gYLXxmIV6FCz1X6dR+ZDt2y4RT4iphPW+gg8Ziaulq0qk7yqVJXfNvcl6kuwrNuxY9PzWhaMdH
U35SaniZLfU3Q6oLL7zfAkdMvHj8Q36M4GmnPGYhXoYezcfrzfmQ7XnLhFMVMJ630EBjsZU0rWlV
qPWqVJXfW9y9iXYVi3Ys2nX8wYeOjo/vJWqYlr63o0+qKzf2nyJPLpl9ma/EUho05BIQJaAElAhq
wAloAQwBDRUCWgBDQAhoAS1coEACGrACGggQ1cAGwBDQANooBtAA2gAbQQDaAG7VgNEgCWggSVQl
oiBJQJaAEgGgDADADADGrgCWgDQBoAwAXECVsCNgG0RQoqDADYULIg//0/oAel8h+VTADQQYUGAG
rEAkKMAMANFQYAYAYAYQGmgBLQUaCDADADADADADADADQQJsAaCjCgwAwAwAwINAGBBogMCjADVg
DQUYUGAGggwIMAMAMANEUYAIZQYEGAGAGAGAGAGAGiKMAMANWCDVgDRQYAYAYAYAYAYAYAYAYAYA
YAaAMCDQBgBhAYAasFGrFBoAwAwAwAwAwAwA0EGAGAGAGAGAGAGAGEBqwUaKDQBgQaAMAMAMAMAM
AMAMAMANNACQDADADADADADADRUGgDVgDLBRooMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMA
MAMAMAMAMsAasAJasAaAMAMANkUYAYAYAYAYUGwDCgwAwAwAwAwgN2CDYBgBsijADZQYUGAGACwD
ZAbCjEAKCBQUYAKRAKKDABUSKFBBhVCkQGwBRQKRAbQBsqhZEGwoUgDZALRQKIBSChQQbQULQBsA
WAbAFgGwBaIDZQLRFGygUiAUVBsKMIBQQYAbQUbKDABRAYEGAGyKMCjZQbQQbCDADADADADTZFCQ
owAwINFQYAYAYAYRQMoMCDADADTCBAUYAaCDTChIBoIMAEyAEgGAGAGAGggQFGAC0EGwoVEAUAbC
haACIAXEAWiKCAC0AEiFBUAFQAVBQVEAWIUFQAVABkRQSIAWIUFiAGQARBQZEAWIUFiAFiFBUAFQ
UFQAVEUFiUBYkUFiAFQUFQAZBQRABEFBEAEQASJFBIgCgoWgDYQbQULCDADADADTQUIAMCDADTCh
ABgQaChDANNXCAbABsIBNFANhANoAG0EA2gAckVAKSABNBAJoAE0EAmioBNAA2gAbCAbABtAA2gg
G0ACaABtBANooBtWAENAA2ggG0ADaCAbKgQ0AIaCAbQAhgCGggQ0AJaKBDQAhoAQwBDQAhoAQ0EC
ABDVgBDQANooBtACGgAbQQDaAENWABtWAsDaAobRQIaCBAUaCBLQBoAS1cIEgGmgBDQAkAS0BqEh
FaauAIANNFBiQBsgFrIAUFCkgBaACxCgkQAsQAiACxIoLEANEAPEKzR4gQaJFBogBYhQeJAGiAFi
FBogBohQaJAGiAGQVkaIAWIUGRAFQAaIUFQAVEUGiAFiFBUAGiQBYhQaIAuIARAC0FBEALQASIAu
IAoAwgNhoLKyNkUYFGwDQBgQaKgQyKNFQJkADkAIkADkAPtHaPeOlwitr9xLWscdiX0tpFYSPiaW
TtZ23Lh1kkdMsteBTJGnALw2FljJqEFm/VzCybFyxFan0do6sc5vZzfF8v8AQzy729kHPa9WVeTl
J3bd2zbzACi5uyV29iAOg6NwNPo9Rdat57WfL7K58fgjFu3oxnb5ooOldIz0pUc59i3JG5NPPlls
RLKyLz0Y0AssTXyis4p/4ny4d5i13ww9aIXpP0gelZakHalF5fafF+41JpjPPYqEjTkLB0b6PS01
UvLKlF+U+PJc+PBdhm3Tphh3Cx9LukUcHH5HhrKytNrcvqr38Nm3ZMY6dTPXiDlMkdHlDvRmi6mm
KqpUlm9r3Jb2+X+hLdNY49w6zpLHUeguFVGjZ1ZLK+1vfOXLguzcznPtPTbOnBw3E1pYmTnNuUpO
7b2ts6vHfIbRpuq1GKbbdkltbZQdx0Doej0Hw0sVibeNaz3tX2Qjze/4K5xt7nrxx+rm6OM9INN1
dP1nWqdUY7orcl73vZ1k08uWXcK/JGmB1zwf9DlK2PxSShHOnGWzL03yW7v2Wvyyy9Hp6XT9aK10
86YvpDU8VSbWHg8vtv6z5cF27XlrHHTHU6nd8Bzlm3AXHoX0Qn0oreVeNCD+klx+yub9Sz4J4yun
Xp9PuF/8IXS+GiKfzbgrRajqzcdkI/UXN7+Cy2vLOOO/Lt1eprxBwJnV4xIaI0PV07XjQoq85PsS
3t8Ev1mTelxx7roehdI43DeC3AKjRtLET2X2ylvnL7K3LqXFnKfae62dKDzTi8VPHVJVaknKc23J
va2zs8FuwCMXNpJXbySRUHpLoh0co9AcJLH42yrOOfGCeyC4ye/u2Jt8Mr3Pd08Pq5ujh/SnpLV6
U4h1qmUdkIbox4dfF73ysl1k08mefdRWysDs3gz6CrHtY7FL6GLvTi9kmvSf2V63yWfPLJ6uj09+
aIzwkdOX0hqfJsO/2aDza/tJLf8AdXo8dvC1xx0z1ep3eJwOVG3AXDoZ0RqdLMRqK8aUbOpPguC5
vd37jOV06dPDuo614QOltPoxQWjMDaM9W0nH+zjwX2nx2pO+1pmMZvy9PVz7ZqDzqdXiD3Rujqul
qsaFGOtUm7Jfrctre5C+Fk2PSc5YbwUaPsrTxFTvnO23ioR9nNnH2q93jpQeasfj6mlKsq1aTlUm
7yb/AFs3Jblkdnht2GgQejOgXROn0Tw8tJY60amrdKX9nF8vrS2W2q9traOOV34e3p4ds3Rx/pj0
rqdLMQ6krxpxuqcPqri+b2t9mxI6YzTzZ591FTNOY6t4Neg3z/U+U4iP7PTeSf8AaSW77q38dnG2
MstPR0un3ebwHvhO6c/OkngsNL6GD8uS2Tkty+yvW+SV5jivV6m/EHIEbeUWTox0bq9KMRGhTyW2
c90Y7318FvZLdN4Yd10O39MekVHoJhI4DBZVXGy4wT2yf2nu79yT5ybevqZ/VzUHm9tyd3tOrwg2
Hw88XONOmnKcmlFLa29wak2PSuisBh/BfgJV61pV5pa1tspboR5Le+t8Ecb9p7pJ0oPPOl9LVdN1
5V6zvOb7EtyXJbjtJp4csu67DWhR13d7Pb+tre5dgSQd68HnROOFj844rJJXpKWVlbz3wy81bo57
Wcsq9nSw15oonTfpbLpPWtC/yeDtCP15cX+tmW+5rGacupn3Cju2beavm/rPguS/W5G3EXroT0Rn
0lrt1LqjBrxstl+FOPv4LLLfnK6den0+4X3wg9LI4GCwGEtfKLUVstkopLctlt7y2KSeMY79XPXi
Diyp3vSUudWe1ZPZfek/4pWtfyWdHlEnojRc9P1oU6cfIT1YQe97W5Nbt83wtFWvFKW6XGdw7hpr
SdLwe4JUaNp4mp5uWblsc2luWyMdmSisk7c5O568r9XPvHBaznKTpJudeq/pZX37XG/rm9l8tibf
V4wlU/lLWHovyFnOe5tbZPfqrZFbXfZrSsD7h33o3oej0PwrxeJ8jVi2k9sU/wDPLK/DKCyV3yt2
9mGPZN0cY0zpifSzETxNduNGGSS3R3QjxlLj1ytqqy6SaeXLLvu6IuFsfJ1qvk0YWSisvu04+952
V5O72k5Cqf7dKWIr5Uo2Wqsr/Vpx4ZbX6Mc83ZOpz5oymvnCUsRXypRsmllf6tOPDJfhir5uyY58
0ZTXznOVev5NKFr2y+7ThzysttknJ3swc+RuEXpio6lR6lKCWtbZGKyUYre3sit7u2/OY4ORnlab
q2VqdKEfw06a9u3rlJ8WOF9oZVk9MVIUaCtTjdQTexbZTk9l3bWk9iStsSs4ORmMqrEOOFw6coJ5
WWdSby1mueyK3Lm23C30gJjqscBD5LSabunWmvSktkU/qx/mlnmlGxLdeAWp/UdNw/5KKkfL404P
0fvSXncI+TtcknK+z8RrAxWiaaxM19JL9xF8snUa4J5R4yz2Rabknjz+ADo7CRra2IxF3Sg8885z
eagnxe2T3Ru9tkySetGqcKnSGu3JqN85S2RhCPsjFZJdSWbHB7VGaQxXy+cKNCL8VDyaUd7b2ydt
spPb2RWSRYtuw60jUWi6bwlNpybTrzW+S2QT+rHf9aWexRIt8ePxC8IvmKksQ/39RfQr6kdjqPnu
h2y3Ru5J9nyGuicBGvrV69/EU7OfGTeyC5y47ld7hamM94ROVbpDiFZJzm0oxWUYpbEuEYpdiV2O
E33UH0tjIRjHDUHejTd3L+8nsc3y3RW6PNsQyvpA7j/yL9G//JTWjlxp05b+UprZvUPvK05a9mff
Q00PgYVNbEV/3FK2stjnJ+bBc3ve6Kb4FrOM9aG9WpW6QYjZrVKjSUVkluSXBJZcEkODzlQ90xio
UIrCUHelTd5zX9pU2OX3Vshyu9rZIuXuDnAr5gorEy/f1U1QX1Y7HU690Od5bkOVn2fP4CM0Ro35
zqPXerSgtarP6sVt629kVvbQqYzY1pfSXzpUvFatOKUacPqxWxde9ve22WJldiVx3/Iv0Hhl+/qp
Ou/qx2xp9eyU+yO5k5av2Zr19Qz0HgIPWxWIV6FG119eb82C69suEU+QqYz1voI3E16um67k7yq1
JZJcXkklw3JbkXhL9qiY03Wjo2msBSaai9atNenU4fdhsXF3ZI1l48fiM0HQjo6m8fWSag9WjF+n
V4/dh5z4uy3imPjyIKlRraZrqKvOrVl2tt7X7Wy8Mz7Ql+kGMhSUcFh3ejRbvJf2lR+dPq3R+yuZ
I1nfSegPoSmtC0XpCovKu44eL3z3z6oeuVluF8mP2fP4Cu4TCVdL1o04XlUqStnvb2tv1t9peGJ5
Ex0jxtNamDw7vQoXWt9eb8+b69keEUuJI3nfSegc6CprQtF6RqLyk3DDRe+pvnbhD/FZbhfJj9nz
+ArOHw1TStZU4JzqVJWXFtvf732lYnkT3SbFwoKGBoO9GhfWkv7Sq/Pn1ejHkuZI3nfT3AvRyjHR
dOWkaqTVN6tCL9Kq9j6oec+dkKuM15/exUK9WWJlKc23KTbbe1t7WactgAAloASECGig1tAENWAE
NBAiwAlooEtACGADasUCWgBAAh5ACGrBAhoAG0ADaABtFANoAG0ADaCAMkBYE0BWgBLAElQIaIoS
VAmwUaCDADQBgBgBgBjVwgQ1YA0FCogSlgRsihQQYUGwDaIoUEH/1PoAel8h+VTADADADQQYUGiA
SFGAGAGggwoMAMAMIDABLQUJCDADADADADADADADQQaANWANFUYAYAYAYAaCDAgwA0RRgBgBqwBo
KMKDQQYEGAGAGAGEUIZQaCDADADADADADADADADCKNAGAGBAmwBqxQYAYAYAYAYAYAYAYAYAYAYA
aAMCDQBgBgBhAYAasVRoA0AYAYAYAYAYAaCDADADADADADADADCA1YqjQBoAwINAGAGAGAGAGAGA
GAGWAEtAGgDADADADADADRUGgDADLAGrAGiqMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMA
MAMAMANSAEAGyKMAMAMAMAMANlBhQYAYAYAZYgN2CDYBgBgBsijADADZQYUGAGAGAC0AbIDYUYgB
YQbCjABSIBRQYAKiRQoIMKBSIo2AKKDaIBSANlULREGwoVEA2QCkUCiAUgoWEGwoWgg2FCkAKAFI
A2ALiQCigUiKFFQbRFCwg2VRgBtEBsIMAFBRhQbRAbCDADCKNhRgBsoFBBgQYAYAY2RQgKMAMANB
BhUGAGAGAGmRQgqDADADADTCBAUYAaCDTChIBoIMAEyAEgGAGAGgg0wBIUYAKQQKCjAAgBgULQAR
AC0ALIoIgBaACIALEKCxACoKCogCoALEKCxACoKCogCoALEKCxACoigqKAqIoKgA0QoLEALEKCxA
CoKCogCoKCxACxCgsWAFiFBUAEQASIUEiALRFBEAEChaANhBtBQsIMAMAMAMAEtBQkAwIMAEtBQk
AwINNXChAQDaAENAA5FQCaABtBANq4ANhANoAE0VAJoAFJBAKSCATQAJoqAbABtAA2ggG0EA2gAc
gAUgAbQANoqAbVwBAANgA2ggG0ECGioEMAG0AIaCAbVwgQFCGrACWioEMAQ0AIaAEMAQwBDQQIaA
EACGgAbRQIaABtAA2ggQ0ADaABtACGgNQNoAG0UCWggQFGgg00AJAEtXCBIBpoAQ0AJANNAa2QEV
pq4AgAwAVFACgBSQUKAFIALEALEKCRACoAJEigsQA8QA0QrA8QAsSKDRADRCg0QA0SAMgoNEANEK
DRADRIAqCsjIANEKCxIAqADRCgsQAqIoMgA0QAsQoKgAyIoLEAJEAWgAgUEQAtAC4gBIgCgDADZG
gtFQbRAYFG0AaAMCDRUCWRQkqBMgBEgAcgBxg8HLGy1Vs3vgRqTYsGOxcdFQVOn51u7m+ZmeXXK9
opknrZvabcAmnSlXkoxV29iBrYucIU+j1HWec363wXJGeXf2IKJi8TLFzc5u7Zp57dhkyoLzoXRM
dGw+UV8mldX9FfH9bTFrvjjrzRU9NaWlpWd9kF5q975mpNOWWWxAyNMC09G9AfL5eNqr6NbF9Z/D
jx2cTNrrhhsK6U9IPlN6FF+QvOa38ly9vVtSHUz34gojNOAk9C6GnpqpqRyis5S4L48CW6bxx7he
tP6Zp9HKKwuGynb+FcX9p/nwvmTbtnl2zUHIZtyze06PKN4bCzxs406a1pSdkgSbHX6VOh0EwutK
0qsu+UuC+yv1m7HP2nr8dODjGkcfU0nUlVqu8pfqy5I6R5LdiMkisjsXRHo3DQVN47F2jJK6T9Bc
X9p8Nq2bWc8rt6unh2+aOc9K+ks+kdW+apR8yPvfN+rZ17xmnDPPuFRkach0DoN0Nem5+Prr9ni9
n12t3Ut77ONsZZad+l0+7yHvhC6ZLFXwWGf0Ucqklslb0V9lb+L5LNji11epvxByGR0eUTfRzo5V
6S11Rp5R2znujHj18FvfazNum8MO6jsvSnpBR6CYWOCwdlWcct+qntnLjJ7u/Yknzk7nqzy+rmoP
OdWbqNybu3m29rZ2eEbw2FnjakadOLlOTSiltbZFk2PR2jMBhvBfgZV61pV5rO22Ut0I8lvfbwRx
v2nuknSnkeedN6ZrafryxFZ3lLduS3Jcl+e07SaeLLLu8iHKyO+eDjoXDRsPnPG2jZa1NS2Rj9d8
/q8Fnttblllvw9fS6evNHP8Ap50zn0rrWhdYem/Ijx+0+b3cFlxvvHHTj1ep3fAUI24jong/6Ey6
UVfGVU1hqb8p/Wf1V73uXNoxllp26XT7vgLh4S+m0aUXo3BtKMVq1ZRySSy8Wrbvrfw8TOOPq69b
qekHCjq8gmtAaCrdI8RHD0V5T2vdGO+T5L1vLazNumsce66HoHTulsP4MsDHC4azryXk323eTqS9
y37NiduUnc9uWU6U1B5pr1pYmTnNuUpNtt5tt7Wzs8GwmnSdaSjFNybsks229iQB6V6MaBoeDjBy
xuMt4+UfK3tX2U48W9/PkrnG3ue/DGdObo4J0k6QVuk2IliKz25RjujHcl73veZ1k08eefddiBsV
kds8GPQZV7aQxatTjnSjLY2vTd/RW7i89iz55ZPV0envzRX/AAi9OH0lq+Iot/Jqby+3L6z5fVXb
vyuOOmOr1O74DmRtwFz6E9EKnSzEaucaMLOpPlwXN7uG3rzldOvTw7qOp+ETpfT6P0VozA2jJRUZ
uPoR+qvtPe9qXN3WMZvy79XPt8QeeTq8YktF6Oq6XqwoUY605uyXvfBLa3uRL4WTfgekKtTDeCrR
+rG08RPvnPi96hH8trucfae3x0p9483Y7G1NJVZVqsnKc3eTfH9bFuWR2eG3YagHonoH0Vp9FcPL
SWOtGerdJ/2cX/mlstt3bW0csrt7enh2TdHI+l/Smp0qxDqSuqcbqnDgvi9r7tiR0k08vUz76KzS
peNdu/8AX6zKxIOteD/ob8+T8fWj+zU3s+vJbucU85PY3lsWXPK6enpdPu+AfeEfpmsa3gsPL6KH
72S2N/VXH2Xz2K6Yxer1N+IOR27Ms/srh1vf695t5hO9HtBVekWIjRpK2V290Ib5Pnw4t3yyFums
Me6juHSPTNDoDg44XDK07Wjx5yfN8d38KfKTb2Z5TpzUHApOpKeedept+xG3qduyMefm9XjG6GH+
WNUad3TTWs0s5yeSSW9vZBdbdvKsJNj0Bo3CUPB9gpYnEJeNaS1Vu3xpx9snvd5M5e09kk6c3RxL
S2l62NqvE1XfEVPMS/s4vZZbnbzd6XlbWmdJHkyy359RHOk8N+z01etPKbW77C/zPs2JuVTjwOx9
AOikKEFiqtvFx8qLeSm16efoR9C+13m/RS55V6ulh6im9Muk0umOI8VRerhqV3d5LLbUl7IrbnZL
WlY1Jpy6mfffuFR1VpGSp0/IoU0229y3zl9p5JL7sVuK58hVvnOShH6OhSTd3nqx3yfGUsut2irJ
JK8JyM/5i01CP0dCmntzUY75S4yfrdorKyTg5GO+l5qnT8ijTTtfZGPpTlxb38XaK9FDg5G6jelJ
xoUFalC+rfL71Sb45Xb3JJLJILz4gzET+WShhcMm4J5bnOT2zfDknlGPPWbF8+IN4yoqcVhaHlK6
15L+0nsVvsrZFb85b7KFvpATFyWioPDwd6kv30l/yrT4J+c98stkbtyl8eAv/mB0/wDuoqR/5Nwa
/wAcl/DF8ZeS5X2fiE4GmtFwWJqJOb/cwe9r02vqxexelLiotBJ48/gEYDDLEa2JxDbpRflZ51Jv
NRT4vbJ7ld7bJ0k35o1ThU6QV3KTUVa8pbI04Ry2bklZJbXklmxwa7qMxuJekpwo0IvxcfJpQ3tv
e+MpPN9iWSQW3fAPpGtHR9P5JSaeadaa9KS9FP6sf5pXls1bRb48AtH+oaSqP/imrHyF/dwfp/el
6PCPlbXFjk9n4hvorBQUXia6+hg7auzxk90Fy3ye6PNoWpJ6hEIVekWIbbWtLOTeUYxSzfKMUuxK
yHCe1QrS2PjX1aNG6oU7qPGTe2cucvUrLcIZX0ge4n+oKTor/iiqvpX9SDz8X957Z8FaP1ictX7P
j1AdE4WGGg8XXV6cXanB/wBpPh92O2fZHaxUxmvNDWhRrdIMQ7u85tynN7EtspPgkvVki8JJ3UG0
xpCFfVo0LqhSuoX2yb86cucvUrLcSLlfcH0v+ReoW2YmtHPjTpvdylNbd6j94ctez8aGWhtHwra1
ev8A8T0rOXGTfmwXOW/grvcKzjPWhtisTV07X1rXnNqMYxWS3RjFcFkki8Jb3USml60dH01gqLTS
d6016dRbk/qx2Li7y4EjWV14/EK0RRjoqn8uqpNptUIv0prbJr6sNvOVlxFMfHn8BEYLCVdN11BO
85tuUm9m+UpPgs22XhmTuDzTmkIVtXD0P+J6N1HjOT86b5y3cI2RIuV9JwH2CX+z1D5S8sRWTVFb
4QeUqnW84w7ZcBys+zN+t4EJojRctLVlTvqxScpzeyMFnKT6vW7LeLWcZsF07pOOkZqNJatCktSl
HhHi/tSecnxfIRcrsStL/kW8Nr7MTiI+Txp0ntlylPYuEbveOV9mfffyEJoXRL0vV1G9WnFOVSe6
MFtfuXFtIt8M4zYVp3Sq0rV8hatGCUKUPqwWzte2T3tiLldiXp/8i1hNfZicTG0eNOi9suTnsXCN
3vJy17M++/kIPQuiXpmsqd9WKTlUm9kILOUn1LvdkWsYzYJ0g0qtJ1Uqa1aFNalKPCK3vm9snxZI
uWWxL4L/AJFrCfKHlicQnGjxhT2SqcnLzY8rsctT7M360VzRGi56YrwoU9snm3silm5Pklmy2ueO
OxIdJdJwxk40aGWGoLUpLj9ab5yefVZEkayy38IKyVgJaKBIAloASECGrFAlq4AgAS0UCGggQ0AJ
aAENACCgQ0AIauAIAEMIBtWABtAA2igG0AIaABtAAZoIsCaApDANMIEFUJaCBLChIQZYATYKNBBg
BoAwAwAwA00EGkrBSiBWSkrBBgBsA2FG0RBsoP/V+gLR6XyH5VNAGAGAGAGioMANEBqwUaAMANBB
hQYAYAYQGAGrEAlooNAGAGAGAGAGAGAGrBBoAywAkKMKDADADADAg0AYEGAGiKMAMANWANBRhUGg
DAgwAwASwoSAYEGAGAGAGAGAGAGAGAGAGBRogMAMCDVgDVig0AYAYAYAYAYAYAYAYAYAYAYAaANB
BgBgBhAYAasFGrFBoAwAwAwAwAwA0EGAGAGAGAGAGAGAGEBqwUaKDQBgQaAMAMAMAMAMAMAMAMaA
EWAMAMAMAMAMANAGAGAGWAMsUGtUA1YA0UGAGAGAGAGAGAGAGAGAGAGAGAGWAMsAZYAywBlgDLAG
7AGWANWIoQAYAYAYAYAYUGwDCgwAyxAbsEGwDADADADdgDCKMAMANlBhQYAYAYAYAKiAKIo2AbQA
oINhRgApEAooMAFRChREGFApEUbAFFBtEApAGyqFIiBQUbQAogNooFkBtBQtFQbIoWggUFG0ALAN
oAUAKiQCyg2goWRBiKoWRBsqjYBiIBQQYAbCjYBhQbRAbCDADZFGBRgApFQbCDADCKEhRoAwAwIN
FQYAYAYAYFCGQGioMAMAMAEsASAYAaCDTChLANBBgAhgGgDADADQQJYUaAMANoAWAYALQBsAUgoI
gBYARAC4kULQARABEFBYgBohQRABkyAKgoLEALEKCogCoAKmFBYgBYkUFiAFQAVBQVABUFBYgBYh
QaIUEQAZMgCphQVMKCIANEKCxACIAJEKCIgFoKCABEALQUKCDEFC0AbCDAowIMAMAEBoaCDAgwAQ
0FGggwAS0FCGrhANgA2ggE0UA2EA2gAckEA2gAcioBSQAFoIBNAAmggG1cqATQANq4ANhANgCGgg
E0ACaABtAA2EA2UCJIAHJACGggGEA2AIaKgQ1cAGwgQ1YAQ0ECAoQwgQ0UCGgBDAENACGgBAAhqw
QIaAEtXABtAA2igQ0ADaABtBANoAQ0ADaABtXA0G0UCCA00VAloKEhBpoASAaauECLWANNACGgBI
BpoDWyAitNXAE2AFgG0FCwDYAqIAWIARBQVABEAFRFBUAGiBKNEKyNEANEigyADRADRCg0SAKgoP
EALEKDRADxIJRYhUFiAGQUFiQBkFBUAGQAWJFBkAFiAFiFBkQBUAGiFC0AEQAQAWgoJEAXEAWgBY
BgBsihaKDaIDAo2gDQBgBorISyKElQakADkALoYeWKkox2siybFlrVYaGp6sc5P1vizPLtb2wU+p
UdVuUndvabcKBKLm7LNsAt+DwsNC03VqedbP4L9eozy7ydop+kMbLHz15di4I1HG3YjpFYFs0Dod
RXj62SWcU/8AE/d3mbXbDH1oh9PaZekZascqa2c3xfuLIznlsVplchN6C0I9KzvLKnHa+PJe/gS3
TphjsTPSXTiw0fk1DKytJrcvqr39xJG88teIOdSNvOHWj9HT0pUVOms3te5LixvSybHRsfjKXRHD
qlSs6jWXN75S93dsOc8vRb2Qcjr1ZV5OcneTd23vZ1eW+Q3jTdVqMVdt2SW9hB1zROjaXQ/DvEYi
3jWs+XCMefH4I527erHHsm6OU6b0vU01VdWp1RjuiuC9/E6SaebLLuEHIrA6d0K6KJ2xmJVoLOEX
y9J8uHfstfnlk9PTw9aK9006VvTk/FUnahF5fafF8uC7erWOOnPqZ9woDNuItPRLorPpHV8q6owf
ly4/ZXN+pZ8L5yunTp4dwu/TnpXDRNP5Bg7RaWrNx9FfVXPi93XszjN+XbqZ68QcNkdXjD3RWiau
m60aFFXlLuS3t8l+syW6axx7vA7vjcXhvBnglTp2lXnsvtlLfKXCK3Ls4s4+09ls6UHnbG4upj6k
qtWTlOTu297/AF3HZ4bdhmoubsldvYioPQvRDo1R6EYaWPxtlV1b5+gn6K4yex93G/G3b3YYdk3R
xfpX0nq9Ka7qzygsqcN0Y/F73v6kjpJp5c8+6irGnMdd8G3QT51ksbio/QRfkRfptb39let5bEzn
llp6el09+aAeEjp389zeEw0v2eD8qS/tJL/Kt3F58C446Or1O7xByU28wtfRDopV6V4hU43jTjZ1
J/VXxe5duxMlunTDDuo7F036U0uhuHjo7A2jV1bZf2cXvv8AXe3j6XC/LGb8vT1M+yag85N3OzxB
1gcDU0lVjRpRcpzdopfrve5ZjaybHpPDUML4KcA5ztPET28Zz+quEY8e3a0jj7T3STpQectK6Uq6
arSr1pa05u75cEuCWxI7SaeHK93kR1gyPQfg86HQ0FSek8daMlHWgpehH6z+09y3Lm8uWWW/D29L
p9vmjmXTjphPpZXurxoQuqcP8z5v1LLi3vGaefqZ99FJNuQ6T4POg76S1fHVk1hqbz+2/qrl9Z8M
try55Zad+l0+74CzeEzpupp6OwjSpx8mrKOx29BW3Lf3bE7zHH1dOt1PSDiB0eQTXR/QFbpJiI4e
is3nKW6Md7f6zeRLdNY4910O/wDSHTOH8GmBjhMLbx8l5N9t3tqS9y45bEcpO57csp05qDzTVqSr
yc5tylJttvNtva2dngGqdKVaSjFNybSSSu23sSAPS3RnQdDwcYKWMxdvHyXlb2r7Kceb38+Sucbe
578MZ05ujg/SHT9bpJiJYis83lGO6MdyX6zeZ0k08eWXddiDKyO0+DPoQsRbSGKVqUc6cXsbXpv7
K3cXnsWfPLJ6ul0/WiD8IfTZ9I6viKL/AGam8vty+s+X1V278tY46c+r1O7x6Dm8IObsjThBfeh/
RSfSOsqauqUbOpPhyX2nu+qrva2jNunfDDuHTenfSmHR6itHYO0Z6tpNbKcPi+/rbMYzb0dTPt8Q
cEW63Wr/AOJ+7/S/V4g6wGCnpGpClSi5Sk7Qj9Z8XyXdbtZFk2PRNGlh/BpgHKTUq0s5PfOfBb7L
cu3K7Zy9p7prpwcEx+kaukqrxNbyqtR/Rx224O3+Fb3nsVn1eO3fkNFTd3Si05POrUbyS3q+9Le/
SlZK+WsQdx6E9G6ehKPy/FeRGMW6altjFrOcvty3L0VZZs55Xb19PDt80c56U9Jpaeq/KKitSjdY
ek9/Gcl2dTa1c0pG5NOGefd5/AVlzlgvLld4iea4xT9L773cFntaarnx8R0HoN0OekZt1F5Ecqsu
L/uov/lY1u8hWu28ZV26fT2JHwg9K3jpfNmC81PVqOOSdvQW5RXpPZlbJJ3Yz1a6ue/EHMJR8bbC
4fNXvOWzWa33eyEc7X3Xk7bFpw+6BU18oawuHzje8pbNZpZyd9kUr2vsV27Nsqc+IMqftTjhcPnG
929mvJLOTvsile1/Njduzcgc+IMqvx7jhcN5Ub5vZ4yX1s9kVnq32K7dm2DnxBvETSSwuH8u7WtJ
bak9yW/VWyK3vyntSiW+6DeKmsDB4ak9aTt42azu90IvfFPa/SlnmlEhfHgFrv5mg6Mf381ao/qJ
/wBmub9N/g+tdyl8BVP+o4Kb/wCKJq8V/dxfpffa836q8ra4tXlfZ+IRgqUdHQWJqpOT/cwe9r02
vqp7PrSyzSkEk15CcFh1iXLE4lt00/KzzqTeeqnxe2T9FZ7Wkyyb80ZThPT1Zzm1GKV5yt5MILJW
XBZKMd7strHB7QzFVpaXqQo0ItQj5NKG/Pa39p7ZPsySVnBfPAXpHEQwkPktFpxTvUmvTkuH2I7I
8XeW9JSFuvAcf8wCn/3U1I9tKEl6pyXbGL4yycr7PxAdGYWGFh8qrq8E7U4P+0muP2Y7Zcco78lq
Tx5A8LQqadrSnUlZZzq1HsjHe/dFLa7JDhJ9oa0jjHpOcadGLVOPk0obXm9r4yk82+OWxIFuw90h
UWiKbwlNpzlbx81xWymn9WL8760uUURq+PH4jej6a0PTWLqJOpK/iIPittRrhH0frS5RY5JO3z+A
ZaNwL0rUlKpJqEbzq1HnZXzfOTeSW9sJJsa0lj3pSpGMI6tOK1KVNZ2W5c5N5t72yluxI6QmtCUn
hIP6WVvHyW62app8FtlxllsjnJ5av2fH4hGicNDAw+WVknGLtSg/TmuK+rHbLi7R3stTHx5oYYbD
1tPYi17zm3KUpPJLbKUnuS2scMz7VDrTGPhV1aFC/iKV9Xc5yfnTlze7hGyEXK+k4D6j/wAi7Q8a
/wDimtH6Nb6dN7Z8pS2R4Ru96Jyvsz76IzQ2jFpGbc3q0aa1qs+EeC+09kVvbLazjjsJ0tpJ6Uqa
yWrCKUacFsjFbF17297bYhldiWxn/IvUHh1/xRVS8c/qQ2qn1vJz7I8SctX7M16+oYaD0dCu5V6+
WHo2c+Mn6MFzl6ldimM359Ax0hjqmmazqSV5SaSilklsjGK4JZJF4Zt7hN6VktBUfkUH9LKzxElx
WaprlHbLjLqJy1l9nx+IZ6B0fTlrYrEL9no2uvrzfm0117ZcI3FTGet4gisdjKumK0qk/KqTexdy
SXBbEipbsT+mJrQdH5BTf0krSxMl9ZebT6o7+Muok8t5fZmvxDLo/o2nVcsTiF+z0bOS+vJ+bTXN
7+EbsVnCet4gidJY+ppetKtUznN7FsW5JckskuBUt2LHpV/7PYf5FH9/UtLEPgtsaXZ50udluJPL
eX2Zr8RG9HtFQx85VKzth6K16r5bor7Unku17hazjjv4QMNM6UnpmtKtJJXyjFbIxWUYrkl8SyaT
LLYsNf8A5FnB+L2YrFRTnxhReyPJz2v7NlvM8unsz77+QpBpxGmigQQCWigSECWgoSVAhqwAloAQ
AIaKBLQQIYAhoAQ0AIKBDVgBDQAhoAG1cIBtAA2gBDRQDaABtAApK4QAA0S0AIKDTRECCqEtBAkA
0AYAZYAS0FGgg0AYAYAYAYALSAy2AYAbAFIijYQYUH//1voGel8d+VRLQUaAMAMANBBhQYAYQCWg
o0AYAaCDCgwAwAwAwgMIDVigQAYAYAYAYAYAYAaCDQBgBqwBoqjADADADADQQYEGAGiKMAMAMANW
ANBRoqDAgwASwo0RRoqDADAgwAwAwAwAwAwAwAwAwAwA0RRgBgQaCDVgo1YoMAMAMAMAMAMAMAMA
MAMAMANBBoAwAwAwgMAMANWCjRQaAMAMAMAMAMANBBgBgBgBgBgBgBhAasFGig0AYEGgDADADADA
DADADABLQBoAwAwAwAwAwAwAwAwAwAwA1YoNWCjQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBg
BgAhgGgDADADZQYUGWIDdgg2AYAYAYAYAbIowAwAwAwA2UGFBgBgBgBgBgBuIAtEUbANoAUEGwow
AUiAUUGAG4hQsiDCg2iKFAG0UCkQCgDZVCkRAoijaKBRAbKBZAbQApACkFCkALANoAWAYgBYBtAB
ADABZFGygWiA2VBsKMAFIgMCDADaCjZQYQCgDAgwA2RRgUbAFJlQYECW7kUaCjADAg0VBgBgBgBg
BpkUIKDAgwAwAwASwQJAMANBAlhRpgGggwAGAYAYAYAJCBIUYAYAYALQQbCjaAFgG0FBEALQAuIA
SJFC0AEACJhQVABYgBYkUFiAGQUEQAZEUFiAEiAFQUGTACoALEigsQAsQoLEAKgoKgAqCgsQAsQo
LEAKiKCoAKgoKmAFQUFQAtBQUgCIKFoAJEAWgoWEGBQtAGwgwKMCDADADTChIUaCDAg0FCGAYEGB
QNqwAhoIBtAA5IqATQQDaAEMIBMAG0ACkioBSQAKSCAUkEAmgATRUA2ADkggG0AIaCATQAKSAByQ
ANoAG0ECGUAwAbQQIkgAbQQIZUAwBDQAhq4QIABtWAEtBAgAQ0UCGgBDQAhgCGgBLVwBAQDasAIa
AENAA2igQ0ADaABtBANoAG0AIasADasBohoqBBFGFQIaAEgGmrgCQDTVwgQAaAENACQDTVwLsgI0
wAwAWkFCgDaVwBYAtABUFBEAFQAREUFQAaIGaNEKg0QA0SKDRADRACxCg8SALEKDRADRADRCg0SC
UWIVBkAGQAWJFBYgBohQVABYkAZBQZABYhQWJAFQAZBQRABABaACIKFxAFoAIgBYBgBsihSAFIAw
KNoAwA0AaKyNMihAQaZQZCk6zUYq7YXWxZoxhoand5yfrfwMcu3siqV68sRJyltZpxt2GpUFs0bg
I6Pi61XJ27l8f9DNdsZrzRW9J6QlpCV9kVsX63lkc8stiJkVgWHQehvlL8bUXkLYuP5e0lrphjsC
0/pn5U/FU35C2vj+XtEhnlsVKRpyEjonRMtK1LLKC86XD8yW6axx7hadN6WjoemsPQyla2Xor4v8
zMm3XLLt8Qc1lmdHmCsNhZ42apwV5PYFk2Ol/Q9D8P8AWqS75P8A4K/WbOfL0exByrG4ueOnKpUd
5S/XcdHmt2GLVyoOpdHNBQ0FTeLxNlK11f0V/wAJ/ltOdu3pwx7fNHP+kenp6dqazypx8yPBcXzf
5G5NOGeXcK1I05i89DuinzpJV6y+hi8k/Ta9y38dnExllp26eG/NC+m3Sz5Y3hcO/ollOS9Jrcvs
r19W1jivUz34g5hI6POJno/0fqdIaypwyis5y3RXx4L3XJbprDDuHUuk2nqXQ3DrB4Syq2y+yn6T
4ye7v2WT5ybenPLsmoOCVJObbbu3m2zq8Q3hsJPHVI06cXKcnZJb2CTY75gcJhvBtg3Vq2lXnttt
lLdGP2VvfbwRx9p7ZJ04OB6Y0tV03WlXrO8pdyW5Lkv1mdpNPHll3eREMrI7l0A6HQ0XD5xxto2W
tBS2RX13z4cNu21uWWW/D19Lp680c+6c9MZ9KK2rC8cPB+RHj9p83u4LLjfWOOnHqdTuFCZtxHQO
gXQmXSer4yqmsNB+U/rP6q973Lm0Yyy07dLp93wFv8JHTaOHi9G4JqMYrVqSjkkll4uNv5v4eJnH
H1der1NeIOEHV5BM6B0FW6RV44eirye17ore3yXr2bWS3TWOPddD0FpnSmG8GGBjhsPaVeS8m+1v
fUly4LfsWSduUnc9uVnSmoPNWJxE8XOVSo3Kcm3Jva2zs8NuwOnTdVqMU3JuySzbb3IIPSfRbo/Q
8HmEljsa145xz3uKeyEeMnv+Cu+Nvc92GP1c3RwvpP0krdKMQ69XJbIQ3RjwXve99x1k08mefdRX
isDs3g06CrHNY7FL6GOdOL2Sa9J/ZW7i+Sz55ZPV0unvzRGeEbp0+kFT5Nh3+zQebX9pJb/urct+
3ha446Z6vU7vE4HLDbzi3dDuiVTpZiNRXjSjZ1J8FwXN7u/YjOV06YYd1HXOnfSyl0ToLRuBtGpq
2bj/AGcX/ne2+1XvtaOeM35enqZ9k1B512nZ4g7wGAqaTqxo0YuVSbtFL9bOL3LMLJsek6NPDeCn
R+tK08RPvnPguEI/ntdjj7T3eOlB5w0ppOrpitKvWlrTm7t+5cEtiXA7SaeG3YYBB6D8HnQ+GgqT
0njrRko60FL0I/Wf2nuW5c3lyyy34ezpYdvmjmXTbphPpXXurxoQuqcP8z5v1LLm9zHTh1M++imF
ch0fwfdCX0mq+NqprDU35X239Vf5nuWW1mMrp36XT7vgLT4SumqaejsI0oR8mrKOzL0FbcvS7tl7
zHH1b63U9IOJxjrZLadHkFo6P6Bq6arRoUVeUs5S3Rjvb5LcvSfJZ5t064493gd103pWh4OsHHDY
ZKVeSeqntb31J/rlsTtzk7nryynTmoPO1WtLEyc5tzlJ3be2ct7f2f1xt1eG0IjHxjtm7u2W2T4L
l+uCKD0P0V0BS6EYWWNxjSrOPlfYjuhHm8r22vLdd8bdvdhj2TdHHukXSCfSOs8TX/dptUqfH8vr
Pe8lva6SaeXLLu8iHtOMtXbXnt3aitmuCdtuxQjltvq1kdS8H/Q+OOtiKq/Z4O8bq3jZr0nf0I+i
nteb3oxlXo6XT359A06ddLVpuThB/slOVsnbx01/lXHt2uNmM0nUz7vgOduo6f7RVs5y/dwtlZZK
TWzVWyMdjt9VWe3D7xZui3Rytpeukm/Gvypzefiov0v95L0Vu87bnHNunTDDdHR+mXSKHRWhHR2B
VqrSj5O2Cf8Anlu35322Myb8u/Uy7ZqDis4vCL5PS8qtPKbWe30I8ftNbXksleW3l48BVRfJ18mo
+VUm0pyjnd3yhG21J7WvOfJJup9wyq/ky+TUfKnNpVJRz1nfKEbbYp7bedLikmxx4G68lgYvD0vK
qSyqSWd/sRttSe1rznsySbHHgbryWiYOjHOtJWqyXor+7X+d7/NWV9ZyvAXP+pIuP/JRNWk/7uL9
H77XnfVXk7W0pyez8QqivmWCqP8AfyV6a+pF+m/tP0OC8r6o5T2fiE4OjHAwWJqpSbv4qD9Jr05L
6qf8UstikUk15GYSisS5YrEtumpZ551JvPVT9cn6K5uKZZPWjKcJ6cqyqVGowirzlbyYQWSUV3Rj
He7LiycHtDVapPTVWFGjG0I+TThfYtrcnsu9s5PLqSSV4PaG9IYqFOKw1B3pp3lL+8nx+6tkFwu3
m3aFvpA5rf1FTdJf8UTVqj/u4v0F9p+nwXkfWHK37PxCcBRjoumsVVScn+5g97XpyX1YvYvSllsU
gk8efwAcDhHpOc61eTVOPlVZ7W29yvtlJ7O1vJMJJvkar1amn68YU422Qp01sjFbF75N7XeTHB7Q
NpPFQw8PktB3pxd6k1/aTW/7q2RXXLa8ot8eA6pf8i9TVR/8U1I+Qv7uD9L70l5vCPlbXEctez8Q
y0TgIVVKvXuqFPztznLdCPN736Mbvhe1nGetCKk63SHEJJXnNpRislFLYlwil3JXY4Paoc6VxcKE
FhKDvSi7zmv7Sf1vurZBcLvaxFyvpA5wkf8AZ+ksRL/iiovoV9SLy8Y+b2Q7ZbkOSfZ8+oj9E6N+
cJSlUerRprWqz4LguMpPKK3vkmLWcZsa0nj5aVqLVjqwSUKdNZ6sdyXF729rbbBb3CUx8loKk8LB
/TTt4+S3b1ST5bZ8ZZbFnOWr9nx+IBofBQpReLxCvSpu0Y/3k9qj1LbN8MtrQqYz1oYN1tPYjfOr
Vl637Eu5JcEXhPaokdMYuGGgsHQd6cHepNf2lTY391bI9r3kjWV14gNomlHRFL5dVScrtYeD9KS2
za+rH1ystzFXHx5/AQ+DwlXTVdQj5VSbbbb7XJvgs22XhiTuD7TmPhNRw2H/AHFK9n9eT86b69i4
RsuJIuV9IHejILQNH5bNfTTusPF7tzqtcFsjxlnuF8tY/Z8/gIHR+AqaYrKnDOU3dtvJLa5N8Ftb
KxJsSOndIwrauHw//E9G6jxnJ+dN83u4RsiRrK+k4geaKgtA0fl019LK8cNF8djqNcI7I8ZdQvlc
fs+fwFdwOCq6XrRpQ8qpUlv9bb4b2ysSbEt0gx9NqOEw7vQo3z/vJvzpvr2R4RtxJGsr6T0DnQdG
OiKT0hVSbT1cPF+lU+tb6sNvOVkL5XGa8/gKzGnV0pVsrzq1JdbcpMrnyLF0hxENH046PotONN61
aa9Orsf4Y+bHtZI6ZXXgC6OYGnBTxuIV6FC1o/3lR+bD3y4RXMVMZ630EBpDHVNJ1Z1qrvObu3+t
25LcisW7DEIMAEtFAgAS0AJCBDRVCWrhAgAS0AJauADaKBLQQIaAENACGgBLVygGAIasADasAIaC
AbQANooBNACGgATQACSCNEgCGgBIAlgCSoEtACQDQBgBgBlgBNgDQBoAwAwAIgMsANgGyKFIINlB
sKP/1/oIel8h+VTQQaaAEhRgBgBgBoqDADCA1YASFGAGggwoMAMAMAMIDADRAJasUGgDADADADAD
ADABIQYAYAasAaKowAwAwAwINBBgBgBoijADADADVgDVig0AYQCbAGrBRgBoqDADAgwAwAwAwAwA
wAwAwAwAwA0RRgBgQaANWANWKDADADADADADADADADADADADQQYAaAMAMAMIDADVgo0UGgDADADA
DADADQQYAYAYAYAYAYAYQGrBRooNAGggwAwAwAwAwAwAwA00AJsAYAYAYAYAYAYAYAYAYAYAYAYA
asUGWCjVgDQBgBgBgBgBgBgBgBgBgBgBgBgBhQYAYAJkAJIDCg3YA3YINgGAGAGAGAGyKMAMAMAM
AMAMAMKDZQYAYAYAYAYAYAbQAtEUbANoAUEGwowAUiAUUGAG4hQsiDCg2goUQG0UG0ALIDYUbQQL
IowoFkBsoFoA2QCkFCkEG0FC0AbAFgGwBaAMACIgNlApEUKKgUiKFBBhQbCjaIDYQYAYAKCjCg2i
A2EGAGEUbCjADYBjYQaCjADADQQYVBgBgBgBgAlsihJUGAGAGAGBAlhQkAwA0ECWFGmAaCDAAYBg
BgBphBpgCQowAwAwA2gBYBgAQAwKCIAWgBaACIigiAFoAJEKCoAKgAqCgsSALEKCoAKgAqIoKgAs
QoLEAKgAqCgyIAkQoNEALEKCoAKgoKmAFQUFQAVEUFiAFiFBUAFQUFQARABEFC0AEiRQSIARBQsI
MChSAFBBgUYAYEGAGACWgoSAYEGACWgoSAYEGmrhQNq4QDYANhAJooBsIENAAmggHJAA5FQBaABN
BAJoAE0EAmggG0UA2rgA2ECGgAbQQCaABNAA2ADYQIaKAckADaAENBANhANoAQ0VAhgA2ggQ0AJa
uADAENACWioEACGgBDAEMAQwBLQAhoIEAA2gAbRQIaABtAA2gAbQQDaAENXABtXAEAaJaKgSRRoq
BLQAgA01cATsANNXCBDVgDQAloAQAaauEUgDRSQAoA2FC0gDYARBQRABUAEQE2KiKbEQE2LECDRC
g8QAsQoPEgCxADRCg0SANEKDRADRADRIoMgJRYhUFQAZABokUFiAFiFBkAFiQBkFBkAFiFBYgBUR
QVABAAgARAC0FBEALQAsAIAYAbIoUgBRQYRRgBtgGgDRUGmQCQDFFzyWbYBZcPQjouDnPzn+rIzy
7SdorWKxMsXLWl2LgacbdhkVBZNFaNVJeOqZWzSe7m/cZtdccfURWldJPGyssoLZz5lkZyy2IRlc
xLaI0S8fLWl+7Xr5fElrpjjsPdO6XUV4ilkllJr2L39xJGs8vSCls24BzgNHz0lNQj2vghbpZjsX
PSGOp9HaKpUvPay/4T93wRiTbvb2jmtWbqNyk7t5tm3mA6dKVeSjFXk8kig6VgsJS6K0HVq51Gs+
b+qvf3nO+Xpk7IOa6T0hPSdR1JvN7FuS4I6SaebK7EWysjonRbo6sPH5XiLJJXinuX1n7u/gc7Xo
ww9aKz0o6RS0zPUhlRi8lxfF+7gak05559wp8jbkLP0X6My05U1p3VGL8p8X9Ve/gjFunTDDuFi6
ZdJ44SPyLC2Vlqza3L6q9/DZxtMY6dTPXiDkcjo8oe6K0TV01WVGks3te5Le3y/0Fulxx7h2HSWP
odAMIqNG0q0llfa3vnLlwXYt7XKfaeu2dODg2KxE8XN1KjcpSd23vZ2eK3Yaxpuq1GKbbdkltbYQ
d36OaCo9B8NLGYtrxrWe/VvshHjJ7/gm3yt7ntwxmE3RxrpL0hq9JK7q1MorKEd0V8eL39Vkukmn
kzz7qK3I0wOs+D3oQsa1jcUvoo5wi/Sa9J/ZW7i+W3nlk9PS6e/NEZ4Qumz05N4bDv8AZ4vNr02t
/wB1buO3hZjjpnq9Tu8TgcskdHnFq6I9E6nSqvqK8aUbOpPguC5vd37jNy06YYd9HWOm/Sul0RoL
R2BtGpq2bX9nF/53t4q+ttaOeM35enqZ9k1B50budniDnAaPq6Uqxo0YuU5uyS/Wze3uQt0smx6R
o0sL4KcBrStPET75z4LhCP57XY4+093jpQecdK6Vq6arSr1pa05u75cEuCWxI7SaeLK78iPDI9B+
D/obDQFJ6Sx9oyUdaCl6EfrP7T3Laut5csst+Hs6XT7fNHM+m/TGfSyvdXjQg34uH+Z836llxb3j
jpw6mfcKQach0nwe9B30mq+OrJrDQef239VcvrPs2vLGWWnfpdPu+AtHhK6cKz0dg2lCPk1ZRyWW
WpG25elb7uy95jj6unV6npBw46PIJro/oGt0jxEcPRWbzct0Y72+XteRLdNY4910PQGndL4fwZYK
OFwtnXkvJvtu9tSXuW/ZsTtyk7ntyynTmoPNVevLFTlObcpSbbbzbb2tnZ4OQmnTdVqMU3JuySzb
b3IA9J9F9AUPB3g5Y3GNeOcc97jfZCPGT3/BXONvc92GM6c3RwnpN0jrdJ8Q69XJbIR3RjuS973s
6yaeTPPuor5WB2XwadBVj2sdil9DHOnF7JNek/sr1vks+eWT1dLp780RvhH6cvpBU+TYd/s0Hm1/
aSW/7q3cdvC1xx0z1ep3eJwOWG3nFv6IdFKnSrEKnG8acbOpPgvi9y7diZm3Tphh30df6cdKaXRH
Dx0dgbRqatm1/Zxf+d7b7c9ba0c8Zt6epn2TUHnjadXhEzo7R08VONKnFyqTdlH9bOfdtvabbk2P
Q+Ho4fwZ4Fzn5defDbOe6K4RXqXYjl7T3TXTg8/aT0lV0xVnXrPWnN522coR5L9X39ZHhyy2GD33
7Wv8K/XqV3UHcPB/0QjgIfOOMSjaOtTjLZCO3Xd9+9cNu1q3LKvX0sNeaKV0y6VvpTV1ruOEpu0I
7HOXHr/wx5uz1Jpy6mfd8BU9aUJKVr1pW8XBLzFuduP1Vt9J7r6cxc+hfRJ6eqOL/cRf01Rem9vi
4vhvk1t2/VM5XTr08O79Rc+nfSeFGDwOHepSglGrKOXVShzfpbksuKM4x16mfpBxxyVS1eqlqLKn
TWx23cdVek9sndXu3JdHlEnorRtbSdaNlr4irnTi1lFfXktiil5sdjts1UlKWtYzY7TpPH0PBtgl
TpvXxNS7u9s5vbOXJcOpcWc/aeq36ufeOGYnETwspTm3LFVLuTe2F9q++9/1Vl519Xo8luviBz/q
lOC/fyVpP6ifor7T9LgvJ26xU4G6n9URdNfv5K039RPbFfafpcF5O3WHJwNz/qWLiv8AiiStJ/3a
fo/ffpfVXk7W7OTgKX9SRv8A8lEll/xuL3/fe76qz85rVcr7PxGUIrQ8VVl++kr04v0E9k3z+ovx
bNXWh7I3haUcHH5TWWtKV/Fwees/rS+yn/FLLYpBJ48jMNR+Ua2KxLbhrPfnUnt1U+G+T9Fc2k6S
b80ZShLTNSVWs9WnFJzkllGOyMYrjujH2JNpwvIycp6cqxp00owimoRv5MILNuT9cpb32IcHtDWN
xKq6uGwybpp8PKqT2azXqjHcubbYt9ID4ua0RB4em06ssq01u/43F8F6bW15LJeVC+PAXhoLQcFX
l+/mr0ov0F/eNcfqL8X1buSfZ8gGjsHGopYnEX8VF7L51JbdRP1yform0mST1o1GNXpDXu7LK7ey
FOEfZGK2d2bY4X2qN6SxscRq0KCaowfkrfOT2zlze5eirJb22i30geYlrQNN0I/8UTVqsvqR/u1z
+u/w/Wu5W/Z8AejsNDA0/lddJq7VKm/Tkt7+xHf9Z+TxsJNeQ2wuHqadrSlOW286tSWyK3yfsS3u
yReEk7hmlNILGuNKinGjTypx3u+2T4yltfYlkkIZXYkcT/yL9J0I/wDFFRWqv6kX/Zrm/T4eb9Yn
K37Pj1DfROChSg8ViFelB2jD+8n9X7q2zfDLa0LUxnrQ2Ua/SHEfWqVH1Je5RS7EkOE85UOtLY2E
YrC4d3owd3L+8nsc3y3RW5c2yRcr6QO8HFdH6SxMv+KKi+gi/Rjs8a1x3Q53luQ5an2fP4CL0Vo5
6VqPWlqwinKpUfoxW183uS2ttIVnGbCtMaTWkJKNNalGmtWnDguL4ye2T3vkkIZXYlan/It0XD/k
qrR8rjSpv0eUpLbvUctrY5a9n40RuhdGRx0pVKrcaFJa1SW+26K+1J5Lv2IVnGbAdKaRlparr21Y
pKMILZGK2RX6zd3vHCZZbE1jP+RdovDx/wCKKqXjn9SLzVNc3tn2R4k5bv2fHqI7QejY4tyq1rrD
0lrVGtr4Qj9qWxcFd7i1MZv4BppXSM9L1XUkrbFGK2RisoxXJfmWM5XYm8b/AMi5QeGj/wAU1UvH
PfCDzVPre2fZHiZ5bv2Zr19RF6D0VHHzlOq9XD0lrVZct0V9qTyXfuLazjNhtpjSktL1XUaUYpKM
ILZCC82K6vW7sshllsTtX/kWcN4vZisRHy+NOk9keUp7XwjZbyctezPvv5CD0Joh6Wq6repTinKp
PdGC2vr3Jb3YWs4zYVp3Sy0pUWotWjTWpSh9WK483tk97YkMstiYwS/2Zw3yl5YmvFqit8IPKVTr
eyHK7HLU+zN+tFZ0ZoyppetGjTXlTfYlvb5JZsrGM34Er0j0jTquGFw7/Z6F1F/Xk/OqPrezgrEj
WV9JxBWSsDVggS0AaAENFAkAS0AJCBDKoS1cIEACGrACWgBDKgQ0AIaAEMAQygQ0AIaABtXAENXC
AbQAJoAQygGwAbQACYRYG0BSQBDQBoAQAaZUCAowA0EGgDADADLAGmgBIBoAXECUoCNhRtIiDZQb
ANhR/9D6CHpfIflUwA0EGmgBIUYAYAYAaKgwAwgNEAkqjADQBhUGAGAGAGAGEBhAJaKBIBgBgBgB
gBgBgBoINAGAGWANWANFUYAYAYAaCDAgwA0RRgBgBgBgBqwAlgGgDADLAGrAGgo0VBgBgQYAYAYA
YAYAYAYAYAYAYAYRRoAwINAGBBqxVGgDADADADADADADADADADADQBgQaAMAMAMIDADVgo1YoNAG
AGAGAGAGAGggwAwAwAwAwAwAwA1YijRQaCDQBgBgBgBgBgBgBgAloA0AYAYAYAYAYAYAYAYAYAYA
YAYAYAasUGWCjVgDLAGgDADCgwAwA2AYUGAGAGAGAGAGnmQCbBBsAwAwAwAwA3YijADADADADADA
DADADCg2UGAGAGAGAGAGAGAGyKFoA2AbQAoINhRgApEAooMANoKFkQYUG0FCiA2ig2FCyINhRtBA
sijCgWgDCAWigUQCkFCgg2FC0EGwoUgBQApAGwBcSAUUG0RQsINoKFhBhQbCjABSIDAgwA2FGwDA
BQBgQYAYRRsKMAMAMAMANBBhUGAGAGAGAGmRQgoMCDADADADQQJCjQBjANBAlhQlgGBBpgCADADA
DQQJYUaAMAMANBBsKFoA2AKiAKAFoKFoAWAECgiIBaACRCgsQAsQAqCgqIAqACxCgsQAqCgqIAqA
CxCgsQAqIoKigKiKCoALEKDRACRCgsQAqCgqACoigqACoKCxACxCgsQAqChcQAkQAiIoIgAgUEAM
CBSChQQYFGwo0EGBBgBgAlhQkAwIMAENBRoAwIEMAHJAA5FQDkgATQQDaAENXCATQANoIBSRQBaC
AUkACkggG0ACaCAbKAcggQwAbQAJoIByQAJoAG0AIaCAbKAbABtBAiQANoIEFQDasAJaCAYAhqwA
iSAEtXAEACGioENACGAIaAENACQAbQAloIBtAA2gBDRQDaABsAG0EA2gBDQAOQAiSAsIApLZUCbh
Qm4QJbQAm4Bq6YAm9ggS5IATcA1cASwBIQY1cCsAu2wpspATZQDbYAQKgiACIAIgAqIoKgAkQAyC
g8QAsQA0SKDRADRCg0SANEKDRADRACxIoMgJRohUFiAGQAVEUGiAFiFBkAFiQBohQVABUFBYgBkQ
BEFBQAiAFoAIgoWgAgAsAIgDADaIoUgDZQbIowA2wDQBhUCWAJ2kBY8FhI4GPjKm32fmZrtjNeRB
43GPGSu9i2I1HLK7EeVkTmitG+M+kqeati48+oza64YhvpfSfyl6kPMXr/ISJllsQDNOYf6N0a9I
S4QW1+5cyWtY47ExpjSawUfEUcnaztuXDr/W0kjpllrxBSJGnAEw2EnjZqEFdv1c2CTYu9arT6NU
dWOdR+t8XyX64meXe/Yg5ziK0sTJzm7ybu2bee3Ybarm7LNsIOiaJ0ZT0BSeIr+fbu5Lm/yMW7ej
HHt80UTTOlZ6WqOUsorzY8F8eJuTTjll3CEkVgXbot0c+U2xFZeQs4p7+b5e3q25yrt08N+aGfSv
pJ84t0aT+iW1/Wfw4cdvAYzSdTPYokjbgJrQGgJ6dq2WVOPny4clzf5kt03hh3C8dJtPw6P0lhML
ZTtZtegv+E/z22MSbds8+3xBxuWZ1eUEweBqaRqRpUlrTk7JfrdxGyTY7NGOH8H2Eu7SrT75y90V
+s2cvaevx04OIaSx9TSlWVWq7yk8/guS3HWTTyW7EY0Vkdq6H9F6egKTx+MtGSjdJ+guL+0+G1bN
ry5ZXfh6+nh2+aObdLulNTpLVvnGjHzIe9836tnX0xmnn6mfcKazTkOhdBOhT0/NV6yth4P+Nrcu
XF9i32xllp36XT7vPoJjwhdNVUTwOEaVOPk1JR2O3oRtuW/js2bc44t9XqekHGGdXlEx0f6PVukt
dUaS5ylujHe37lvZm3TWGPcO5dINNYfwc4OOEwqTryXk3zee2pPnwW/ZsRyk7nryynTmoPN1etLE
yc5tylJttvNtva2d3hCKVCWIkoQTlKTSSWbbexIEHpDo9oTD+DfByxeLa8fJZ2zavspw58X27Fc4
29z3Y4zpzdHBuknSGt0mxDr1nyjHdGO5L3ve8zrJp488+67ECVgdr8G3QVVraQxiSpx8qnGWx29O
V/RW7jt2beeWT19Lp+tEF4ROnL6R1Pk9BtYaD2/Xa3vl9Vdrzta446Y6vU7vE4HMLG3nFy6GdD6n
Suvq5xows6k+C4L7T3cNvXnLLTr08O+jq3TvpdT6L0Fo3AWjNRtJx/s48PvPbfar32tM54zfl6ep
1O3xB53tc7PEHmjtHVdK1Y0aMXKpN2SX62La3uQ3pZNj0jThhfBTgLu08RPvnPhyhH9Zs4+093jp
QecdKaSq6YrSr1pa05u7fuXBLYlwO08PDctiPsEHoTwfdDqfR+k9JY60ZKOtBS9CP1n9p7ltXW8u
WWW/D2dLDt80cx6b9ManSyvdXjQhdU4f5nzfqWXFveM04dTqdwpJpyHR/B90Hl0nq+NqprDU35X2
39Vf5nuWW15Yyy079Lp93wFr8JXTeMU9HYNpQitWrKOSyy8XG25el/DxM44+rp1ep6QcNOryCY0D
oOt0irxw9FXlLa90Vvk+S9ezayW6axx7roehdM6Tw/gxwMcNh7OvJeTfa3vqS5cF2LJO3KTuezLK
dKag83YjETxc5VKjcpybcm9rb3nV4eQ7wuHd07Xk3kv1v9nW0RqQeh+jGgqPQfCyxuMyquOfGK3Q
ivrPZ6uLfK3b24Y9k3RxjpJ0hq9JK8q1V2SuoxWyMfqri36T92R0k08mefcIB91lZ/ZXBc/1xZpz
HVPB50K+dpLF4iNqEH9HB+m+L4pet5bFY55ZaerpdPfmjOn3TD58lLD0ZWwlN+XJf2klsS4rhu9L
YkMZo6vU7vHoOcOVtWco3k8qVPaktza38l6TzeWUtuAn+j3R+rp2u6FN3m869XbqRe1J729je95L
ydZuW6bxx7rr8R1/pHpij0PwywWEahJR8qW1wi9/OpLPVXXJ2ijnJt6c8uyag4NKSxX0tRONGLaj
G+cntavvb2zluy+zE6vHyDUKUsXKNScdeU2o0aSXnbllugtn2nl9ZoTyO7aPwlHweYSeKxT18TU8
573LdCPJb+q+xJLlftPZJ9XN3kcZ0rperiKrxVd3xE84R3U47nbc/qrd57zav0kebLL1vIjl/VC1
n/xRLNf8bT9J/be76qz862rWOPiMj/Uy1n/xRJXiv7tP0n9t7vqrPzrark9n4jdNfM8VUl+/krwX
1E9kn9p+ity8rbqg4G6MVouKrVM60s6cXna/pyX+FPb5z8mykXgZh6aw0flNfypSbdOEs9d3znL7
Kf8AE8tilaHHmjdCl47WxWKblG7sr51JcFyXpPcslm0E++jdKEtLTlXrvVpRtrNLZ9WEFsvZWiti
Su8ky8E8+aMevp2qlG0KcI5L0acFvfve2UnvbsThfaGYis9IShhsNF+LTtCO+UntlLm+6Ky4ti+f
EC8ZXjgYPDUWnf8Ae1F6bXox+wn/ABPytijYW68A9v8AZ+H/AHVTX/JqL/ztfwr7T8lyez8QLAYW
GDh8prq6z8VTfpyW9/YW/wCs/JW9oSa80Jw2HnpmpOtWk1BeVVqPctyS3t7Ix9iTacEmxrE156aq
wpUYWivJpU1uXvb2ylveeSWTgv2gbSGJhgofJaDTV06tRenJbl9iO76z8rhYtuvEB6C/2fpqtL/i
mavTj/dxfpv7T9Bbl5X1RyT7PxDPRmAjiNavXbVCD8p75SeyEftPjuV2+apJvzQmtVq9Ia6jGPlS
tGEFsjFbEuCS2t823tZeD2qHOksVDDQ+SUHeCd6k1/aTX+Reit+cnm8oZXXiBzhILQFNYiS+nmr0
Yv0F/eNcfqLj5W5XnKz7Pn1DDRej/nKcp1JONKHlVam2y5cZN5RW98rlqYzY1pLHvSlSKhHVpx8m
lTWdluXOT2t7W2Qt2JLGyWgaTw0H9PNWryXor+6T/wAb3vydid3LV+z4/EN9EYKEIvFYhXowdox/
vJ7orktsnuWW1oVMZ60Mpzr9IMR9erUlZJepLgkuxJcC8J7VEhpbFwwlP5Hh3eEXerNf2k1w+xHZ
HjnLeSLldeICaKoR0XT+W1km7tUIP0pLbJr6sfXKy4imPjz+Ai8Nhq2nK+qnrVKjbcm+1yb3JbW+
BeGZ9qiQ0zjoascLh39BTd9bZ4yexzfsit0ebZI1lfSB3oyktCUljaiTqSusPB8VtqNcI+jxlyQ5
XGdvn8BC4PCVdM1lCPlTm222+1yb4La2ViTuEhpvHQko4XDv6Ck9uzxk98317IrdHrZI1lfSBxom
jHQ1L5dVSc22sPB75LbNr6sd3GXUxyuP2fP4CBw+Hq6YrKEbzq1Jdrb2tv1t9pWJNiY05jKdGMcF
h3elTd5zX9pU2OXUtkeWe8kayvpBvQeDhgoPHV1eEHalB/2lTcvux2y7FvFXGa80QFarV0rWcpXn
VqS7W2/1ZFY5Fi01Vjoal8gpNOV1LESXpTWyCf1YeuV3uJG8vHj8Qy0BouGJcsRiMsNRWtPjJ+jB
c5PuV2KmM9bxBF6W0nPS9aVapk3sS2RislFckskWM5Zdwslf/kV8L4rZisTG8+NOk9keUpbZcI2W
8zy6X7M++/kKTY04hLQBoKMCBLQAkAQ0UCWgBDRQJaIgQVQloIEtXAEACGigQ0ECGAIaAENACSgG
0ADasAIaABtBANoAG0ADaKAbQAGaCECA0Q8gDTQAgAS0ECSqEtBBqwUaANAGBBoAwAwAywAloA3E
CUsKjaREGyg2AbCjLEB//9H6CHpfIflUwAwA0EGmiASVRgBgBgBoIMKDCA0QGrFUaAMANBBhQYAY
AYAYQGEBoAS0VBoKMAMAMAMAMANWCDQBgBgBgBqwBoqjADADQQYEGAGiAwKMAMAMAMYAMAwAwAwA
wA1YA0FGioMAMCDADADADADADADADADADADADRFGBBoIMANWCjVigwAwAwAwAwAwAwAwAwAwA0AY
EGgDADADADCA1YKNWKDADQBgBgBgBgQaAMAMAMAMAMAMAMIBNiqNAGBBoAwAwAwAwAwAwA00ECQo
wAwAwAwAwAwAwAwAwAwAwoMAMAMAMAMAMANWKDLBRqwBhQYAYAYAYAYAYAYAYAJIgwAwAwA2RRgB
gBgBgBgBgBgBgBhQbAMKDADADADADADADCA2FGAC0AbANoAUEGwowAUiAUUGAG0FCyIMKDYUKIDa
ANlUKIyFBobRUCjINlUKQBsgFooNkApBQoIFBQpBAoKFIAUAbRAKKBSIBZQYgoWRBsqhaIDYQYUG
wowgFBBgBgBtBRsA2gDYQYAYAbIowKMAMAMCDRUGAGAGAGAGACWyKElQYAYAYAYAaYQICjADGAaC
BIUJAMCDTAEAGAGAGmECAowAwA0EGAGwoUggUFG0ALAFIKFoAIALQASJFC0AEQAVBQSIAaIUERAF
QUGQAVABYhQWJAFQARMKDIAKgoLEgCoAKgoKgAqCgqACxCgsQAsQoLEAKiKCoAKgoKgoKgAiACIK
CIgCBQRABEAEQUbCDaChYQYFGwowA0EGBBgBoKEhRoIMCDTChLANBAloKEMIBsAGwgE0UA2ggGwB
EkEApIAE0VAJoAE0EAmgATQQCaKgG0ADYAhoIBsAEwgG0ACaABtAA2AIaCBEkUA2ggGwAbQQIaAE
NXKgQADaCBDVwBAAhqwAhoASAIaKgQ0AIaAEMAQ0AJaABsIEMAG0ADaKBDQANoAG0ADaCBDABsAQ
AgbyA0S0VAhgCGgBDQAkoEMA0ECGgDQBgBogNBBgBgBsKFhBsKFRAFhQRABEAFQAREUFQASIAaIU
GiAGiAGiRQaIAaIUGiAGiRQWIAaIAaJFBkBKLEKg0QAqADIigsQAsQoMgA0SALEKCoAKgoNEALEg
CxCgqACIAWgBaCgiAFgBEALQBsA2iKNoAUVBsjQwA2AaAMCDTKCd0fglRXjamW9X3czNrrjjryI7
H414t2XmrYveWRjLLYiysCU0Zo75S9aXmL1mbXTHHYLpbSWt9FT2b2vYuQkXLIVtmnIO8FgZY6eq
ti2vgStYzYsGkMdHRUFSpedbu5vmSeXTK9viCkTes22acAmlRliJKEVdvYCTYu8IU+jdHWec363w
XJGeXf2IKDjMVPGzc5u7fq5I24W7DFhkXzQeh46Nh8pr5NK6T9Fcev8AW0xa9GGOvNFU07pmWlp8
KcfNXvfP2G5NOWeXcK8yuYtHRvo89JS8ZUX0Sf8AE+HVx7urNrrhhsOulXSJVE8NQdoLKTW/7K5c
eOzZtSLnn6Qc9kbcA/0RoeppqqqcMltlLcl+ti3kt01jj3DoumdK0uiVBYfDpeMay5falz4fBWMS
bd8suyag43Vm6snKTbbd23vZ0eWhFKhLEyUIJylJ2SW9lTWx2TRuAodBsM69Zp1ZLO21vdCPvfbs
WXK3ueuSdObo49prS9XTdV1arz3LdFbkv1ntOkmnlyy7hCSNMDrHQjojGkljsWkopa0Iy2JLPXl7
u/gc8svR6un0/WirdNul0tPz8XSbVCDy+0/rP3Lt27Ljjpy6nU7vgOfyNuIt3Q7olPpLVvK8aEH5
cuP2VzfqWfC+crp16fT7heunPS6Gh6fzfgrRaWrNx9BfVXPi93Xsxjjvy7dTPXiDhDOzxh7orRVX
TVaNCirzl3Jb2+CRLdLMe7gd+xNfC+C/BKELTrz2cZy4vhFcOza2zj7T22zpQec9IY+ppOrKtWk5
Tm7tv9bOC3I7aeG3YZaus7LeVB6F6F9E6XRCg9IY+0aijdJ/2cX/AJ3s4+jtuccrvw9vTw7JujkX
THpbU6V19d3jSjdU4cFxf2nv7tx0xmnm6mffRUDbkOp+DvoI9PzWJxC/ZoPJf3jW77q3vfs4255Z
aejpdLu83gSnhI6dLF3wOEdqUcqko7JW9FfZW/js2bZji31epvxBxg6PILB0a6OVuk+IVClkts5b
ox4v3LeyW6bww7qO69JNO4fwc4OODwaXj2st7V9tSXFvcvcrHKTuezPKdOag83Vasq8nObcpSbbb
zbb2tnZ4RuhQliZKEE5Sk0klm23sSBoekuj+hcP4NsHLF4pp15LyrZvPZThz4vft2I429z3Y4zpz
dHBekXSCt0lxEq9Z7cox3RjuS973vM6yaePPLuuxBFYHavBt0FVe2PxatSj5VOMtjt6b+yt3Hbs2
88snr6XT9aITwidOX0iqfJ6DthoPb9dre+S9FdvC1xx0x1ep3ePQcwNuAt/Q7ojU6V19RXjSjZ1J
8FwX2nu79xnK6dOn0+8dZ6c9LKXRSgtHYG0aijZuP9nF/wCd7b7Ve+1o54zfl6epn2TUHnfadniD
rAYCppOrGjSi5Tm7RS/Xe9yzIsmx6Rw1DC+CrAOc7TxE9vGcuC4RXHt2tI5e09010oPO+lNKVdNV
pV60tac3nwXBLglsR11p4cr3XYTQoW8p9i9/v6s3lk4Qd36B9FIaMp/OOMtG0daClkox267v3xvn
6T8prV55V7OnhrzRQemvS2fSWtk3GhTfkR97+29y9FZbdZmsZpw6nU7hStj4Nfyr4+zr2bcheug3
Q6XSWrrzTjhqbz+0+HXx4LsvjK6dun0+74C79PelcaMXo/CtQpwSjWnH0V/dx4ye9dmSUms4x16u
fpBxqUklGco+T/ZU+P2nxXF+k8lZLLo8wktHaOraQrqhSWtiaj8p7oLfnudtr9FeSs9ktWTd16ju
1R4fwc4LxdOzqtXcnve+UuS2RjvyXFnP2ns8dODguLxctLylWrOSpKTb+tOT28tZ73sjG2VlGL68
PHbsAuq1q1ZeQsqdNZXtuW9RXpPa3fPWbaIO3dEuj8ejlKWk9INRq6t0mv3cbWSS3SexJbFaK3nO
3fh68Me3zRzfpN0jnpeqsTWW79novNRj9ea3t7UvSyb8hJS1I4Z578/gK6n8g+mq+VXn5UIyztfP
Xlfa3tint855WUtOfA3D+rl46r5VaflQi87Xz15X2t7Yp7fOeVlIcDKcfkK8fW8qrPyoRlnt9Od9
q+qn5zzfk5SE8eRulBYdfKcR5cptuEJZ67v58vsp/wATy2J2L99GUafjL4vFXkm3qxbzqS4cor0m
vurN3UPvoVSg9IylicQ2qUWk7ZXdsoQWxZdkY58E3Cc+aMjGWm6jlK1OlTWb9GnBbElvfBbZSd3m
2y8HtDKk5aXnGhQjq0431It7F6U5vZfK8pbElbJJInC8+IMxeIjZYXDXcLrWklnUludtuqtkY9rz
eVLfSA9eS0LB0YNOvJWqyXorfTi+P12vurK+tOS/Z8BWGprQsFXmk60lelB+it1SS/wLf5zytrCT
t8gWBwirKWJxLfik88/KqT26qfrlL0VntaTpJ60aSq9Ia13aKSzeyFOEfZFLtb4t5uD2hmkMYsRq
4fDp+Ji/JVvKnJ5a0lxe5eislvbFu/EDvEzWgoOhB3rzVqsl6C304vj9d/hWV7zlb9nwB4DDQ0fT
WKrpSv8Auab9Nr0pL6i/mfk7Nawk15DfCYappyrKdSdlnOrUlsit75vdFLa7JDhJO4b0jjfnCUaV
GLjSh5NOG1573bbKW/sSySBbsP8AFSWgacsPB3rzVq0l6K/u0+P13+HYnecrfs+ALRmDhhYfK8Qr
wTtTg/7Sa/yL0n+FZvISa80NadOt0hxDu7zm25SeSiltb3KKXYkrIcJ7VBtK4+DisNh7+Ig732Op
LfN+yK3Lm2IuV9IH2HX+ztNVpf8AFNRXpL+7i/7R/afoLcvK+qOVn2fiIzRWjfnKcpTlq0oLWqz4
L3yeyK3vtLWcZsa0rpL5ymlCOpSgtWnBeivfJ7ZPe+wSGV2Jav8A8i5SdJf8VVY2qP8Au4P0F9p+
nwXk72Tlq/Z+IYaG0ZHE61as3HD0rObW1vdCP2pepXb2FtZxx3zwAaRx89L1dZq2yMIR2Risoxiv
1d57WEt2JnGyXR+k8LB/T1F9PJeiv7pP1z5+TuZOW79nx6+oY6F0bDEa1evdYelZzttk90I836ld
ipjPW8BppLSE9L1XOSzdlGK2RisoxiuC3fErNuxN41ro7ReGj/xRUX08l6EdqpLnvn2R3MnLd+z4
9fUR2hNGRxspVKzccPSWtUlv5RX2pbF37hWccdhtpbSctLVXNpRikowgtkYrZFdXrd2NGWWxN1V/
sxQcF/xXXj5fGlTfo8pS371HLeTlv2Z99EJobRT0rV1W9SnFa1Sb2Rgtr69yW92RbWMcdhenNKrS
U0qa1aFNatKHCPF/ae2T4iQyy2JbAxXRugsVL/imqmqC+pHY6r57odrzJy1PszfreBWsBgKmlq0a
VNXnN/6tvgtrfA0xJsS+n9IU7RweHd6FH0v7yfpTfsjwj1kjWV9IC6AwcMHCWPxCTp03anB/2lTa
l92O2XcKuM15orWNxU8fUlVqPWnNtt82Vzt2GoBgAloIEhRgAhoqBJAJaKBDQAlooEtEQIKBDVgB
LVwBAAhqxQIaCBDQAhoAS0ADaKBDVwAbABtAA2ggG0ADaKAbQAOSuAN2gjRLVwBIAloAQUCWiIEl
BoAwA1YA0FGgDAg0AYAYAYApSzCslBBgBsKNgCiIP//S+gh6XyH5VMAMAMANBBogElUYAYAYAaCD
CgwgNAGEAkqjADQQYUGAGAGAGEBgBogNNFQasFGgDADADADADADQQaAMAMAMANWANFUYAYEGggwA
wA0RRgBgBgAgqDADRFGAGAGAGAGrAGgo0VBgQYAYAYAYAYAYAYAYAYAYAYAYAaIoywQaCDADADVg
o1YoMAMAMAMAMAMAMAMAMANAGBBoAwAwAwAwgMANWCjVig0AYAYAYAaCDADADADADADADADViKNW
KDQBgQaAMAMAMAMAMAMKBLQBogMKDADADADADADADCgwAwAwAwAwAwAwAwAwAwAwAywBqwBqwUYU
GAGAGAGACSIMANkUYAYAYAYAYAYAYAYAYAbKDCgwAwAwAwAwAwAwAwijYBgBuwApAGwBSCDaCjYB
gApEAooMAMQUEIgwoNhQogNgGyqFIiBSAMKoWiINhQqIBsgFIoFEBtBQtFQbIoUggWFG0ALAMQAs
A2ALIDZQLRFGyoFIijYQbKDADYUbRAbCDADADYUbANoA2EGAGAGyKMCjAg0VBgBgBgBgBgBpkUJK
DQQYAYAYAYAJYAkAwAwINACAo0EGAGmAIAMAMAEsIEhRgBgBoIMKDZFG0ALAMACAG0FBEALQAuIA
SJFC0AEQARBQVABYgBYkUFiAFQUFQAZBQSJAFiAFiFBUAFQUGiQBYgBYhQSIAVBQZABEwoMgAiCg
sQAsSKCxACoKCoAMgoIgAgUEQARBQSJAEiAEiFCggwKCBBgUbQBjAMCjQQYEGACWgo0FGggwINMK
EAGBANgA2ADkVAOQANoIBtACGEAmgATRUApIAFJBAKSABNBANqwAJoqAbAESQQDaABNAA5IIBSQA
NoAG0AIYQIZQCaAENBAOSCBDABsIENFAhoIEACGgBLVwAYAhqwAloIEMAQ0UCGgBDQAhgCGgBDQQ
DaABtACGigGwAbABtACGggG0AIkgAbVwNEACGioEtACGAIZQJYAgIMANEAmxQaANEBoIMAFIKFgG
wBaANoKCIAKgAiACoigiACRADRCg0QA0QA0SKDRACxCg8SALEKDIANEALEigyAlGiFQWIAaIAVEU
GiAFiFBkAFRAFiFBUAFQUGQAWJAFiFBUAEQAtABEFC0AEAFoAJEA2AbIo2gBRUGyNDADYBoAxhBM
6OwOt9JPZuXvJa6Y4+obaRx/yh6sfNXrEiZZbEUacw+0fgHi5XeUVt+BLW8cdh/pPSCorxVPLc2t
3IkjeWWvEFYZpxBcNhZYySjHtfBEWTYs2JxENC01CGcns+LM8u1vaKVVm6jbbu3tZtwAowdRpJXb
2IILphMLT0DSdSp572/BGeXeTtFK0hjp6Qm5y7FwXA1HG3YjZFZFy0BoVU18orZJZxT3fafu7zNr
thj60Qmn9NvSUtSGVNbOb4v3Fk0xnlsViRpzE7oHQT0tPWllSjtfHkvfwM26bww7hOdJdPLCR+S4
fKytJrcvqrnx4deySOmeevEHNmbeYOdH6OqaUqKnTWb2vclxYt0smx0zGYqj0Mw6p07Sqy2cW/rP
lwXZxZz5em2YQcexWIni5uc25Sk7ts6vLbsNlB1GkldvJJBB13QOhaXRSi8VibKpb+FP0Vxk9/ds
u3zt29WOPZN0cw6Q6dqaeq688orKEdyXx4v3WOkmnmzy7hXZFYHRehXRD5c1isQvolnGL9Jre/sr
19W3GWTv0+nvzQ26cdMPnRvDUH9DF+U16bX+VbuO3gXHHSdTqb8Qcxkjbzif6M9GqnSWtqRypxzn
Pgvi9y9yJbp0ww7qOo9KuklLodQWCwaSq6tsvQT3vjJ7V3vdfnJt6M8+yag4DUk5ttu7ebbOrxBe
EwdTH1I0qUXKcnZJfr/QLJsegsDg8N4M8E6tW0q89ttspbox4RW99vBHH2ntknSg8/6a0xW07WlX
rO8pbtyW5Lkvz2naTTxZZd3kQ7KyO6eD7oXDR0PnHHWjqrWpxlkorbry58Fu27bW5ZZej2dLp680
UTp301n0oq6lO8cNB+RH6z+s/cty5tmscdOPU6nd8Bz024i/dBOhU+lVXXneOGg/Ll9Z/Vjz4vcu
bRnLLTt0+n3fAX3whdNYaKp/NuBtGy1ZyjsgvqR58Xu2bb2xjjvy7dXqa8QcDOrxiU0Poitp2tGh
Qjecu5Le3wS/WYt01jj3eB6IxeJwvgrwKp07TxE9l9s5fWfCK3Ls2ts4+09ts6UHm7H46ppOrKtW
k5Tm7tv9dy3LI7PDbsNUtbJBB6K6E9E6XQ+g9I4+0aijdJ/2cX/nezjnq7Wzjld+Ht6eHZN0cj6Y
9LavSuvru8aUbqnDguL+09/duOmM083Uz76Kgacx1Hwd9BX0gmsRiFbDQeS/vGt33VvfZxtjLLT0
dLp93m8CX8JPTpYq+AwjtSjlUlHZK3or7K38dmzbMcWur1N+IOLnR5RPdHOj1bpLXjQornKW6Md7
fuW95Et03hj3XQ7z0h01h/Btg44TCJePkvJvm89tSfPguzYjlJ3PXllOnNQeba1aWIk5zblKTbbe
bbe1s7PCNUqUq8lGKblJpJLNtvYkAekejOgaHg7wksbjGvHNZ72r7IR4t737lc429z3YYzpzdHCu
kvSOt0nxDr1clshHdGO5L3vezrJp5M8+6iNw1D0n2L9fre8kKzIOxeD/AKF/OLWMxS+hjnCL9NrO
7v6KfHznm8lZ88snq6XT35oZ+EHpr88TeHoStQg/KkvSa9v2V+Lg4scWer1N+IOYbMtlv5eb5/rg
l0ecWTor0ZqdJ6ypxuqUc5y4Li+b2Je5NmbdOmGHcOx9KukFLonh1gsG1Caj5Uln4uL385y9Ffid
kjnJt6s8uyag4LOaaU5ryM/F075ye+Unwvte2TWqrJeT1eMOqGHq1KqhBOeKqOyS9DktylbqVNcH
5o/Md80LojD+DrByq1WnWa8uXF7ox36q7287XtE5W9z244zpwcS0zpip0mqyr1m40YvtfBJceCzU
Vm283LpJp5Msu7yIttV0qtVatGOVOmt/Je2Uve0VkdZ6B9FPHtaSxqSjFXpQeUUlslbdFej/ABcG
+eV9Hp6eHrRC9NOlnzvNP+wi70ab9N7PGTX1fqxe3quXGMdTPYoqfyb9or+XVnnCMs7/AG5Lh9WP
pbX5PnbcePNG4/s37RX8urPyoRlne/pz5cF6T2+T5w480ZCPiV8pxHlzndwhL0n9aX2b/wATy2Jg
++jdON74rFeVrNuMXtqPnwgt7W3zVvcS/fRlKn8tbxWJb8Xe1lk5tLKEdySVrtZQjbe4pw580KhG
Wl5OrVepRgkm0sor0YQXF7l1yb85l4TkY9bTdRQglTpU07JvyacN8pPe3ve2TsktiHB7QyvVePcc
LhovxafkrfOX15c+C2Rjv2tl58QbxeIhgoPD0HrX/e1F6b+rH7Cf8TzeSilC3XiBx/zL8bf8lUln
/wAaT3ffe/6iy85+S5PZ+IRg8NDAQWJrpSb/AHVN+k16UvsJ/wATy2KVhJrzQnDYeWlZzr4iTVNO
9Se9t7Ix4ye5bEs8khwSb80aq1KmnasadKNopWpwTyhFZu7ffKT25tjg9oK0hjIUIfJsO7073nPf
Ukt/3V6K/E83ZC30gdRX+zsbv/iqSyX91F7/AL7Wz6iz85rVcr7PxDXRuBhqvE4i/iYuyWx1JfVX
LfJ7lzaFqSetGrVukVfdrNdUIQiu6MYr1cxwe1QTSWOhGKw2H/cxd3LY6kvrPluity5tkLfSB7Bf
7OQU3/xVNeSv7qL9J/ba81eis9rVnLXs/EMNF6PjidatWbjQp+e98m9kI/afqV29mZnGb5CMXiau
nK0VGO20KdOOyK3RXve93bzZdaLe4PtIV4aKpvCUWpSf7+ovSa9CL+ot79KWexISLbrx+I1o3Cww
FP5XXSkrtUab/tJLe/sR38X5PGykmvNDGjRr9IMQ89apNtyk8klvbe5JdiReE1cqHelsdDVWFw/7
iDu5bHUnvm+W6K3Lm2SLlfSB5gaS0DTWKqK9aavQg9y/vWuXoJ7XnsWc5WfZ8/gIrR+BqaZq6t9t
5TnLZFbZSk/1d5bWXhmTuDnTGko4jVoUE44enfUT2ye+cvtP1KyRIZX3cCQwcV0dpLES/wCKKi+h
i/Qj/eNcfqfxbkOWp9nz6+ghdG6PnpirqJ22ynOWyMVnKUnwXreW1lZk2HemdJQxOrRoXjh6V1BP
bJ75y+0/UrIkXK78TgP9HwXR+ksXNfTzX7PF7lvqtctkL7XnsQ5WfZ8/gIPAYGrpisqcM5zbbbez
e5SfBbWysSbElprHwcY4XDv6Cm9ux1J75v2RW6PWyRrK+kDjQ+Hjoun8urpOzaoQfpzXpP7Md/F2
XEVcZrzfkIH6XS1bfOrUl2uTZWORPaZxENGU/kNBppNOvNenNeivsx2Li7vgZjeV14nzDTQWjIVN
bE4j/ielbWW+cvRprm9/BXZbUxnreBGaT0jPS1WVWptlsS2JLJRS4JZIrNuxY8T/AMixh3RWWKrx
+ke+nTeahylLbLgrIzy6X7M++iA0NoiWmKqgnqwScqk3shBbZP3cXZFt0xjjsG0/paOkZxhSWrh6
S1aUeW+T+1J5vu3CRcstiBKwNNACLWAMANbQBLVgDQAhoqBLRAIaKBLQAllAhoASECGrACGigS0Q
CGigG0ECWgBDABtFANoAQ0ADYAOSCAbQANoAG0UA2gAEkEaDANNACQBDQAkoEMA0AYEGgDADVgDQ
UaCDADQBsAWgMsANhRsA2iINlB//0/oIel8h+VTADADADADQQaIBNiqMAMAMANBBhQYAaIDCA1YA
0VRgBoqDADADADADCAwgNBAmxQaCjADADADADADVgg0AYAYAYAZYA1YA0VRgBoIMCDADRAYFGACC
oMAMAMANEUYAYAYAYAasAasAaKDAgwAwAwAwAwAwAwAwAwAwAwAwAwijVgg1YAwIMAMANWKo0AYA
YAYAYAYAYAYAYAaAMCDQBgBgBgBhAYAasFGrFBoAwAwAwA0EGAGAGAGAGAGAGAGrEUasUGgDQQYA
YAYAYAYAYAasVBqwUaKDADADADADADADADADADADADADADADADADADADADADADVgDLBRooMANEBh
AYAYAYAYAYAYAYAYAYUGwDCgwAwAwAwAwAwAwijYBuwBlgDZEGFBtBRsAUgg2go2AYAKRAKKDADE
FBCIMKDAoWiAwIFFaCkRBtAGyqFoiDYUbQAogNooFkBtAC0AbQApBQpACkAKANgCwDAAiIDZQKRF
CioFIijYQbAMKDYUYQCggwAwAwAUFGACgDAgwAwA2RRoqDADADADADADAoSyASVBgBgBgBgBoIEs
KNAGAGggxgCAo0EGACZACQDADABDCDQUYAYAaKgwAwgNhQtBBsKFRYAoAIgoWgBaACIiggAtABIh
QVABUAFQUFiQBYhQVABUAGRFBEAFiFBYgBUFBUAGRAEQUFiAFiFBYgBUFBUAFQUFQAVEUFiAFiFB
YgBYhQVABEAEiFBIgC0RQRABEFBAgxBQtAGwg2GgphAkKMANBBgQYAJaCjQBoIMAENBRoATIIBsA
GygGwgGwgGwAbQAiSCAUgATRUAWgATQQCaCAbQAJoIBtFAhgA2ggGwATQQDaABMAGwBDQAhoIBtF
ANoIBsAG0ECGggQUCGgBDQQIYAgAQ0AJauAIAENFQIaAEMAQ0AIYAhgCGADYANhANooENEANooBt
ACGggG0ADaAEAahDVigQ0ECABLAEMAQUCGgDQQYAaIDQQasVRpogNAC0EGwo2gBYBtBQRABUAERA
FQUEQASIAaIUGiAGiAGiRQaIAWIUHiAFiRQVAB0AFiRQaIEosQqDRACxADIigsQA0QoLEAKgA0SK
CxACxACoKCogDRCgsQAkQBaChaACABEALiALiAKAMIoUAKKg2RRgUbANAEpo/A+PetLzV6yWt447
BNI47X8iGze+IkMshBsrmHeDwbxcrbltYq447Evj8YsFHxdPJ+z8yR0yuvAq0jTiFUqEsRJRjm2R
ZNizzlDQlOyzk/W/gZ5dvZFPr1ZV5OUnds24Whu1rZLaAXDR+BhomDrVfOt3clzM3y7Yzt80VTSe
kJaQnd5RWxcPzNSOWWWxEsrAs+gdCeP+mqryFnFPfzfL29Rm11ww9Q26Qac+WPxVN/Rra/rP4f6i
Qzz2KkzTiJPQ+h5aWnbZBedL3LmLdN449wtWndMw0PTWGw+UrWy9FfF/mZk265ZdviDmUszbzBeF
wk8dNU6avJ7P1wBJsdO+h6GYe/nVZd8n7or9Zs58vV4wg5Pj8ZPSFR1KjvKX6suR0eW3Yj2rlZHV
OjXR+GhKbxeKtGSV0n6C4/efDds2nO3b04YdvmiidJukU9PVN6pR8yPvfP2bOvcmnHPPuFUkacxd
eh/RN6akq1VWoRf8b4LlxfZ1ZyunXp9PuEl036WqSeDwrtBZTktjt6K5ceOzZtmOLXU6npByaR0e
YSmhNB1dP1lSpLnKW6K4v3LeyW6axx7h1/TWl6HQHCrDYZJ1pLLjntnL3Lfs2I5ydz1ZZTpzUHAM
RWliZOc25Sk7tva2zq8V8gNOjLESUIJylJpJLNtvcAd/0BoSh4P8LLF4prxzWe9q+yEeLe9+5XOV
vc9uOM6c3RxLpJ0hq9JK7rVclshHdFcF73vZ0k08mefdRXGVzHX/AAedBli7Y3Fq1KOdOL9K3pP7
K3cduzbzyyerpdPfmiL8IXTl6dm8Nh3+zxebX9o1v+6ty37eFrjjpnq9Tu8TgcqZ0ecWvoj0Sq9K
6+pG8aUbOpPguC+093fsRm3Tp08O6jrnTTpXS6G4daPwFo1VG11/Zp7/AL728fSe6/PGb8vT1M+y
ag86Sk5O7zbOzxB1gcDU0lUjRpRcpzdopfrve5ZhZNj0hgcHhfBZgXVq2niJ7bbZy3Rjwit77XnZ
HH2nuknSg886a0zW0/XlXru8pdyW5Lgl+e06yaeLLLu8iKKyO8+DvoTHAQWksdaKitanGWSilnry
v/Lw27bW5ZZej19Lp680Ujp702l0pq6lO6w0H5K+s/rP3LcubZvHHTl1Op3fAc9NOIvnQboXPpVW
1pXjh4Py5cfsx5vfwWfC+cstO3T6fcOh+EHppDQ1P5twNotLVnKOyC+pHnxe7Zt2Yxx35dur1NeI
OAHV4xI6J0VV01WjQox1pyeXBcW+CW9i3S4493gei61XC+CrAasbTxE++cuL4Qj+W13OPtPd46UH
nDSGkKulasq1aTlObu2/1s3JbkdpNPDbsMtoQehugnRCn0YovSOPtGajeKl/Zx4v7T4bVs2uxyyy
34e3p4dvmjlnTTpfU6V19bONGF1Th739p+rZze8cdPP1M+8VmhQ9KXYv1+t7y26c5B03oJ0NfSKp
46sn8mg8/tvbb7u973te5Lnllp36fT7vgLF4QumyingMI7Rj5NWcd32I+/u4kxxb6vU9IOMWtyt3
R+MvZ1+b0eUSmhNC1dPVo0KKu5Z57lvlLgl+Szd3LdNY493gd+0hi8P4O8GqNFp1Wr6zWbby15Ls
tGO+1soqTXL2nttnTg4BisW8W/HVrtSbcYN5zb2yk+HF5Xtqxsl5PV4rdjIwqKpZeViZZWX9n7lJ
LqVNL63mj8x3rop0codCMNLF4ppVNW85P0V9Vb8+G1vuXK3b2YYTCbo5L0l6R1Ol1V1Zt08LTfkx
38uub7orldvpJp5s8+/4CvtrEJVKi1aEcoQW2T4LnvnP/lmJWB0DoP0Ql0lqLF4qNsPDKENilbcl
9Rb+LvteszGV07dPp93miZ6e9L41F4inZ0luX9o1x/42n/G1ZeSmyYxvq9T0HK/3X7RiPLnPOEHv
+1JborcvStbzUdHm++jEvFftOI8uc84Qfpfal9lbl6WzYmD76MhG37VifKcs4Qe2b4vhBbMrXtqq
1m4j76Nwj4++KxTvFvyY7HNrcrbILY2skvJWewv30bpwekW8RiHalHLLK9tkILYsuyKze5OHPmja
UtMzc5tU6NNJO3mwjujFb29y2yd23tavCe0Mk5aYnGjRWpSgm0m8or0pzfH6z6klZJDg9obxFbx+
rhcKm4Nrd5VSWxNrh9WO5c22FvugViK0dFQdCk1KpJWq1Fs+5B8PrS9J5LyfOhfANTgtARU5f8Uy
V4R/u09kn9t+ivRXlPO1nJ7PxAsFhI0o/KcRnC71IXzqS389VelL8Kzd0JPWjKVKpp2rKrVkowik
5zt5MI7Ekl3RituzZmnB7Q1icRLSs4UKEGqadqdNZtt7ZS4ye97FsVkkUt34gNjMRDRsHhqDUpSy
rVF6X2Iv6i3v03nsSItuvALhqS0HBV6iTryV6UH6K3VJL/BF7fOeVtZyT7IbYDA/LnKvXk1Si71J
7ZSbz1Y32yl6s5PJDaSb80ZiK9TTtWNOnGy82lTjsiuHvlJ7XdsnBb3BxjsTDR9N4Wg1K/72ovTa
9GP2E/4nnsta6W3XiAmDox0NTjiaqTqSzo03/wArJL6q9Fek8/NWYnjz+AZYHBz0zUlOpK0V5dWr
LOyvm3xb2JbW8hwkncN6T0j8ucadKLjRhlThvz2ylxlLe+pLJIsMrsSVV/7NwdNf8VTVpv8Auov0
F9t+k/RXk7bk5a9n4hjonRsKqeIr3VCm87bZy3Qjze9+is+F1rOOPrQLF4mrpysrRvJ2jCEVlFbI
xiuC/N5jgt7hJ4+tHQ9N4Si05y/f1Fva/s4v6q3v0pckictXx4/EC0VgYUYPF4hXpRdoQ31Zrd91
bZPhks2KmM9aGNSpX0/iL5zq1HZJepJbkls3JIvCecqJLSeKho6n8joNSV061RenJeivsR3fWflc
CNW68T5hOicFTw8HjMQr04u1OD/tZrd91bZPs2sVMZrzRG1atbTle7vOrUlZJb28klwS2LckXhn2
qJfSmIhoum8FQak7p16i9KS9FP6kf5pZ7LEbvjxPmA6G0dDVlisQvoKbso7HUnuguW+T3Lm0LTHH
1oj8bi6umKzqTznNpJJbNyjFcFsSDNuxPY+S6P0nhIO9ea+nkvRX90n/AI+Ly2InLd+z4/ER2hdF
xx0pVKr1aFJa1SXLdFfalsXfuLWMZsN9MaTlpapr21YRSjTgtkIrYl73veY1oyy2JqC/2Xoa3/JX
Wj5PGlTe/lOS2b1HPJsnLfs/GiA0Voyel6qpQstrlJ7IxW2T5L8jVrGOOw+07pOGJ1aFC6w9K6gt
8nvnLnL1KyJIuWXpOA70NhoaKpfL6yTs2qEH6c16T+zHa+LsiVrGa835CtTnU0lVu7zqVJdbcmzT
nyLNpirHQdH5BSac208TNb5LZTT+rHfxl1Enl0y+z4/EU5orkEWAMAMAENAGgDABLQAkAQ1YqBLQ
AgAS0AJZQIaAENXCBAAlooENACGggQwBDQANoAQ0UA2gAbQANoAG0EA2ADaKAbQAGYFgbQRSABLQ
AkAQ1YA00VAgKMANAGBBoAwA00AaCjQQaACIDLYBsKMRAKKg2FH/1PoK0el8h+VTQBgBgBgBgBoI
NEBpoqjQBgBgBoIMKDADCA0QGAGrFUaANBBhQYAYAYAYQGEBoINFBpoA0FGAGAGAGAGBBoA0AYAY
AYAZYA1YA0VRoIMCDADADRFCGUGBBgBgBgBgBoijADADADADLACbAGigwIMAMAMAMAMAMAMAMAMA
MAMAMAMANEBlgDQBgQYAasFGrFBgBgBgBgBgBgBgBgBoAwINAGAGAGAGAGEBqwUasUGgDADADADA
g0AYAYAYAYAYAYAasFGrAGgg0AYAYAYAYAYAYAYAasVRoAwAwAwAwAwAwAwAwAwIMAMCjADADADA
DADADADADADADADVig00AJIDADADADADADADCg2AYUGAGAGAGAGAGAG7EUbsAbsQGBBgBgBhQYUG
0RRsAUEGwo2AYAKRAKKDADaChZEGFBsKFIgMCBRWgpEQbQBsqhSIgURRiKBZAbKBaANkApBQoINh
QsINhQtAGwBSIDZQLiQCig2iKFhBtFUKIgwA2AYUGwo2iA2EGAGAGwo2FG0EGwgwAwAwAwAwAwAw
AwAwAS2RRooNBBgBgBgBgBoIEBRgBgBoINMKEgGggwATIASAYAaYQJYUaAMANBBhQYQGAGwoUggU
FG0ALAFoKFoAIALIoIgBaACRCgsQAqCgqADIgCRACxCgsQAqCgqIAqACxCgsQAqCgqACoigqACoK
CxACxCgsQAsQoKgAqIoKgAqCgsQAsQoLEAIgoJEAIiAIgoIgAgAsKNgCkAKCDYaCggxoASFGAGgg
wIMAEBoaCDAg0FCGAYEA2ADaAByKgHJAA2EA2gBDVwgE0ACZUAZIAHJBAKSABMIBtAAmggQygHJB
ANoAG0ACkggFIAHJACGgBDABsqAbVgAbQQIauEA2AIaCBDRQICBDQAhoAQAIasAJaAEMAQECGigQ
0AIYAhoAQ0ADYQDaAENAA2UA2gAbQAhgA2ggGwAbQFhLVwKQUCGggQ0AJZQIZAIZUCbBRoIMANEB
oIMANWCjYQbChaANgCkFC0AFQAREAVBQRABIgBYhQeIAaIAWJFB4gBYhQaJAGiAFiFBogBohQWJB
KNEKg0QAsQoKiAMgAsQAsQoKgAyIoLEALEKCoAMiALEALEKCRAFoAIFBEALQAuIASIAoAwgNhoLK
yNkUYFGwB/gcE8U7vzVt+BLWscdh7pDGqmvFw6nb2CRrLIQJpxBsNhnipaq7XwI3JsTuJxEdGw1I
ed+s2Z5dLe0VecnJ3e024BMabqtRirthYLRThDQ1PWlnJ+t8FyMcu3siqYrESxUnKW1mnG3YaMqC
1aL0csHHx1XJpXV935/raZtdscdeRX9K6SekJcILYve+ZZHPLLYh5FYE7oTQ3y1+Mmvo1u+t+XHu
Ja6YY7BdP6a8ZejSfkrKTW/kuXt6tqRc8vQUyRpxD7RmjJ6UqakckvOfBfrYS3S447Fx0rpKn0ep
KhR8+3dzfPh8DMm3bLLt8QcyqTc223dvazo8wTSoSxMlCCvJuyQWTY6bhcNR6I0HUqZ1JbeLf1Vy
4vt4I58vRJMIOY6T0jU0pUdSo83sW5LgjpJp58rsRcisjo/Rbo3HDL5XibKyvFPcvrP3cNpi16On
hrzRWOlPSWWmp6kLqjF5L6z4v3LcXGac88+4U2RtxFo6LdGJaeqa07qjF+U+P2V73uXYZt06YYdw
tHTDpRHR0PkWEtFpasnH0V9Vc+L3bNuzOMdepnrxBx2R1eUO9GaKq6YqqjSV5PuS3t8v1tJbpcce
4dnxWJw/g7wihC0q09l9spfWfCK3Ls23Zy9p67Z04OC47GVNIVJVasnKcndt/ruW47R4rdhiouTs
s2wg7t0T6M0uiVB47G2jU1b5+gnuX2ns9S335ZXb2YYdnmjlHSzpRU6T1tZ3jSjlThwXF83v7jpJ
p5s8+4VJlcx0voB0GenJLE4hWw8Xkvrtbvure9+zjbGWWno6XT7vN4D7wh9OVi74HCO1JZVJL0re
jH7K38dmzbMcV6vU34g40zq8onejnRut0mrqjSVltnPdGPF+5b2Zt03hh3Udx6Q6cw/g4wkcJhEv
HtZb2r7ak+L4Lf1Kxzk7nrzynTmoPNtevLEyc5tylJttvNtva2dnh5GUaMsTJQgnKUmkks229iQB
6R6OaBw/g4wksZi2vHtZ72r7KcOLe9+5XONvc92GM6c3RwrpN0krdJ67rVXZbIQ3RjwXve99x1k0
8mefdRXisDsvg46BrHWx2LVqMc6cH6VvSf2Vu49W3nlk9XS6e/NDDwi9PHp2TwuHf7PF5tf2jX+V
buO3ha446Z6vU7vE4HKTbzi19EeilXpXX8XDyacbOpPdFfF7l27EyW6dMMO6jsfTHpRR6EYeOj8D
ZVdW2XoJ+k+M3tXe91+WM35erqZ9k1B5zlJzbbd2822dnhB8JhKmPqRpUouU5u0Yra2Fk2PSOi9H
4XwXYJ167Uq81Z22yluhHkt77XuS429z3STpTY8+6d03W6Q15V6zvJ7FuityXJfntZ1k08WWVyux
EFZHcvBz0HjSitI41JRitanGWSss9eV92+P8XA5ZZej19Lp+tFU8IHTiXSap4mi2sNB5fbf1ny+q
u3a8tY46c+r1O74Ci0MP6UuxfH257s3la+3KQXfoj0Vn0prWzVGNnUl67K+97k/vSytF4yunXDDu
HR+nHS2HR2ktH4K0ZJWnKPoJ7lxm9re1Xvtd1jGbdupn2+IOE7OTX8vxk/V1+b1eMOcDgamkakKN
KLlOTtCHHnLlv6uW2LJseiMJhsN4NcE6lRqVaXnS3zluiuS3LtyOXtPdJOnBwnS2lammKjxGIz1n
enT47rvlu4u2qrJXj0k08eWW/NDaKnCeXlYiXUlTSXcml1KmlxXk1PzHaug3RSnoSk8biLKy1k5Z
ZLPWd9i3xW1+c89VR55Xb19PDt80UHpb0ol0tqN3cMHSfkrfJ8bb5PctkVt331Jpwzz7/gKm2q6V
SqtWjG6hBbZPel/mm/bZGnMXTod0QqdLKqr4hauGhkorK6WyMeEeL2vPNttrNunXp4d3mi/dOull
PQlL5JRte1tVZJJZWy2R3O23zV6TjjGbdup1O3wOJfu/2jEeVOWcIPfwlJboLcsr7FaJ1eT76Npe
L/acT5c55wg/S+1LhBbllrWsrJNoffRijf8AasV5TlnCDyc7ZXdtkFsyte2rG1m4l++jIR+U3xWK
d4N2jFZObXoxtsisk2sorJZ2QPvo3CD0m3XxD1aMbLJW2bKdNfpRXlO72w580btLTMru1OhTX4ac
eC4yffJ58WrwntDJylpaUaFCOrSjdpN985vZe217EslkhwvPiDeIrppYXC3lFta0kvKqy3ZbdX6s
e157IW+kBK1SOhoulTadaStUms1FPbCL9UpLb5qyu5OTgKoUloSKq1EnXkr04PNQT2TkuP1Yv7zy
spOT2QjCYVVE8ViW3Tu9/lVJbWk/8Uty5tIEnrRkY1OkFVyk1GMVm9kKcFwW5LYltb4tjg9oaxmK
+WauHw8X4pPyY+lOTy1pW2ye5bIrJb2xbvxA5xFWOhYOjTadaStVqLNRW+nF/wCOS2+avJu5OVv2
RmCw0NGQWJrpSlLOjTfpfbkvqLcvTeWxMnJJrzQHC4aemqk6tWdoLyqtR52v7W9kYrbySdrwkncM
x2Mek5Qo0YtU4vVp01m7ve+Mpb32LJJDRbsPMVVjoOEqFNp1pK1aa9Fb6cX/AI2tvmrJO7lb9nwB
aPwcMJTWKxCvG/0VN/2klx+wvSe9+St7Qk15obU6dbpDXbbvKWcpPKMYra3uUUvcluReE85UF0nj
4OKw+HuqEHe7ydSX15f5V6K5tkhb6QPqEF0cgqslfFTV6cX/AGcXsm/tP0Fu857hy1Ps/ER2jNGv
SUpTqS1aUPKq1HnZe+T2Jb3yuxazJsb0ppL5wlGFOOpRh5NOHBcXxk9snvfJIkMrsStR/wCzVNwX
/Fc1aT/uov0V9trzn6Ky2t2ctez8RG6J0YsXrVarcKFPOct74Rjxk93DNvJCs4zYFpPSMtK1FaOr
CK1adNbIx3JcXvb2t5gt2JjESXRqm6Mf+KqitUl/dxfoL7T9N7l5PEctX7PxEbofRaxrlUqtwoU8
6kt/KMeMpbF3vJCs447AtK6SlpSadtWEVq04LZGK2JcXvb2t5lkMrsTc/wDkWKWqv+K6sfKe+lB7
uU5LbvjHLayct+x8REaH0V85zes9SlBa1Sb2Rj729kVvZbWMZsL0xpRaQlGNNalCmtWnDguL4ye2
T49RIZZbEthYro3SWIl/xTUX0MX6EX/aPm/Q/i4DlqfZ8+ogdHYCppeqqcPOlduT2JbXKT4La2Vi
TYkdNaRhKMcLh/8Aiem9ux1J75v2RW5EjWV9JwD6HwkMBT+XYhJxTtRg/wC0muP2Y7ZcXkKuM15o
gq1arpWq5SvOrUl2tv8AVkgxvYsOlKkdBUngqTTqys8RNcVspp8I+lxlyViOlvb4/ERmg9ErSM5T
qvUoUlrVZ8FuS+1LYl8C2s447+ABpnSr0tV1ratOKUacFsjBbF8XvYkTLLYnMFFdGaCxMv8Aimqn
4hfUg8nUfN7IdrzJy3Pszfr6ClyvJ3e005BIBgAloASAYAaaAEWAMAENACQBLRUCWgBAAloAQyoE
NBQloIEACGUCGgBDQQIYANoAQ0ADaKAbQANoAHJAA5BANgA2igDNAIERGiWigSAI2AGmrgCCgQ0E
GgowAwA0EGgDADLACbBRoIFxAlKCowAUEGwDAo//1foQel8h+VRLRAJKDADADADADQQYQCbAGiqM
AMANBBhQYAYQGgDCAywAmxVGggwoMAMAMAMIDCA0EGigywAkKMAMAMAMAMANFQaIDADADADADLAC
bAGFBoAwIMAEMKNAGBBgBgBgBgBgBoijADADADADADVgDVgDRQYEGAGAGAGAGAGAGAGAGAGAGAGA
GAGrEBoAwIMANWCjLFBoAwAwAwAwAwAwAwA0AZYAwINAGAGAGAGEBqwUasUGAGgDADADQQYAYAYA
YAYAYAYAasFCQDAg0AYAYAYAYAYAYAYAasVRoAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwA
wAwAwAGAYAYAYAYAYUGwDCgwAwAwA3YgMsAbsFG7EBlggwAwAwAwAwAwAwoMKDZFG0AKKgURRgBg
AtAGwDADaChZEGFBgULRAYAKKDaIBSANlUKRECiKMKBZAYALRQbIBSChYQbChaCDYUKQAoAUiA2U
CokAsoMQAsgNlULIDAgwA2UGBRsgFBBgBgBgBsijZVCkEGBBgBgBgBgBgBgBgBpsihIBoqDADADA
DADABLAEgGAGAGgg0woSAaCDABDANAGAGggQFGAGAGioMANMgMQAoKNoAWAYAEAFRChaACABEALi
RQtABEAFiFBYgBUFBUQBUAFQUFiAFiFBUQBUAFQUFiAFiFBYgBUQBUFBUFBUAFiAFiFBYgBYhQWI
AVEUFQUFQAVABUFBEAEQUERAECgiACIAXEKFACkAKCDYUKQBgQaaCjQUYEGggwA0woSFGggwIEsK
EgCZIIBtAA2igG0EA2EA2ADasADkggEwATRUAmgATCATQQCkgAbQQDZQIABtBANgAmgATQQDaABs
AQ0AIaCAbVyoBsAQwAbQQIaCBBQIaAENBAgAQ0AIauAIAENWAEtFQIZAIZQIaAEMAG0AIaABsAG1
YIENAA2gAbRQIaABtBANgA2AIA0RJFAlhAgAQwBDQAhlBoiDTRQJAMANEBoIMANgG0FC0AYALRFC
4lARABYkASIUEQASIAWIUGiAHiAFiRQaIAaIUGiAFiQBohQaIAWIAaJFSioKgyACxADRIoKgAqAD
RCgqACoigyACxCgsQAqACogDRCgiAFoAIFC0AEiALiALQAsAwA2RoLKyNoijAoeYPCvFStu3sLJs
SuNxSwkfFw2+z8zMdMrrwK88zTiCUaLryUY7QSbFgqThoqFlnJ+vn1GeXb2RWak3VbbzbNOIHquT
strKgs2Gw8dFwc5+d+skY5d5O0VrGYqWLlrS7FwNONuwyZUFj0To1QXjqmVs0n7X7jNrrjj6iM0t
pN416sfMXr5lkZyy2IKRXMS2idEvSEtaWVNbefJe8lreOOxI6c0uqK8RRytlJrdyXvJI3nl6QUhm
3AOMDgJ6RmoQ7XuS4sb0smxdsZi6XRqiqdPOo9nX9Z/rkY5d7eyDmterKvJyk7ybu2bea+QCNN1W
oxV28kig6VozR9LozRdet+8az5fZXPj8Dnbt6MZ2eaOeaX0rPS1TXnkvRjuS/W1m5NOGWXcIaRpg
Xvot0aVS2JxCtBZxi9/2ny4cduzbi13ww9aI3pZ0melH4mk7UU839Z8erh39VxmmepnvwKLI04ic
6O9HZ6eqW2U4+fL3Lm/VtJbpvDDuF56T9IYdH6SweEsppWbXoL/hP89piTbtnn2+IOMzz2nV5ATB
4GppKpGlSWtOTsl+t3EcLJsdpp08P4PcJrStKtPvnLguEV+s2cvaevx04OH6U0lV0vVlWqu8pdyW
5LgkdZNPHldiKkVkdo6F9EoaGh8vxtotLWipegvrP7XBbuvZyyy34evp4dvmig9M+l0+klXVjeNC
D8iPH7T58OC7b7xx049TqdwozNOIvXQjoXLpJU8ZUTWHg/Kf1n9Ve97uszllp26fT7vgLZ0/6aRw
UXo/BNRSWrUlHJRSy1I29fDZxtnHH1der1NeIOGM6PGJPQ2ha2n68aFFXk9r3RW9vkvy2jem8ce7
wO/Y/G4XwX4JUqSU681dX2ylvnLhFbl2Lezj7T2WzpQecMdjamkqkq1WTlObvJv9dy3I76eG3YaR
g5uyV29iDI9E9DeidHoZQekMe1Gqo3z/ALNPcuM3s/lW+/HK7e7p4dk3RyHph0sq9K6+vLyaUbqn
DguL+09/duOmM082fU7xUrGnMdR8HvQN6fmsTiE1hovJf3jW77q3vfsW+3PLLT0dLp93m8CY8I3T
pYi+AwbSpR8mpOOyVvQjb0Vv47Nm2Y4tdXqekHFtU6vKJ7o70drdJa6oUVzlLdGO9v3Le8jNum8M
e6jvOnNMYbwa4OOFwqTryWSebu9tSfuW/Ysllyk7nsyynTmoPN+Iryxc5VKjcpybcm9rb3nZ4bdh
FKi60lGKbk3ZJZtt7EgD0d0W6OUPB/hZY3GteOcc9+qnshHjJ732bE2+Vvc9uGM6c3RxPpT0mq9K
a7q1MorKEN0Y/Hi9/VZLpJp5c8+6itlcx1vwddA/naSxeKj9BF3hF+m1vf2V63lsuYyy09PS6e/N
G/CN07+dm8HhX9BF+XJem1uX2V63nssMcdHV6m/EHMKGHS8qXYvj+ub3KW3AWfo70eq9Jq6pU8ks
5zayiuL4vhHa3m+WbdN4491HY+kunqHQLCxweE/fNZb2r7Zy4ye7v2JJ4k7nqzynTmoPPVWo6snK
T8q93J52b9snx/1XV4gTDYaeLnGnTi5Tk7Qgs9u9/rm7LbCTY9DaE0NhvBzhJYrFSTryXlS2u72U
4e/jtdksuVvc9uOM6c3RxrT2navSCt8oxCu3lRorNJPZfr75vhGx0k08uWXd5v4CMipxm1F61d+d
K6tBLg9iaW17IrJcVWR1ToD0PhXXymqvoFmr5eNazu77KaexPzmtaWSSWMq9HS6fqI3px0t/2gbp
U5OODpuzkttWS3R5LuXnP0UMZpOpn3fAc9k1WSq1lq0llTprLW6uX1pbW8s3s24Cz9F+jNXpTXU6
qtBJWjsSjuy3R4LbJ3s/OlHNunTDDuHV+l3Sql0OoLDULOs4+Svqr6zt6krcrIxJt6Opn2eIODyf
i38oxPl1J5wg9/CUuEfqx9LlHb1eP76NW8V+0Yny5zzhB+l9qXCPBelsVo5g++jcY2/acV5TlnCD
yc7ZXdtkFsyte2rG1m4l++jcY/Kb4rFNuDyjFZObWWrHhFbG1klks9g++jcIPSbdeu9SjHLJW2bK
dNcfUl5Tu3nDnzRlpaalfKlQpL8MI+1yffJ+q8J7Q3OctKyjh8PHVpRu0m++c3svba9kVkstrhef
EGV66ivkuFvJSaUpJeVUluSW1Rv5sdrflPOyjC30gLVqLQkXTptPESTU5rNQT2wi+O6Ul91ZXbcr
7I3QoR0PFVaqUq0lenTexLdOa/wxe3a/JspOU4CcLhvlWtisVJ+Lu7u/lVJbdWN9/wBaWyK4tpMS
b80a+l6QVd0YxXVCnBexLtcm98nm4PaGY3GKqlhsMn4pNbvKqS2a0ku6MfRXFtti30gdVJrQEXTg
74mStOS/s09sIv6z2Slu81b2OV9n4geBwcMHBYnEK8X+7p/3jW98ILe/Sfkre0JNeaB0aVXT9aU5
ySSWtUm/NhFZbt26MVtySQ4T2hmkMesSo0KCaoxfkx9KUnlrSttk9y2RWS3t0t34gfVJLo5Fwjni
pK05L+yT2xX236T9FeSs72nK+z8Q00bo+Cg8TiL+Ji7KKydSX1Y8F9aW5c2hamM9aBzlW6RV0kry
eUYrKMYrctyil3LN72OD2qHWkMXDCU/kuHd4XvUqf3klw+wvRW/znnZItuvEBsFhoaHprE1kpTln
Rpvf9uS+qvRXpP7Kd5ys8efwDHC4Wrp2s25Zu8qlSWyK3yk+Ht2LMcMydwLpXSMKsVQoXVCDur7Z
y3zlze5eisuN0Mr6QP8ADwXRyCrTSeJmr0ov+zT2VJL6z9BPZ5z3DlqfZ8+oitHaPnpeo7ytFXlU
qS2RW9vi+C2t5FZk2C6W0lHFatKinHD076kXtb3zlxk/UslkhIZXfwEnh4Lo3TVaavipq9KL/s4v
+0a+s/QW7znuJy3Ps/EQ+jdHT0xVcb2WcpzlsjHfKT/Tby2st8MSbDnS+ko4hRoUE44en5qe2T3z
l9p+pZIRcsvSCQwFKOgaccVVSdaavQg93/HJLgvQW957ETlZ9nz+AhcJhaumq2pHyqk22232uUnw
W1svDEncJLS+Pp04LCYZ3owd5T2OpP6z5LZFblntZI1lfSBeicFTwlP5ZiVemnalTf8AaTX+RbZP
8O1irjNeaIjEV6umKzlK86tSW7a28kkvUkXhi3uE9pGrHQVJ4Ok06sv+KJr/AJVxfBek97y2Izy6
X7Pj8RH6F0Usc5VKr1cPSV6kuW6K+1LYu/cW1nHHYDpfSj0rU1rasIrVpwWyMVsS973vMQyy2JvD
R/2YoqtL/iqrH6Jf3cH6b+09keCzJy1Ps+fUVzAYCppWrGlTV5yf+rb4La2ac5NiW05j6cIxweGd
6FN3cv7ye+b5borcuszI3lfSDWg9G01GWLxK/Z6T83+8nugvbJ7l1i0xnrRDaS0jU0rVlWqO8pPs
S3JckskajGV2GIQJaAEgGAGmgBNgDQBq1wBLQBoAQ0UCSASyoEtACABDRQJaCBDChDRUCGrkAhlA
gAQ0EA2gBDQAhooBtAAmgAbABtAA2ggG0UA2rgAGgNEkQIKBLQAkAQ0AJKDQQasAaCjADQBgQaAM
AMAMSsFSlARtIINgGwowA//W+hB6XyH5VMAEtEAkoMAMAMAMANBBgBqxAJKowAwA0EGAGFBgBogM
IDADViqEhBhQYAYAYAYQGAGiAwqDQBqwBoKMAMAMAMANFQaIDADADADADADLAGrACSgwIEsKNBRo
IMCDADADADADADADRFGAGAGAGAGAGAGrAGrAGioMAMAMAMAMAMAMAMAMAMAMAMAMANWANWIDAgwA
wA1YKMsUGgDADADADADADADADQBgQaAMAMAMAMIDADVgo0UGgDADADQQYAYAYAYAYAYAZYAS0FGg
g0AYAYAYAYAYAYAYAYAZYoNWCjQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgAhgGgDADADC
g2UGAGWAN2IDdgDZAYAYAYAYAYAYAYAYAYAYUGAGFBgBsgFIKFBBsKMAMAFoA2AYAbQULIgwoMCh
aIDABRQbRAKANlUKRECiKMKBaIDABaKDZAKQUKCDYULQQKCjaAFgG0QCig2gBZAbKBZFGyoFIijY
QYAbAMKDYUbRAbCDADADADZFGygUAYEGAGAGAGAGAGmyKEgGioMAMAMAMAMANBAlhRoAwAxgGggS
wo0AaCDABDANAGACWECQowAwA0VBgAgihSANhBsKFoINhQqIAtBQRAC0AEiALiRQRAC0AGQUEiAG
iFBIkAVBQVABUAGiFBIkAVABUFBUAFQAWIUFiQBYhQVABUFBUAFQUFQAVBQWIAWJFBYgBEFBUAGQ
UEQAQKCABEFBIkASIAuIULAFIAUEGBQpAGwgwASwowKNBBgQYAaaChIBoIMAENBQkAQwgG0ADaKg
HJAA2ggGwAbCAUkACkioBSQAJoIBNAAmggG0EA2gAbRQIkggG0ACaABSCAckADkgBDQAhgA2rFQD
aCAbQAhhAhoAQ0ECGigGAJaAEMIEACGgBLVwAYAhqxQJaCBDABsAQ0AIaABtACGgAbQQDZQDaAEN
AA2ADaCAbAENAaJABsoEtBAhgCGUCGQCSoMIDQAmxQaANEBoINhQpACgDaChYAqIARABYkUEiAEQ
ASIAWIAaIUGiAGiRQaIAaIUFiAGRAFiFBogBkFBokEoqAgyCgsQAsSKCoAMgAsQoLEAKiKDIALEA
LEKCogDIAKgoIgAiACAC0FC4gBEALQAsAwA2RoLRWRtEUOMPh3iZaq7XwDUmxOV60dHQ1Ied+s2Z
5dbe0V2UnJ3e004jcKbquyzbALFGMdFwu85P1v4GeXX2RXK9Z15OUtrNOW9gO0rIseCwkcFHxlTb
bu/MzXbGa8iCx+MeMlfctiLI55XYj2VkTmitGeM+kqeati48+oza644gGl9KfKXqQ8xbXx/ISJnl
sV9mnMPtGaMekJcILa/cuZLWscdia0vpOOAj4ijk7WbW5fH9bSSOmWWvEFHkbecLw2EnjZqEFdv1
c2RZNi81KlLoxRss5vvb4vkv1mZ5d/Yg5zisRLFSc5u8ntZuPPbsNbazstoQdD0PomGg6bxGIynb
+FcFzf5GLdvRjj2+aKTpvTE9Lz1nlBebHh+ZuTTjll3CBkVgXHox0b+XtVqy+jWxfWfw9pm11ww3
5o10r6S/K74eg/o1lKS9LkuXt6trGHUz34g59I24CV0JoSppyrqRyivOluS+PBe4lum8ce4dD07p
ml0UorDYZLxluvVv6T4t7u/ZZPEm3fLLsmoOMVZuq3KTu27tva2dXkCaGGni5qnTTlKTskt4JNjt
Gj8DQ6B4Z1qzUq0lnba3uhHlxfa9yXK/aeuSdODjWmtMVdN1nVqvN7FuiuC/We06yaeTLLuEKysj
rPQjofGkljsWkoxWtCMtiSz15e7v4HPLJ6en0/Wis9N+mMtPz8VSbWHi8vtvi+XBdrz2axx059Tq
d3wHO5G3AW3oh0RqdJqud40Ivy5/5VzfqWfBPFy069PDuHQ+mvS2n0cpLAYG0ZpWk4+guC+0972r
bteWMcd+XfqZ9viDgcszq8YdaO0bV0vVjRox1pydkve+CW9jayb8D0HCGF8F2Cu7Trz75y4LhFfr
NnH2nt8dKDzxpXStXTVaVetLWnJ9iW5LgluO2tPFll3CLaKyO/dAuhcNB0/nHH2jKK1oRlsgvrP7
XBbvvbOWV29nT6fb5o53046aT6VVdWN44eD8iPH7UufDgsuLescdOPU6nd8BRDbiOg9BOhE+lFTx
lS8cNB+U/rP6q973Lm0Yyunbp9Pu+AvHhA6bQ0bD5uwNo6q1ZyjkorZqR58Xu2bb2zjjvy7dXqa8
QcGOrxiU0Poetp2tGhQjecu5Le29yX6zJfDWOPd4HoXE4jC+CzAqELTxE9l9s5fWfCK3Ls2ts5e0
9ts6UHnPSGkKulKsq1aTlObu2/1s4LcjtJp4bdhmlcIPQvQfohT6LUXpHH2jNRulL+zj/wAN7LbV
s2s45XfiPb08O3zRyzpn0vqdK61840Yfu4f5nzfq2c30xx08/Uz7xTDTkOkdAOg8uklTx1ZNYaDz
3a7XorlxfYs9mMstO/S6fd8BaPCL04jTi9H4JpQitWpKOSsstSNt26VuriZxx9XTq9T0g4/Roamc
tvs6/wBcs3kdXl0JzQ+iK2nq0aFJXk9r3RS2t9V+y62zZLdN449w7npHH4bwa4ONGitavPzVvlLf
KXL/AE4s4ydz12zpweeMZjamPqSrVZOU5Pype6Px92b7PFbsBpUpVpKMVeW5bo83z/XIqD0L0T6N
0OhmHljcW7VNW8pS2xXBLi+G2/PJcLdvdhh2TdHLOlHSOr0irqc4t7qFDbqp7JTW9vbbflfyUlLp
Jp5s8+6/lBXoRlrSUJKVV3dSq3lFb7P1OW/zY3T8qsC/9B+iC089eSawkXm3k60lu5RXDszeaxld
O3T6fd8BOdO+lsKsXhaL1cPHyZyjk5tf2cOEV6Uti2Z7JTGN9TP09ByWbUkq1dWja1Kksrr2qF9r
2yd7O+tKPR5viJrQuhK2na8dZa1SaTjB5RjD60kvNgvRirOWSWTzlum8ce6jsendNUPB9hVSpeXi
Jq6vtb2a8rbEtiSyyUVZLLnJ3PTll9XPvHCq1R0pPEYl+Mrz8pRlnt2SmuH1Y71ZvybKXV4/voTb
5N9PiPLqz8qMJZ7dk58vqx9La/JtrDjzRij4v9pxXlznnCD2y+1LhDhvlsVlmi/fRuMPG/tWKbal
5sdjm1lZW82C2Nrhqxz80ffRuMHpFvEYh6tKPkqyte2yFNbMt+6Kzd20nE580bSlpmWs7UqFNfhh
HguMn3yeb3tXg9oZKUtKyjQoR1aUbtJvvnN7L22vYlkgvPAyvXSXyXC3kpNKUkvKqS3JLao382O1
vN52UYW+kBalSOhIunTaeIatOazUE9sYPjulJfdW9tyvsjdChHQ8VVrJSqyV6dN7Et05rhvjH0tr
8myk5TgJw2G+Wa2KxUn4vWd36VSW3VjffxeyKz22TEm/NGfS9IKqSSjCKyWyFOC9iW95uTe+TzcH
tDWMxsZRWGwyfirq7t5VSW5tcPqx3c22wW+kDuUl0eTjHPFNWlJf2Se1L7fF+jsXlXs5X2fiA4DA
ww8FicQr0/QhsdRr2QXpS/Cs9hJPWhMIVukNZyk0rK8pPKEILq2RWxJckrtjg9oZpDHxnFYfDpqj
F3z86pL60v8ALH0VzbbQt9IH2XRuP/dXJf8AJlP/AJyP+Rfa81y17PxDLRujo1069duNCLzfpTlt
1I8W972RWb3JrUk9aNYivV09WjCEeEadOOyK3Je1t7XdscFvcHmMxMNFU3hqDUpSyrVV6X2Iv6i3
v03ysTkt14g1o/BwwdNYrEq8f7Kn/eNb39hb3vfkre0JNeaGkY1+kOI+tUnm28kkt73KKXYkhwnn
Kh1pLHQoQ+S4Z/RJ3nPY6slv5RXox7Xm8rItvpAbA4aGiaaxVdKUpZ0aT9L7cl9Rbl6T5JkJNeb8
hHUKFbT9d561SbcpSk8kt8pPcl6i8JJcqHmlMfCEFhcM/oYu8pbHUl9Z8l6Mdyz2sRq30gPo/Cw0
VTWLxCUm/wBzSfpNenL7C/meWy4JNeb8hGU6VfT1e2c6tR3bfrb4JdyQ4Z85USOlMbTwtP5Jhnem
nepU/vJL/IvRX4nm8ouV14g3orA08PT+V4lXpJ2pw31Zrd91ek+xZsUxmvNEZicRW01W1pXnUm0k
kuxJLhuSLwzb3UTekK0dBUpYSk06ssq9Rf8AKuL4L0n6Ty2InLd+z4/EMNDaKjjNarWbjh6ec5b3
whHjJ7uCzYtTHHfwANLaUlpWprWUYRWrTgtkYrYl73veYhldicpr/Zakpv8A4sqx8lb6UH6T4Tkt
m+Kz2snLfs/EQGjNG1NLVVThvu5SeyMVtk3uSLtzk2JHTOkYTjHDYe6w9N5PfOW+cuvctyyJGssv
ScA+hsFTwlN43EK9OLtTg/7Sa3fdW2T7AYzXmiExeKqaUqupNuVSb729iS9SXYXhi3YseNkujVF4
aD/aai+nkvQi/wCzT4/X7icut+z49fUQeh9Ey0tV1b6sIrWqTeyEVtb9y3strGOOwfTulY6QlGnS
Wrh6S1aUeW+T+1La+4SGWW/gICwYGig0AaaAEhRoIMAEtBQkIMAEtACQBDRQJauAIAEtBAhgCGig
S0AICBDRQIaAENACGgAbCBDQUDaCBDRQDkgATAByABsIBsKBsqAMkQaDZUCWgoQECWgBO0AQ1YA0
UGBBoA1YA0FGAGggwA0AbAlKSAjYBsKMAN2ID//X+hB6XyH5VMAMAEtEAkoMAMAMAMANBBgBogNN
FUaAMAMANBBhQYAYQGiAwAywAlooNFBgBgBgBhAYAYQGgg0UGAGrAGgowAwAwAwA0VBogMAMAMAM
AMAMANNAA2UGgowAwA0EGBBgBgBgBgBgBgBhFGgDADADADADADADVgBNrFQYAYAYAYAYAYAYAYAY
AYAYAYAYAaAMsQGggwAwAwA1YKNFBgBgBgBgBgBgBgBoAwINAGAGAGAGAGEBqwUaKDQBgBgBoIMA
MAMAMAMAMANNBQmwBoIMAMAMAMAMAMAMAMAMAMAMsVRqwBoAwAwAwAwAwAwAwAwAwAwAwAwAwAwA
wAwATIASAYUG7AG7AG7AG7EBgBgBgBgBgBgBgBgBgBgBgBgBhQYUGAGAGAGyAUgoUEGwowAwAWgD
YBgBtBQsiDCgwKFIgNgCig2iAUAbCjaCBRFGygWgDCAUigUQG0FC0EG0FCkAKAFIAUAbQAsA2ALR
AbKBSIBRQbIoUAYEGAGwDCg2RQoIMAMAMAMANhQpAGwgwAwAwAwAxuxFCADRUGAGAGAGAGAGAGgg
SFGgDADAg0AJCjTANBBgAMAwAwASwgSFGAGggwoNMgEhRsAUEGwoUggUFG0ALACIKCIAXEAWiKCI
AIgAiCgyACRACxIoKgAqCgqADIKCIgCxACxCgqACoKCoAKiALEKCxACoKCoAKgoKgAqCgqACoigs
QAkQoLEALEKCoAIgoIgAiACRIoIgAiChYQbQaCwyMChSANhBgBgUJCjADQQYEGACWFCQDAg0FCWA
DkECGgAbRUA2rgAmECAAbQAJoIBNBAJooBMIBSQAKSCAbQANoIBsoEBANoAE0ADaABNBAMAQ8gBD
QANoIBsqAbAENWAENBAgIBtFAhoASwgQwoQ0ECABDVgBDQAlq4AgIBtFAhoAQ0AIYANgA2AIaABt
BANoAQ0ADZQDaCATQAkCwhqwFIaKBAAhhAloAQwAbKDAgwgNAGgg00VQkgNoAWgDABaIo2UCokAV
ABIhQSIASIASIAWIAaIUGiAGiRQWIAaIUGiAFRAGiFBYgBkFBokEosQIMgoNEALEKCogCoANEKCx
ACxIoMgAqACxCgsSAMgoKgAiACAC0AEQULiALQAQAWAYAbIoWigLRpOs9WO1kWTYsMnHRcLLOT9b
+Bnl29kV6dR1Xd5tmnEJjFydltALFh6MdHQ15+d+skZ5dZO0QWIxDxMtZ9i4GnK3YbMIJ7R+BVFe
NqZb1fdzJa64468iM0jjXi3l5q2L3lkYyy2IyRWBK6M0b8petLzF6/yM2umOOwTS2ktf6Kn5u9rf
yXISLnkK2acg7wOAlj5WWSW18CbamOxYNI46OioeKpedbu5vmSTbple3xBR5vWze004DVKhLEyUI
K7ewEmxeIQpdG6N3nN97fBckZ5d/Yg5/jcXPGzc5u7fq5I24W7DJhkXzQeho6Nj8pxFk0rpP0Vxf
P2dZi16MMdeaKrp3TUtLTyyprzV73z9hqRyzy7hXWacxZ+jnR16Ul4yorUk/4nw6uL7OrNunXDDY
f9KekaSeGw7tFZSkv8K5ce4SLnn6Qc6kbcA90VomppiqqdP8T3JcX+syW6XHHuHSdJ6Ro9DcOqNF
J1Wsv+FL3Ls2IxJt6crMJ4HG8RWliJOc23KTu297OjyXyAQpSrSUYpuTdkltbKg7HobRFHobQeJx
LXjWs99r+jHi3vfuVzlbt68ceybo5Rp/TtTT1V1J5JZRjuivjxe/uOkmnmzy7hXpGnMdL6E9Dli7
YvEq1JZwi/Stvf2fb1beeWT0dPp780MunPTJ6Wbw1B/QRflNem1/lW7jt4Fxx0nV6m/EHMZG3nFh
6MdGKvSatqR8mnHOc+C4Lm9y7dhLdN4Ydw6n0q6SUehtBYLBJKra2Weon6T4ye1d73J85NvTnn2T
UHn+rN1G5N3bd23tbOrxBeEwdTH1I0qUXKcnZJb/ANeoLJseg9G6Pwvgzwbr12pV5Kza2ye6EeS3
vte5Lj7T2yTpQcE07pyt0hryr1ndvJLdFbkuXt27TrJp48su6iDZpgdt8HvQaNNLSGNSUYrWpxlk
rLPXlfdvV+vgcssvR6+l0/Wir9P+nMukk/E0W1hoPLdrtek+XBdrz2axx059Xqd3wHNTbgLp0M6H
1Olda2caEH9JP/KvtP1LN7k85Zaden0+8dS6b9L6fRaitHYC0aijZuP9mv8Ahvbfatu1nPHHfl6O
pn2+IPPTdzs8QeaP0fV0rVjRoxcpzdkl+tm9vchbpZNj0ZhsPhfBZgnOdp4ie3jOX1Vwit77drSO
PtPdJOlB560zpitp2tKvXlecu5LcktyX6zO0mniyy7vIiwyO7+D7oRHAQWkcclHVWtTjLJRSz15X
38Fu27bW5ZZej2dLp680Urp303l0nqeLptxw0H5K2az+s/cty5s1jjpx6nU7vgOem3EXjoT0NqdK
q15Xjh4Py58fsx5v1LPgnnLLTr0+n3DpPTvpjDQFNaNwFozS1ZOPoL6q+0972r7zyxjjvzXo6nU7
fEHEaNDxWb87dy/Pq7M849XjD/AYGppWrGjRTlObskvbfYkt8tkVsJw1Jsd8hHDeDLBXdp4ia3ZO
cluXCEdre7a/KefH2ns8dKDz/pTSdXTFWVetJylN5v8AyxW6K2fHY+0mnjt35DOnTc3lZNbX6MF8
e932XlsqaHdegvRKnoqn8uxS1Ipa0FPJpL058/qx9HbnLM45Zbevp4a80U/pl0rqdIK6p015MW9S
D2R+3O+Wtbc8oLbne2pNOfUz7hSqcb6yhL/e1nfftS32f8Uuq6NOItvRHotLpVPVinDB03ect83w
6/VBPe3eWbdOmGHf8B0Ppt0opaBorB4e0UlqtRydllqp7lulLbtivKu4Zxm3fqZ9viDiNSWpatXS
cml4ulsVtza3R4LbLbsd30eT4iQwOjquNrRTj4zE1LalN7IrdKa2JJbI7LZtatlKWtSb+I7bUqYf
wbYNyk/GYmrm2/OqT9qivV1vPn7T12zpz7xxLSGOn42WIxL18VPNReyHByXFejDYvS4PpHjt9byG
rXzf9LW8uvLNQlnq3z1p32veovbtlllKpwM1FhPp8R5dWflRhLO989efLeo7ZbX5PnF480bjT/5K
cVeTlnCD2z5vhBbMrXtqxtm4w++hUabxl8Tim1T2JLJyt6EFsSW92tFbm7Jk580Yoy0xJ1KjVOhT
SWS8mC3Rit8nnZbW7yb2yLwcjHKWl5KjRWpRhdpN5RW+c5b3xfVFLYhwvIytXU0sLhU3GTSbt5VW
W7LdH6se157Ib9ICVKsdDJ06TUq7Vp1FmorfGD47pSW3YsruTk32hVGhHQ0VVqpSrNXp03mop7Jz
XrjF7dr8myk5OAnDYb5VrYrFSfi7u7v5VSW3Vjf+aWyK4uyYk9aM+l6QVbLVjCCyWyFOC9i4vNyb
3yebg9oZjMbFxWGwyfi7q7t5VSW5tcPqx3c22wW+kDptdHlqxs8U1m91JcF/xzi/Q2Lyr6rlfZ+I
DgcDCjD5Tib+Lv5EL2dRrcuEV6UuxZ7CSetCUq3SKtd2Vlm9kKcF7Ir9XbzcHtDekMfBQ+T4e6op
3ctkqkl6UuX1Y7lzbYLfSB7CK6NpSlZ4tq8Yv+yT9J/b4L0drzsk5X2fiGWjtH/LdavXk40Yvy57
XJvPVjfbJ+pZvIWkmxmMxc9M1I06cbRXk0qUc7J7lxb2t7WyJb3B9ia0dBwdCi1KtJWq1FsS304P
h9aS27F5O1y1b2+ADRuj4U4fKcT+5TtGGx1ZL0VwivSlu2LNhJPWhvUqV+kNdJLWnKyjFZKKWxJb
FFLsSze9l4TzlQ+x2Lho6m8Lh2pX/fVV6bXox+wv5nnssgtuvECdG4GGFp/KsSr07/R099SS/wAi
9J7/ADVnsWkmvNDOUq/SDEfXqzdkls6luUUuxJDg9qiQ0hi4aOpvCYd6yf76qvTa9GP2F/M89lgt
uvECNF6Pp0ofKsSvoU7QhsdWS9FfZXpS3bFmyWknrQyxOIracrXa1qk2lGMVs3KMVuS2JF4Zt7qJ
fHV46DpywtFp1ZK1eov+VcX9Vek/SeWxE5at7fH4hlojRccSpV67ccPT85rbJ7oR4yfqWbFqY478
3gNtKaSnpaprNKMUtWEFsjFbEve97zCW7E4/+RWp2/5LKkc/+Mxa2ffa274rmyct+x8RC6K0XLSt
TVTUYxWtOb2RitrfuW95FtZxx2HOmdKRxWrRoJxw9PzE9snvnLjJ+pZISLllv4B9ozDQ0RTWMrpO
T/cU36TXpyX1Vu+s8tlyLPs+b8hBPxulq2+pVqS7W2Vz5E/pPEQ0NSeCotOT/f1F6TXoRf1Y7/rP
kI3le3xPmGGhdFLHuVSq9TD0lepL2Rjxk9i7xamOO/gBaY0q9K1E7alOK1acFsjFbF17297ETK7E
1gqa6N0Vipr9oqL6CL9Ff3jX+C/WTlufZ8+voKzh8PU0lVUIJzqTeXFt/q7faVzk2J7TGKho6n8h
w7TinetUX9pNbl9iO7i8yR0yuvE+YqhpzGgg00QCSqNBBgAloKNBBoA00AJCjQQJaAEgCGigS0AI
CBDQAlooEMAQ0AIauECABDRQIaABtACGggGwBDKAbQAJgA2gAbQANgA2rlQBkBYGwKSECGgBIAgA
01cAGUGAGAGBBoA1YA0FGAGggxACwMthRgBtEAoIP//Q+hB6XyH5VMAMAMAEtEQJKowAwAwAwA0E
GAGiAywAkqjADADQQYUGAGEBogMAMANNFAkAwoMAMAMAMIDCA0EGigwAwA1YA0FGAGAGAGioMIDQ
BgBgBgBgBgAmSAEWANBRhQYAYEGgDAgwAwAwAwAwAwAwAwijQBgBgBgBgBgBqwQasUGgDADADADA
DADADADADADADADADADVgDVgDCIMAMANWCjVigwAwAwAwAwAwAwA0AYEGgDADADADADCA1YqjQBo
AwAwINAGAGAGAGAGAGNBQloA0EGgDADADADADADADADADADADADLFUasAaAMAMAMAMAMAMAMAMAM
AMAMAMAMANNXANWKg3YKNkBgBgBgBgBgBgBgBgBgBgBgBgBgBgBhQYUGAGAGAGAGAC0QCgDYUYAY
gBaANgGAG0FCyIMKDAoUiA2AKKDaIBQBsKNoIFAGwoUgDZAbRQLIDaAFoA2gBSChSANgC0AbAFog
MKBaIBRQbiQCgDZQKRFGwgwAwA2AYVQpEBsIMAMAMANhRsKFIIMCDADADHkRQgA0VBgBgBgBgBgB
gBoINMKEgGAGAGggwAQFGgDAg0wBABgBgAhgGgDADRUGACWRRoAwAUggUFG0ALAMACAC0FBEALQA
sigqAFoAJEKCoAMgAqCgsSAJEKCoAKgAqIoKgAsQoLEAKgAqCgqACoigsQAsQoLEALEKCxACoKCI
AMiKCIAKgoLEALEKCxACoKFxACRIAiCgiACABAo2FCwyMChSAFAGAGgg00FGgowA0EGBBoASGhoI
MCBLQUICAbABsAQyoBNAA2ggQwAcggDIAFIqATABNBAJoIBtAA2ggG0ADaKBEkEApIAGwAUkEA5I
AQ0ADYAhhANlAhoIBtACAgG0AIaCBBQIYAloIEACGgBDQAgAQ8gBDQAhoqBDIBDKAbQAhoAG0AIa
ABtBANoAQygG0ADYAJoIEMKsJauEUgAQ0UCGggQwBDRQJaIBNig0EGEBoA0EGmgDEgoUAbAFhRgA
tEARABIhQSIASIASIAWIAaIUGiQBYhQaIAaIAWIUGRAGiFBYgBkFBokEosQIMgoKgA0QoLEgCoKC
xADRACxIAqCgqADRCgsQAqIoKgAoAQAWgBaCgiAFoAWAEAMANkUEhFzaSzbALJSpx0ZDWl5z/VkZ
5dpO0QNes8RLWkac7dgSCCwYPCrBx8ZPb7PzM11xmhE4vFPFSvu3I0527DMrAmtHYC/0k9m5e8za
644htpHH/KXqx81esSJllsRMjTmH+j9HvGO781befIlreOOw90ppBUl4qnlubW7kiSNZZa8CsGnI
GwmEljJase18ERZNizYvEw0NTVOHnP8AV2Z5dre0UmpN1G23dvazbgBQpuq1GKu3sQQXbDYen0fp
OpUzm9vwRnl3k7RR8fjZ4+bnPsW5LgacbdiOZWRdNA6EVBfKK+Vs4p7ub93eZtdsMfWiC0/px6Tl
qxyprZz5v3Fk0xnlsVlmnIT2gNAvS09aWVKLzfHkvfwM26dMMO4TnSTT6wcfkuHysrSa3L6q58eH
XskjeeevEHNWdHnDnR+jqmlKip01dva9yXFkt01JsdNxWJodC8PqQtKrLZxk/rPkty7OLMe09Fs6
cHH8XiZ4ybqVHrSk7tnR5bdhpqObSSu3kkEHXOj+gqXRik8XimlUt/CnuXGT/Jb787dvVhj2+aOb
dJOkFTT9XWllCPmR4Li+b3nSTTz559wrMiuYv3Qzof8AOrWIrr6FPJP02v8ALx47OJnLLTv0+nvz
Qfpx0x+VXwmGdqaynJel9lfZ48erbMcTqdTfiDlMjo8wmNAdH6vSKsqVPJLOct0Vx6+C397JbpvD
HuHXtO6aodAsMsLhUvHNZb7X2zlxfBe5WOcnc9WWU6c1B5/r1pYmTnNuUpNtt7W2dXivkDo0JYmS
hBOUpOyS2tsGtj0BoHQmH8H2Fli8U06zWe9q+yEOL4v3K5yt7ntxxnTm6OJdJOkVbpLXdWrkllCG
6K4dfF7+5HSTTyZ59wrbKwOveD7oIsdbG4tWorOEH6VvSf2V6+rbjLJ6el09+aGXhC6dvTTeFwzt
h4vypL02v8q3cdvAY46Tq9Tu8TgcmOjzC0dFOitbpVX8XDyacbOpPdFe9vcvcmS3Tphh3Ds3SrpL
Q6B4aOBwSSravXqJ+lLjJ7V37LJ8pO56s8/q5qDznUqOs3KTbk3dt5tt72dnhBcLhZ42cadOLlOT
tGK2tsLJsejtDaJw3gzwcsTiWpV5Kza2t7oQ9737Xklbjb3PdjjOnN0cG6Q9IK3SSu69Z8oxWyMd
yXv4vM6yaePLLuogisDtPg76BquljsYrUl5VOEtjt6cr+it3Hbs288snq6XT9aIjwhdO3p+Tw2Hd
sNF5v+8a3/dW5b9r3WuOOmer1O7xOBy4284tfRLopV6VV9SPk042dSfBcFze5duxGbdOmGHcOx9L
Ok1LoXQjo/AJKtq2yz1E/SfGT25/ee6/OTfl6s8+yag4PCnqNyk7zd7t8drzfe332XndXk0D4bDT
x8406UXKcnZJb7+xc9rWWSCybHoHRWjMN4OMJLEV2pV5Lynvb3QjwX64I429z2YydObHCdO6cq9I
qzrVbvWyjFcNyXCK9bz25rrJp5Msu4RVOnr3k3ZLzp8PsxW9/rJJsrI7H0A6F/KlHGYmOrRj5VKm
/S/45Pjy3PbZRtfnlk9PT6e/NDDpv01lpuo8NhH9FDOVS9ll6V+C3PjsvLVsxx0nU6nd4g5tSjFx
ai9WivPqNeVN7bJeyP4pPJW284tnRfovU6WVIxs6eFhnzfO+9u1tbsSSTUc26dMMO/4DqPSzpVQ6
F0Fg8Kl43VtGK2QXF83t4vbzMSbejPOYTUHCq05UJupX8vES2Qeajwclx4Q2LereS+rx/HkGo0Jw
qqKTq4ycso7dRvjxnyeUN/lZRiyfiO46K0bQ8HeFliMQ9fE1POazlKTzUI79u179r3Jc79p65J05
u8jkOnNN1cTXdaq9bFPJJZxordGPGf8Aheec/N6SPLllu/eIh20RnLysS9zzVPm+M+WyO+8so3ln
j4hWotF/SVvLxDzUJZ6t/SnfbLeovrl9VuV4+IxU1hfp8T5dSflRpt5u/pz36u9LbLblHNw480Kj
T8b+1YttqXmx2OpbKy+rBbG9itqxV1kPvoyMJaVbr13qUYeTkslwhTjx9nnSe93hOeRvy9MyUIJU
6NNN2b8mEd8pPfJ5Xe2TskvNinC8jKtb5VbC4WL1G196pLjLguEdkVxd24c+IFVcRDRUXSoNSqNW
qVVstvhB8N0pelsXk31hboEp0Y6DSnUSliGrwpvNQ4Smvrb4wfXLcm5PZ+IRhsKqyeKxTl4tt7/K
qy3pN/zS2Lm7IEnrRlqvSCp6MIQj1QpwXsXfKTe+TzcHtDWMxiqJYbDJ+Lut3lVJbnJL+WOxc222
LfSB25Lo8tWLTxTylJZqlyj9vi/R2Lys05X2fiA4HAQow+U4m/i89SF7SqNcOEV6UuxZ7CSetCUq
3SKtd2Vlm9kKcF7Ir9XbzcHtBWPx8Iw+T4e6op3lJ5SqSXpS4JejHdtd2ylvpA8pwXRyKnNJ4pq8
IvNUk9kpL6/1Y+jtedkTlr2fiGWj9HvSDlWrScaMXepN5tt56sb7Zv1bXkLUk2MxuNlpWcKdKGrC
Pk0qUc7X9snve1vlZIluxIVqsej8XSptSxElapNbIJ7YQfHdKS+6t7blrfb8Q00bo6Dg8RiLqhF2
SWUqkvqx/wA0tkVzaQtZxnrQLEYitp6tFRjdu0adOKyit0Yrcvzb3scF+0JDF4iGhqcsPQalUkrV
qq/wQf1frP0n9na5av2fEANGaOhGHynE3VGLtGKydSS9GPL60tyy2tCknrQ1xOJraerLK8pWjCEV
klujFbkvzHDNvcJXF14aDpyw1FqVWStWqL/lXB8PrP0nls2zlq3t8BporRkKsXiMQ3HDwdnbbOW6
Eeb3v0Vm911TGet4DbSOkJ6XqJ2slaNOnHZFboxX6bee0qW7E1VkujEHTi74uatOS/sov0U/rv0n
6K8lZ3Jy17PxETojRT0jJuT1KMFepUeyK98nsit7FrOOOwrS+lPl7jCmtShTypw4Le3xk9rfZsQk
XK7ErhKUejtOOIqJPETV6MH6K/vJL/An97gOWp9nz6iCwmEq6ZrKEbyqTbbbfa23w3tl4Yk2JXSu
Op4en8kwzvSTvUnvqzW/7q9FdrzZI1llrxBrQ+jaag8Vib+Ig7JbHUlugv8AM9y5i1MZ63gRuktI
VNLVXUntdkorZFLZGK3JbkVm3YsM3/stT1V/xZUj5T/uoPcvtyW36qy2szy6ex8RA6K0XPS1RU4W
WTcpPZGK2yb4L8i2sY47D/TOk4VVHDYe6w9PZxnLfOXN7luWQjWV9JwDaHwFPDweMxKvSi7Qh/ez
4fdW2T7Noq4z1ohsfjqmlKsqtR3nJ/6JLgtiQYt2LLVf+y1F01/xXVj5b/uoP0VwnLfwWXMnLp7P
xFMsacRqxAJKo0EGrAGrBRoA0ECWgDQUaCDTQAkKNBAhoASwBBQJaAEhAhoAQ0UCGECGFCGioENA
CHmADYAhgA2gBDQQDaKAckACYAOSABtAA2gAM0VFgREUloqhLCBDAEtACSgQ0AJAMAMAMANBBgBq
wBoKNABAjLAowAWkRAoqj//R+hB6XyH5VMAMAMAMAEkQJKowAwAwAwA0EGAGiAwA1YqjQBgBoIMK
DADCA0AYQGAGNXAE2sUGigwAwAwAwgMANEBgQaKDADADVgDQUYAYAYAaKg0QGAGAGAGAGpACADAD
VgDQUYUGAGBBoAwIMAMAMAMAMAMAMAMAMIo0AYAYAYAYAZYINWANWKDQBgBgBgBgBgBgBgBgBgBg
BgBgBgBqwBoiDADADADViqNAGAGAGAGAGAGAGgDAg0AYAYAYAYAYQCbFUaAMAMANBBgBgBgBgBgB
gAloKNBBoAwAwAwAwAwAwAwAwAwAwAwAwAwAyxQasFGWANAGAGAGAGFBgBgBgBgBgBgBhAYAYAYA
YAYAYAYAYAYAYAYAYAYAYAYUGAGFBgBgBgBsAwijABaCDaCjYBgBtACgDYBgBtBQsiDCgwKFIgNg
G0UCkQCgDYUbQQKQBsKFIA2QG0UCyA2AKQAoA2FCwg2FC0EGwoUiA2UCokAsoMQAsgNlBiChZAYE
GAGwDCg2FCiIMAMAMAMANkUbuUCgDAgxsihIAkoMCDADADADADADADQQJCjQBgBgBoIMYAgKNBBg
BphQgIMANBAhhRgBgBoqDCAQFGAGggUgoUEGwoWgg2FC0ALiFBEALACABERQtABYhQSIAVBQVABk
QBIgBYhQWIAVBQVEAVABYhQWIAWIUFiAFRFBUAFQUFiAFiFBYgBYhQRABYhQVEAVBQVABUFBUAFi
FC0AERAECgiACIAIgoUAKCDYUbQAsAwA0EGAGmgo0FGBBoIMANNBQkKNBBgQIaCgcggHJACGioBN
XABsIBgCGgATQQBaKgFJAApIIByQAJoIByABtBAMoENBAJoAG0ACaABtBAMAQ1YAQ0ADaCBDKgEw
BDQQIaAEBAhqxQIaCBAUIaAEsIEACGgBDQAgAQAIasVAhoAG0AIYANgCGADaABsIENAA5IAE0UA2
gBDCBAGiJACWrlAMAQwgSwBBQaIDTQAkqDCA0AaCDADYUKQAoKNoAWiAWgAkQoLEAXEALEAJEANE
KCogDRCg0QA0QAsQoNEgDRCgsQAyCg0SCUWIEGQUFQAaIUEiQBkAFQUGiAEiQBkFBUAGiFBIgBok
UFQAUAWAEQAtBQtABABYARAGACkrkUWTB4ZYGPjJ7fZy6zLtJryIfFYp4qV3s3I05W7DYAndH4NU
14yfWuXMlrpjj6hjjsY8U7LzVs+IkZyy2GBWRK6OwHjvLl5q9f5Etaxx2N6Sx/jPIh5u98fyEi5Z
CEK5h7gsE8ZLhFbWLVxx2JTSGNWDj4qnk7d35kkdMsteIKszTiF4fDyxUlGO1kWTYtFSpDQlO0c5
v1vi+Rnl29mCm1qrrScpO7Ztw3sAUXN2WbYBccDgoaGpurV863dyXP8AWwzy7SdvkVDSWkJaQnrS
2blwRqRyyy2IuRWBa9A6EU/p6y8lZxT383y/Wzbm12ww9Qw6QacePfi6b+jX8z+HDvLJpnPPYqkj
TkJbQuhZaXnwprzpe5c/YZt03jj3Cz6e03HRUPk2HyklZteivj7Oskm3XPLt8QcyeZt5gXB4KekJ
qnTV5P8AV3yCybHTpOh0Mw/1qsu+T90V+s2c+Xo8YQcmx+MnpCo6lR3k/wBWXI6x5bdiPauEHVej
XR6GhafyvFWUkrpP0Fx+8+G7ZtOdu3pww7fNFE6TdI56eqZXVKL8mPvfP2bON9yacc8+4VORpzF0
6I9E3puSq1U1Qi/43wXLi+xZ7M3LTr0+n3CY6a9LVTTweFaUUtWco7LbNWPLj3cTOOLfU6npByNn
V5RI6G0LV09WVGks3m3uiuL/AFnsJbprHHuHZNJaRw/g9wqo0UpVpK6T2t/Xly4LsW9rlJ3PVbOn
PA4Fi8VPHVJVKknKcndt7zs8duw1jTdWSjFNtuyS2tsIO89F+jdHoXQeNxrSq269RP0Vxk9j7lld
vlbt7MMOybo5H0r6UVek9bXl5NOOVOHBc+b3vs2G5NPNnn3Cps05jp/QDoK9NyWJxKth4vyYv02v
8q38dnExllp6Ol0+7zQ88IXTpYy+CwjtSWU5r0rejH7PHjs2bZjivV6m/EHGzq8onejnRut0mrqj
SVltnN7Iri/ct7JbpvDDuo7np7TeG8G2EjhMKk68lknm7vbUn7lv2bEcpO568sp05qDzjicRPFzl
UqScpybcm9rbOzw27CKVKVeShBOUpNJJZtt7EgD0b0Y6OYfwf4aWNxrXjms9+rf0I8ZPe+zYm3xt
7nuwwnTm6OK9Kuk9bpTXdWplBZQhuive3ve/qSS6yaeXPPuorNiuY614POgXzu1i8UvoIu8Yv02u
P2V69my5zyy09PS6W/NBvCJ08+cm8HhH9CspzXp23L7K9fVtY4r1epvxByCx0eYWHo10brdJ66o0
sltnN7Ix4vnwW99rWbdN4Y91HddOaYoeD7CxweDSdeSyvna+2pPnwW/ZayscpO568sp05qDgtSbl
KU5tynJtyk823vd/1nxeUerxhEabrSUYpuTaSVru98lbe77I8c5bwDvvR7QVDoHhpYzGNKq1nvav
6K4ye99isrt8rdvZjj9XN0cc6TdJK3Sav4yplFeZT3QXGXP29WT6SaeXPPuEBGCa1pN6j3+lN8I8
Fxexb7u0SsDrXQfoM9KOOKxcbUYeZS3N8/ffa8nsaWMsnp6fT35ozp101eltbCYWWrh45Vaq9L7M
eK5LzuUE22OJ1OpvxBy56rgm7woJ5L0qjW/8/Njmkm73284sOgOj9XpHXhBxSSV1DPVhD60t6T3K
+tN53SesS3TeOPcOv9I9P0ug+HjhcKtbEzXkq13nlrSS7oxWWSSWqrHOTb055dk1ORwmdSdOo3d1
cXN5y87Vb4cZ89kd15Zx6vH+Y1Ri8PNU6H0mJk7a0c9VvdDi+M/4frMs8fEdz6K9FqXQmg8VifKx
ElbLNq/oQ4ye9+5Nvlbt68MOzzRzDpJ0mq6ZxHkeVVfkx1c1BP0adtsn6U97yj5Ku9yaefPPdFcU
lot6lLy8Q8nJZqDe6FtsvtLZ6P1jTnx8RvLQvCWJ71T+M/VDnLzXK+z8Rvxa0V5dZa1d5qDzUb+l
Pi96g+uX1XDgKjSVH9oxV5yn5UYNu87+lLeoeuWxWXlIffRkabx18TipNU9itZOVvQgtiS2N21YL
c3aLqc+aNpT01K7tToU1+CnHgt7k+2Unm97TheRk6stJNYbDRapp3SyvJrbOb2bPwwV+bcOfEG62
JhgYuhh3rOWVSqtsvsw3qHrlvssgW68QHjCPR/OSUsVuTzVLm+M+C2Q3+VlFyez8QPDYSMY/KcU2
4ybcY38qq9+e1Rv50uxXd7CT1o1GNXT9Ryk1CEEry2QpwWxJexLOT4tscHtDWKxfyrVw2Gi1SurL
0qktilK21/Vjsisld3bFu/EDqVSOgE4U2pYl5Sms1T4xg98vrSWzZHexyvs/EDwWBhhoLEYleQ/3
dO9nUa9kFvlv2LO7RJNeaERjW6Q1nJtJJXlJ5QpwXsitiS27FdscHtDeP0hBQ+T4a6op+U351SS9
KXBfVjsXN3YLfSB7CmujiU5pPFNXjF5qlwlJfX+rH0drzshy17PxDLR+j3pByrVpONGLvUqPNtvP
VjfbN+ra8hakmxmNxstKSjSpR1accqdKOe3/ABSe97W+Vkmkt2JGrUj0di6dNp4mStUms1TT2wi/
rbpSWzzVvY5a9n4hnozRsZxeIxDcaEXbLzpy+pHnxeyKz22TWpjj60CxeLq6bqxjGPCNOnFZRW6K
Xte1vNjgt7hI4mvHQUJUKLUq8larUWyK304P/FJbdiy2zlq3t8BrovRkakXiMQ3GhF2y86cvqR58
Xsis+CdtZk9aA47G1NM1UlHhGnTisordGK/TbzeY4S3uEtXqR6OQdGm08TJWqTWapp7YRf1vryWz
zVvZOWr9n4iO0TotYzWq1XqUKfnz3vhGPGT3cNryFrOOOwjSmk3pKSUY6lKCtTprZFe9vbJ7WxDK
7ExCK6Lw1n/xZNeSv7mL3v7b3L0VntsOW/Y+IhdG6Nnpao0nZJOU5y2Rjvk3+m3kXhmTYd6W0nCr
FYfDpxw8HdX2zlvnLm9y9FZCRcr6TgOtHYOGjKaxeISlf9zSfptelL7C/meWy5KsmvNEROVbTVa7
vUq1Jdrb/XUlyLwx5yE3j8RDQlOWEoNSqSyr1Vv/AONxf1V6T9J8ictW9vifMMND6KWOcqlV6lCn
nUn7Ix4yexLtFqY47CNL6Uek5Ky1KUFq06a2Rj729sntbEMrsTGCpR6OU44mqk8RNXoQfor+8kv8
Ce15k5ak7fPr6Cu0KNXStVRjedSpLtbe9+1srHIndKYuGjKbwWHakrrx1RenJeivsR3cXmSN5XXi
fMMtC6JWPcqlV6mHp51J+yMeMnsXeW1Mcd/AC0xpR6VmmlqU4LVpwWyMeHXvb3sRMstiZ0dRj0fp
LGVUnWn/AMTwf/KyS4L0eLz2K5OWp9nz+AqtarLESc5tuUndt7W2Vz2AlBgBqxECbBRooNWCBLQB
oKNBBpoASFGAGrBAloKEtBAhoAS0UCABDQAlq4QIKBDQAhoIEACGigQ0AIaABtAA2rgCGEA2igG0
ACaABtAA2gAbQAKSuVAFoDRLIgQyqEtACSoENEAkoNOIAmwBoAwAwAwINAGACbBQtAZYAKSIgUUG
wo//0voSel8l+VTQQYAYAYAYAJIg0VRoAwAwAwA0EGAGEBoAywAkqjADQQYUGAGAGEBogMAMANNF
QJCjCgwAwAwAwgMIDQQaKDADADADVgDQUYAYAaKgwgNAGAGAGmAIAMAMAMANWANWCjCgwA0EGAGB
BgBgBgBgBgBgBgBgBgBhFGgDADADADAgywAmwBqxQYAYAYAYAYAYAYAYAYAYAYAYAYAasAaCDCAw
AwA1YKNFBgBgBgBgBgBgBoAwINAGAGAGAGAGrEUasUGgDADADQQYAYAYAYAYAasFCbAGWAMsAZYA
wIMANAGFBsAwAwAwAwAwAwAwAwAwA1YoMsAasFGFBoAwAwAwAwAwgMIDADADADADADADADADADAD
ADADCgwAwoMAMAMANkBlgo2AYAYAbQApAGwDADaAFgGAGAG0FCyIMKDAoUiA2AbRQbQAoiBQaG0V
ApEBsKNoIFEUbKBaANkBtBQsINhQsINhQpBAoKNogFFBtACyA2UCyA2UGACkRRsIMAMANgGFApEU
bCDADADADADZFG0wBTYAkKElQYEGAGAGAGAGAGAGggSwo0AYAYAYAaCDTChIBoIMAEsASAYAaYQI
CjADQQYUGmQCQowA0EGwoWEGwoUggUFCogC0FBEAEQAtABIkULQAWIASIUFiAFQUFRAFQAVBQWIA
WIUFRAFQAVBQVABYhQWIAVEAVBQVABUFBUAEQUFQAVBQWIAWJFBYgBUFBEAGQUEQAQKCkAtFUERA
EiAEiFCwBSANgGwoUGQoNDQQaCDADTQUaCjQQYEGACWg0EhBgQaYUDauEA2ADZQDaCAbQANoIENA
ApIIAyQQDaKALQQDaABMIBtAA2EA2gBDKAUggG0ACYAOSCAckAIauAIYANhANooBtBAhhAhgA2gB
LVwgQUCGgBDQQIYUIaCBLQAMAQ8gBLAENFQDIBDKBDABsAGwBDQANhANgCGgATRQDYANhAloDUIA
EACGigQwgQwBDRQaIg0FGBAlooNEBoAwA2AKQBsKFIgFlAqJAFiFBIgBEAEiAEiAFiFBkAGiRQWI
AeIUFiAGQAaJFBYgBkFBokGaLEAKgoMgA0QoJEgDIKCxADIALEgCoKCoALEKCxADRIoIgAqACIAI
gBaChaAFgBABaANgFg0bglSXjZ5b1fdzM2u2OOvIY43GvFvLzVs+JZGMsthkVkTGjsDr+XLZuXEz
a644hGkMd496sfNXrEiZZbEWysCQwGC+Uu781evkS1rHHYd6RxuovFw6nb2CRrLL0ECzTkD4XCvF
ystm98CLJsTeMxUdHQ1Kfnezm+Znl1t7RV5PWze024DVKk67UYq7YXWxaEoaFp3ecn638DHLt7Iq
WIryxMnKTu2acbdhs1cqC2aN0fHR0fHVcpW7vz/0M2u2OOvNFa0ppKWkJX2RWxfreakcsstiIkGR
YtB6F+VPxtReQti4/l7SWumGGwnT+m/lH0NJ+QtrW/l1e3qEhnnvwKezTiJHROiZ6VnqrKK86XD8
xbpvHHYtumNKw0FTWHoWU7fw83zf59eJNuuWXb4g5nOTk7vNs6PMN0MNPFzUIK8pbEFk2OmUaNHo
fQ15eVUl3yfBcl+fBHPl6PGEHLtJY+ppOo6lR3b7kuC5HSR58rsRsisDpXRjo3HAx+V4qysrxT9F
fWfPgt3XsxlXpww15oqnSnpLLTc9WF1Ri8lxfF+5bjWM05Z59wp0jTkLV0W6Ly07PXndUYvynxfB
e97uszbp1ww7hZ+l/SmOjofI8JaLS1ZSj6K+qufF7uvZnGOnUz14g49I6vKHejNFVdMVVRpK8n3J
b2+X62kt0uOPcOz4ivhvB3hNWFp1p985cXwiuHZtbZy9p67Z04OD6Qx1TSVSVWrLWnJ3b/W7gjtr
Tx27DDV1nZbQyO5dEeitLoxSePxtozSuk/QX/Cezitm05W78PZ08O3zRzLpf0sqdJqu+NGL8iHvf
N+rZxb3jNPP1M+4UyRpyHQug3QiXSGfjqyaw0X1ObW5cuL7Fnsxllp36fT7vgLF0/wCm8aUXgME0
opatSUckkstSNt25tdXEmOLfV6npBxE6PIJXQegq3SGvGhRV29r3RW9vl7dm0W6bxx7h3vSOPwvg
wwSo0UpV5q6T2ye+cuEVuXYt7OM+09ls6UHnLG42ppKpKtVk5Tm7yb/XctiWR34eG3YbwpubSSu3
kkAeh+h3ROj0NoPH49qNVRvn/Zp7lxm9mXUt9+OV29uGHZN0cm6YdLavSutrO8aMf3cOC4v7T38N
huTTzZ9TuFQsach0zoD0FfSGar101hov+NrcuXF9izvbGWWno6XT7vN4Fh8IXTmKTwGCaUIrVqSj
krLLUjbdudurZe8xxb6vU9IOJnR5BM6B0FW6RV40KKu3m3uit7fL27NpLdN44910PQWNxWG8G2DV
CglKtJXV9snvnLlwXK2SUpLl7T2WzpzwOC4vFTxk5VKknKc3eUnm2/V2LKyyyV9brp47dhorzaST
bbyS2t8vZrbFuWRUHeOiPRWl0TovHY2yqqOS3U09yW1zezju435W7ezDDs80cr6W9K6nSatr+bSh
5kb5R585v1btlzpMdPPnn3Ct06NrXTd84098uDlbNLhva2WvrFcx0noR0Qlpup4+rnTg7OSyTa9C
nbct8lktkc/KWMrp36eHd5E5076XxjB4PDPUox8mpKOTlbLxdPktkpbFs5SmOLfU6npByGo1FRdS
OX9nRV9++W+z/illays10eb96ErovRNbSuIVKKU8Q9zXkUorfJbMt0dkck035Klumpju/eO24vE0
fB9hlRorxuKq3ee2ct85vdFc3a2/azl7T13+TnjkcLr4upjastSXjK9S7qVnkkt6i3bViltk7ZZK
0b36PHbsN6MNZuhhfKbXl1Nl1vtfzYcW7OW+19UpPuHeuh3ROj0WovE17Kpq3cpZaq7dnU897s/J
jyt29mGHb5o5t0r6XVelNbxOGv4tXSey63vPzY22t2y22WS3Jp58+p38Coxl4l+Iwt51J5SqJZvj
GHCPF5OS22jdPTl90GKa0d9HQ8uvLJzjna+WrT4vc5LbsjlnIvA3eOhNlpYjjtjT6tznz2R3XlnG
cns/ELVGOivpK6167zjTeerf0qnPeoPbtlllJynHIyNG/wC04tuWvnGN/KqPjfdDc3v2R3uNPvoy
MJaWbr15alGFldLJLdCnHe+W7zpPayLz5oxynpmSpUoqFGF2k35MVvnOW98ZPbkktkRwe0MrYlJf
JsKm1JpSlbyqj3K21Rvsjvebu7JC30gcOUdAZRalid8lmqXKPGfGWyO7ys05PZ+IRh8JDBRVfEq+
tnTpb5/alvUOe2Wxb5ISa80Jp0qmnJyrVpatONtebWUVujFLfujFepJtOD2hmIxMtJOOGw0Gqafk
QWcpS+tLjJ90VkrIFu/EDipXhoWLp0WpVmrTqrZFPbGm/VKe/YsruRd9vAThMFDAQWIxKvfOnS2O
f2pb1D1y2Le05JNeaB06VbpBVlOckklec3lGEVktmxboxW3YkOE9obx+kIzisPh040U9/nVJfWl/
ljsiuLu2LfSB7GMejavKzxb2LaqPN8anBehtflZJy17PxDPR+jvlutXrycaMX5c9rk3nqxvtk/Vt
eQtSTYzG42elpxpUoasI+TSpRztf2ye97W+Vkmkt2JCrVj0ei6dNqWJatOos1TT2wg/rbpSWzYt7
HK+z8Qz0bo2M4vEYhuNCLtl505fVhz4vZFZvOya0xx9aB4zGVNNVYxjGy82nTjsityS48XtbzY4L
e4SVetHo/F0aTTxElapUWagnthB8d0pL7qyu3OVt7fiGei9FxrRdeu3DDwdm1tk/qQ4t73sis3zW
pJ63gC0hpCel5xSjaK8mnTjsityXFve9reYS3YlpzXRmLhBp4uStOS2Uk9sYv6/1n6OxZ3Y5a9n4
iM0Vor5wcpzlqUYZ1Kj3clxk9y39RamOOxvSulPl2rTprUoU8qcPbKXGT3vsWSEhllsSlClHo3BV
qiTxUlenB/2aeycl9b6sXs857kTlqfZ+IhcFg6umq2qneUrylKTyS2uUm9iW1svDMncJDSmkIU4f
JcN+5TvOex1ZL0nwivRju2vNiLlfSBWi9HU6FP5Xil9EnaENjqyW5cIr0pdizJaSetEdjcbV0xV1
5ZylZRilklsUYrclsSLwxb3CerTXRiDpQaeLmrVJL+yi/Qi/rP0nu81b2Z5dPZ+IhtE6KlpSbV1G
EVrVJvZGPF+5bW8i2s447DnTGlI4pRoUE44en5kd8nvnLjJ+pZISLllvxOA60Xgqej6axmJV43+h
pv8AtJLe/sLfxeRKsmvNELisTV0rVc5tzqTfe3sSXqSXUVi3YseJmujNN0INPFTVqs1/Zxf9nF/W
fpvdsJy6X7Pj1EHonRU9LVNSLSilec3sjFbZP9Z7C1zxmw+0zpOFdRw+HTjh6fmrfOW+cub3cFkJ
Fyy34nANofR1OnB4vEr6GDtGG+rP6q5L0nwy2kq44+tETpHSFTSlWVWo7ye5bEtyS3Jbis27DEqD
ViATYoNAGrAGmiIElUYAJaCBIUYAaaCBLQUaANWCBLQUIaCBDQAlooEgCGrACGggQygQ0AIaCBDQ
AhlAhgA2rAA2gBDQANoIBtFAJoAGwAbQANgA2AAaKjRDAEsASECGgoSECADCg0AasECbBRoAwAwA
0EGAG0FStpEELKg2FGAH/9P6FNHofJflU0UGggwAwAwAwASRBqxVGgDADADADQQYAYQGgDADViqN
AGAGggwoMAMIDRAYAYAYECbFBoKMKDADADCAwA0QGBBooMAMAMAMsAJsFGAGFQaANEBgBjABgGAG
AGAGAGAGWANWANBRhQYAasEGAGBBgBgBgBgBgBgBgBgBhFGgDADADADADAg1YA1YA0UGAGAGAGAG
AGAGAGAGAGAGAGAGgDQQYQGAGAGAGrFUaAMAMAMAMAMANAGBBoAwAwAwAwA1YijVig0AYAYAaCDA
DADADADADViqNAGAGAGAGAGAGAGAGAGAGAGrAGWAMsAZYAywBsAwA1YAywBlig1YKNWAMsAZYAyw
BoiDADADADADADADADADADADCgwAwoMAMANkBlgowA2AYAYAYAYAbQKFAGwDADaAFgGAGAG4hQsi
DCgwKFIgNgG0UG0AKIgUgowqhaIg2RRiKBZAbKBaAMIBSChQQbChaCBQUKQAoA2gBQBsAWQGygUi
AUAYUGBQsgMCDADADYBhVCyAwIMAMAMAMANkUbCjRUGggwAwAwAwAwAwAwASwgSFGAGAGAGggwAS
wo0AaCDABMgBIBgBphAgKMANBBhQJZFGgDQQYAbQUKQQKCjaAFgG0ALQAVBQtAC4gBIkULQAVABU
FBIgBYhQWIAVEUFQAVABUFBYgBYkAVBQVABUAFiFBYkAWIUFQAVBQVABEwoKgAqIoLEoCoigsQAs
QoLEAJEKCoAKgoIgBaCgkSAJEAIgoWgBaANhBsNBQQKCjADQQaCDAoSFGAGggwINACQ0NBBgQIYU
DaCAckADkVANoAGwgGADaCATQAFlQCkgAUggG0ADkggHJBANoAGUA2ggG0ACaABsAGwgQ1YAG0AI
aCAbVygGwgQwBDQQIYAN5BAhoAS0UCABDQAhoIEMARJACGAIAEACGioENAA2AIYANgA2AIaABsIB
sAGwAbKAbAEBFhAFIkgBLKAYAlhAhgCCgwiDQUYECWgDQBoA2gBYBgUERAbKBcSAJEKCRACIAIgA
qACxCgyACxIoNEANEALEKDRIA0QoLEAMgoNEgyLEAKgoMgAsQAsSKCoAMgoNEAJEgDIKCoAKgoLE
ALEgCxCgqACIAWgBaCgiAFgBEALQBNaMwHjfLl5q2Lj+Rm11xx2E6Sx/j3qR81esSGWWxFormJPR
+C+UvWfmr1i1vHHYc6Rxv9nDZv8AgSRrLIQpXMPcJhHipcltYaxmxJ43FrCx8XDJ+z8zMbyuhX2b
cQWhQeJlqxIsmxPVqsdFw1Y+c/1dmeXW3tFZqSdRtvNs04gcIOo7LNsoLPQow0RT1pZyf6sjHLtJ
2ir4rEyxcnKX+hpxt2GbKgtGi9GrDLx1XK2aT3c3z/W0za7Y4680QmldJvHSssoLYveyyOeWWxCM
rAm9DaH+XPXn+7Xr/LiS10xx2HOntMpp0aWUVlJr2LlxEi55ekFMkacQ80do2ek6mpHZve5L9bCW
rjjsXLSOPp9HaSo0fPay5fafP9bDPLvlezgc0qzdVuUndvNtnR5ginRliJKMFeTdkkCTY6VgsHS6
KUXVq51Gs+b+rH395z5emTsg5vpTSVTStR1J9i3JcEdJNPNll3CJkVkdB6L9GlBLFYnKKV4xf+J+
7vMWu+GHrRB9Kukz0vLxVN2op/xPi+XBdvVZNMZ59wpLRtyFh6N9G56eqZ3jSi/Kl7lz9m3hfNum
8MO4XLpT0khoOn8jwloySs2vQXBfa57tu3ZmTbtnn2+IOOSzOjyA2B0fU0pUjSpLWnL9XfLiLdLJ
sdnjHDeDzC3dp1p985e6K/WbOXtPX46cHENKaSq6WqyrVXeUu5LguCR1k08eV2IporI7R0N6Iw0P
D5fjbRcVrRjLZBfWf2uC3dezlllt6+n0+3zRQ+mfS+fSSpqwvGhB+THj9p8+C3LtN446cep1O4UV
mnEXjoX0Mn0lqa9S8cPB+U/rP6q973LmZyy07dPp93wFy6ddM4aKh834G0XFas5R2QX1Y8+L3bNu
zGOLr1OprxBwo6vGH+idEVtOVo0KMbzl3Jb23uS/WYt01jj3D0BVqYTwXYLVjadeffOXF8Ir9Zu5
x9p7fHSg87aT0nV0xVlXrS1pyeb9y4JbkdtaeK3YYJXDI7/0G6G0+j1L5xx9oyitaKl/Zri/tPct
q+9s5ZXb29Pp9vmjnHTbpnU6U1bRvHDwfkQ4/alz9iy4t7xx04dTqdwo5pxHQegvQifSep4ypeOG
g/Kf1n9Ve97uszldO3T6fd8Bd+nvTaGi4fN+BtHVWrOUdkV9SPPi92zbe2ccd+Xbq9TXiDg51eMS
eiNE1tN1o0KEdacu5Le3wSJbprHHu8D0VGOF8GWD1Y2nXn3zlz3qK4d15PPj7T3eOlBwnSWlKmlK
kq1WWtKWbfLluSWxbVsS1nmu0mnjt2Ixu/63c96XLzpbXuDI7l0J6Iw0JTekMdaMktaKllqJelJb
nwj6P3rW5ZZb8PX08O3zRz/pn0xn0oqasLxw8XaEfSm9l7c9nJZZu6e8cdOPU6nd8BU6dFwdrJzS
vZ+ZTXGW5vlsvZO78lac9C6dDuik+ktRu8lh0/par86o98Y8Fx32ze1RWcrp1ww7hfum3SyloGms
DhElKyjqwyst0VbNc2vK3KzetHGM27dTPt8QcTakpq6VSu8lGy1aduWy64ebHfd3S6vKHWjcFVx9
dUcLeriJvyql8o8Wn7Z7d0eMpVk3xyO74TB4bwcYN2tKtJXlJ5az571BcM3uScmk+XtPXJOnBw3S
Ok6vSCpUnrWg7OrVlldblle0fq01du13rNXXWTTy29wZQXyqLhS+joRs5zltfByttf1YK9ubTkGR
2voZ0Yp6MpfK8QvF04rXjGe3L+0qc/qx2Q25ydzna9XTw15oo3SvpVV6Y1HSovUwtPNt5J/an/lj
m+CcjUmnHPPv+AqMW8VfD4VWhtnOWTklvm9kYrdHZe19aVjTlz4g3GV/2fCJycspz2OfFK/mwW3O
19srKyiX7oM8asB9Fh/LrS8mVRc8tWnvz2OW2WxWV9aHHAX5Og+EsT3xp+5z9UecvNvKez8RkaEd
HrxuIWvVl5Uab5561Tfbeo7ZbXaNtYa1yNwovFXxWLk9RvLdKbXowWxJbG7asVkk3aJF1vzRpKpp
uV3q06NNfgpx4Le2+2UnxzY4PaG6lZ462FwsX4tvZ6U2vSn7l5sVzvJi3fiAtTEQ0RF06DUqrVp1
VsXGNPluc9r2K0c5DjgbpYaGh4qpXSlVavCk9i4Sqct6jtltdo+c5XWgihhpaTcsTiZtU0/Km83J
/Vgt75bIrN2Vgmt+aNVa1TTc40KMNWEb6lNPJcZSb2vfKTtlwikk4N9wLXxUNGQdHDvWlJWqVlv4
xhwhxe2XKOQW3XiAlDCQ0TFVsQlKpJXp0X6pT4R4R2y5R2zk1rkBoYerpypOtVnaKzqVZbIrckt7
3RiupWSyvCSdw1jsf8qUcPh4uNFPyY7ZTls1pW2ye5bIrJb26W78QPrx6NqytLF73tVHkuNTnsh9
7zZy17PxDTR+jViU6+Ik40YvOXpTlt1Y32ye97IrN7k1qSetGsXi6mmqkKdOForyaVKOaV/a3vk8
2/U0lvcH9WvDQEXSotSxDVqlVZqC3wg+O6U+xZXbctb7fiGujdGRlD5RiG40Iuyt51SX1Y++WyK5
2TWpjj60CxeLq6cqxjGP2adOOyK3JL2va3mxwW9wk61eHR+LpUWpYiStUqrNQT2wg+O6UuxZXbnK
29oZaL0XGvF167cMPB2bW2T+pDjJ90Vm+ZnHH1vAFpDHz0rOMYx1YR8mnTjsiuC4t73tbLot2JiT
XReOrGzxjXlPaqKe5fb4v0dizzU5b9n4iJ0Xox6SlKUpalKGdSo9kV75PctrfaW1nHHYJpXSixaj
SpLUw8PMjvb3ylxk+5LJZCQyuxIYXDw0BCOIrJSryV6NJ7luqTXD6sd+15bZy1J2+aIihh62nK9l
edSbbbb723uS3vYkXhifaok9I46ngqbwmFd4f2tTfUa3LhBblv2sjVuvEA9FaMhOLxOJvHDwdstt
SX1I+97kLUxx9bwGek9JT0tU1pJJJasILZGK2RS/V3mEt2J1JdFYXf8AxZNZL+5i9/32tn1VzJy6
ex8RAaO0fU0vV1IbXdyk3lFLbKT3Jb37ysSbElpbSNOEFhcNfxMXeUtjqy+s+S9GO5Z7RFyvpBmi
NGQ1HisTdUIOyWx1JfUj/me5cxTGetEfpPSVTS1R1J2W6MVlGMVsjFbki60zllsWGlBdFaanL/iy
a8hf3UX6T+29y9FZvPIzy37HxFcwWCqaUqqnTTlOb/1bfDe2aYk2JvSuOp4Kn8jwzvBO9Wov7SS/
yL0Vv2kjeV14gaaF0Sse5VKr1MPTzqT9kY8ZPYu8Wpjjv4AWmNLPSk1ZalKC1acFsjH3t7W97EiZ
ZbEQVkYAYAYAJaIBJQYAaaIBLVgDRQasAJaANAGACWggSFGmggQwoS0ECCgS0AJYAgIBtWAEtFAh
gA2ggQ0UCGgBDVwAbQANoAG0ADaKgG0ACYANoAG0ACaAAyCLCGUUkAQ0AJYQIKBLRAJKDADADQQJ
aANBRoAwAwIMQEpaAhQUYAYAf//U+hh6HyH5VNWChJQaCDADADADADREGrACSqMAMAMAMCDQBgBo
gMAMsAJKowA0EGFBgBhAaAMIDADAg0UGrAGiqMAMAMAMIDCA0EGigwAwAwAwAywBqwUaANFQaIDA
BBUGEBoKMAMAMAMAMAMAMsAasAaCjCgwINAGBBgBgBgBgBgBgBgBgBgBhFGgDADADADADAg1YA1Y
oNAGAGAGAGAGAGAGAGAGAGAGAGgDAg0AYQGAGAGrFUaAMAMAMAMAMANAGBBoAwAwAwAwA1YijRQa
AMANBBgBgBgBgBgBgBqxVGgDADADADADADADADADADADADADADADADADADADADADVgoyxQaANMA0
RBgBgBgBgBgBgBgBhQYAbAMCjLAGAGwDADADADADADADADADaAFgGAGACkECgowAwAVEihQQYUGB
QpEBsA2ig2FCiMhSCjCqFkQbIow0BZkGAC0UGyA2FCwg2FCkECwo2gBQBtAC0QGFAtEAooNxIBQB
soMAFJkUbCDADADYBhQbTIoUEGAGAGAGAGAGBRgQYAYAYAYAYAYAYAaCBIUaAMAMAMANBBgAgKMA
NBBgAhgGgDABLCBIUYAaCDTAEhRgBoIMAMAFoKNhBsKFoINoKCABEFC0AEiALRFBAAiACIKDIAJE
ALEKCxIAqCgqACoKCoAKiALEKCxACoKCoAKiALEKCxACRCg0QAiCgqACoKCpgBURQVABUFBIgBYh
QWIAVBQSIASIAtEUEQAQKCACkAKCDYaCkEGwDYUYAaCDQQY0FCQowA0EGBBpoKEhRoIEyABtBAhg
AyoBsAE0ECGADkACkggE0EAmigC0EA2ADaCATQAhhANoAGygHJBAJoAGwAckECGgAbVwBDABsIBt
FQIaABhAhoAQ0ECABBQIaAEsAQwBDQQIYAgAQ0AIaAENXABgCGioBtACGgAbAENAA2gAbCAbABso
BsAGwEJaCNEMAQAIaKBDQQIYAmwBqxQaIDQBgQaAE2AFIA2FG0iAWUGyAWgAkQoKgBaACoAIgoLE
ANEALEig0QA0QAsQoMiANEKCxADIKDRIMixACxCgyACxACxIoKgAyCgqACxIAsQoKgAqCgsQAsSA
NEKCIAKgBaChaACIAWAEQBKaOwXyp3fmrbz5Etbxx2H2k8dqrxUOp/AkjWWXoIJFcw+wOEeKl9lb
WNtTHYlcfi1hl4uGT9n5kkbyy14EAVzDjDYd4mWqu18AsmxOYmvHR8NSHnfrNmeXS3tFcb1s2acg
qnSdZqMdrCa2LD5OiqfGT9b+Bnl29kVurVdaTlLNs0427A0tbJbSoLHhMLHRsHUqed7OS5mOXeTt
8ivYzFyxkrvZuXA05W7DFlZFh0VoxL6WpsWaT9rM2uuGPqI/S2k3jHqx8xevn8CyM5ZbEFIrmJTR
Winj5XllBbXx5IlreOOxJaa0ssOvEUcrZNrdyXvJI3nlrxBSmbcAfBYGekJqEO17kuLJvSybF1xe
KpdGqKp085vZzf1n+uRnl3t7BzivVlXk5Sd5PNs2818gEabqtRirt5JIoOjaN0dT6N0nXrNa9u77
K58fgc7dvRjj2eaKBpjSs9LVNeWSXmx3JfrazcmnDLLuENIrAvPRjo0q1sRXVoLOMXv5vl7erbm1
3ww9aGHSrpM9It0aT+iW1/Wfw4cdoxjPUz2KLI24ia0BoCenalllTXny4clz/wBSW6bww7heukWn
qfRuksJhUlNK2XoLi+Mn+b54k27559viDjlSTm23m3tZ1eQKwuDnj6kadNOU5OySBJsdlwuGw/QH
CupUtKtLbxk/qx4RW99vBHL2nrknTg4vpjStXTVV1qru3sW5Lcly/wBTrJp5Msu6iIZWR13oX0Pj
g4/LsZZJLWhGWxLbrS9y3bduznll6PV0+nrzRU+mvTGXSCfiqV1h4vJfWfF+5du3ZccdOXU6nd8B
z9m3EW3oh0RqdJql3eNCL8uXH7MefsWfBPOV06dPp9w6F0y6XU+jtL5BgbRmlqtx9BcF9p73tW3b
sxJt36mfb4g4JJ3Orxhzo7RtXS1WNGjHWnJ2S974Jb2S+Fk2PQVKlhfBfg9aVp15985cFwivz2tI
5e09sk6UHn3TGl62nK0q9eV5S7ktyS3JfrM6yaeLLLu8iJNMju3QLoRDRsPnDH2jqrWhGWSilnry
vv4Ldt22tyyy9I9nS6evNFL6ddN59Jqni6V44aD8lb5P6z9y3dZrHHTl1Op3fAc8NuAvHQrobU6U
1byvHDwflz4/Zjz9iz4J5yy069Pp9w6T036ZU+jdL5vwFozitWTj/ZrgvtPe9q2+dsxjjvzXo6nU
7fEHn9u51eIPdHaOq6Wqxo0YuU5OyXvfBLe9wt0smx6MweEwvgxwbnO0681m985cFwguPvaRw9p7
pJ0oOIaY0vV01VlWrO8nlbcvspcuHbJ7jrJp5csu4RDd+/rz5cXz2LduKwO0dBuhUcHFY/G2iorW
hCWyK268r7XvV9m3hbnll6PV0+nrzRVOm3S+fSar4mlfxEXlHZrW9OfBLcnsWbsaxmmOpn3ClQSg
nJSstkqtv5YLL3ZfVje+nIXHol0Qn0lmlJOnhotNrfLhd8WtnBPJJO5m3Tphh3fAdD6WdLIdHYLR
+j4rxyjbK2rTXF7r73fJbWYk35rvnn2+IOHwblKXi5a09tSvJuyvts3nnx86WxLO0uryfvYcaOwE
9KS8RhU1GTSlNrypPh1b1FPdrSdleMqyb8Qd9weGwfg2wbnO2u9r2ynLdFfpJbcjl7T2STpwcQ01
pmt0nqPEYl+LoJ+TFb7bo8Xxk8o35qL6SaeTLLu80RTXyqKnU+iw8W9SK2ye/Vvtl9abyX8MSs8/
Ada6E9FPlUY43FxUKEFrUaT2JfXlfbxu9u3KKSOeVejp4b80Q3THpS+kzcISdPA03Zz31JLgsr8l
sXnSaytZNMdTPu+AoavpJasbUsNTd23mk+Lfpze5dyjFO23Hn4Dabx96NBalGPlSlJ2vb06j9kVk
r2Scm3IvPA2p+N/ZsIm1Lzp7JTtnn9WC22vbLWk8lqw+6Dfj46O+iw716sspVFzy1ae/k5bZbFZX
1qm9cBWrHQe208Tw2xp9e6U+WyO+8souV9n4jIYeOGXyjFXlKflRptvWnf0pvao/zS3WXlKGteaM
jSnpVvEYiWpSjlrW4bIU45K/JWUVm2t4580Y5VNNSVGjFQpQu1G/kxW+c5b3xk+pJKyHB7XiBVbF
xw0XQwt3rZTqW8qfJLaoctstr3RQ36QHUI6AzklLE7ovONLnLc5/Z2R33lknK+z8QHDYNVE8TipS
8W27Z+XVlvUb7vrTeS5vIJJ60abrdIKijFKMILJbIU4La29y4t3cnxbHB7QXisbDDweHw19R+fUt
aVT4Q4R37XnZIW+kDmFCGgEp1UpYh5xpvNU+EprfLhDdtl9VzlfZ+IbYXBy0o5YivNxpp3nUebbf
ox+tJ8N212RUk35o1i8ZPSkoUKEHGmnanTWbbe9/Wk977FZZAt34geyrQ6PJwpNSxLVpVFmqfGMH
vluc92yPEctez8Q20fo2Lh8oxDcaKdkl51SS9GP+aWyPN2TWpJ60Jr162nqsYQj9mnTjsiuC9rb2
5tscJb3B7XxUNCxdHDyUqslapWWy2+FPl9aW2WxeTtcrvXH4gGj9GwjD5TibqinaMVlKo1ujwX1p
bFszeQtJj60BxGIraerRjGN35tOnFZRW5RXDi+ttjgt7hJV8RDQUXRoNSrSVqlVbEt8IP1Slv2LL
bOVt7eA00ZouNWLr124UIuza86b+pDi+L2RWb3J1McfW8AWkNIT0tOMVHVhHyadOOyK4Li3ve1sc
FuxLycejCsmnjGs2s1RT3LjU4v0diz2Tlr2fiInRmjJaTlKUpalKGdSo9kV75PctrZbWZNgulNKL
EpUaKcMPB+THfJ75ze+T7kskJDLISGEwkNBwjiMQlKrJXo0X6pzX1fqr0ny2zlZ9nzREU6dfTtey
vUq1Hm/e+CXclyLwz5yolcdjKejKbwuGetfKtVXp/Zjwgv5nnssRq3XiBtonRUcQnXrtww8H5Ut8
nuhDjJ9yWbFpjj63gN9K6UlpOSyUKcFanTWyMeC4ve3tbEiZZbE1Qpx6MwVWok8VJXpwf9mnsnJf
W+rF7Nr3InLfs/EQGFwtXTFZQhedSbu2+9tv1ts1w5ybExpLHU8DTeEwrvH+1qr+0kty+wty37SS
N268QNtD6JWLUq1ZuGHp+fLe3uhHjJ+pZstrOM38AHS2lHpSSslCnBatOmtkY+9va3tbEMstiYwO
HjoCnHFVknWkr0Kb3f8AHJLh9Vb3nsM8tSdvm/IV76XSdXfOpUl1ttlY5Fjx1ePR+nLC0WnWmrV6
i3f8bi+H1nveWwnLpb2+PxELojRUtLVNVNRhFa05vZGK2t+5b2W1jHHYd6Z0rHEqNCgnHD0/NW+T
3zl9p+pZISLllvxOBAFYG7EAqwBjQAkoNAGWIBDQBooMAEtEAkoMAEtEAkoMANNXAEvIAS0ECAoS
0VAgAQ0AJaAEBANooEtACGggGwBDRQIaABtAA2gAckADaCAbRQCaABsAG0ADaAATRQIZEaIZQJaC
BDChLQAgqBDViAwoMAMANAGrBBqwAkKMAFIIlLCowAwA3YiD/9X6GHpfIflUwA00RQkqDQBgBgBg
BgBoiDQBoqjQBgBgBgBoIMANEBgBgBqxQaCjQQYUGAGAGEBogMAMANFQYAasAaKowAwAwAwgNEBg
QaKDADADADADLAGrACSgwAGEGAGAGAGiKMAMAMAMAMAMAMAMsAasAaCjCg0EGAGBBgBgBgBgBgBg
BgBgBgBhFGgDADADADAg0AasAasUGAGAGAGAGAGAGAGAGAGAGAGAGgDAg0AYQGAGrFUaAMAMAMAM
AMANAGBBoAwAwAwAwA1YKNAGgDADQQYAYAYAYAYAYAasVRoAwAwAwAwAwAwAwAwAwAwAwAwAwAwA
wAwAwAwAwAwAwASwBIBgBgBgBgBgBsoMsFGAGwDADADADADADADADADADLAGAGWAN2ANpACgDADA
BaANgGAGACkRQoqDADAoWiAwA2ig2FCiMjaCjZVCkRAoijCgWQGAColAogNoAWgDaAFIKFIA2gBa
ANgC0QGFAtEAooNoAUQGygwAwAXtIDADADADYBhQKTIo2EGAGAGAGAGAGAGAGAGAGAGAGAGgg02F
CQDADADADAg0AaYUJANAGBBgAhgGgDABDCDQUYAaKg0yASFGBBoAwAwAUgoUEGwoWgg2FC0AEQAR
BQtACyKCIAJEAIgoMgAqACoKCRIAsQoKgAqACoKCogCxCgsQAqACoKCoAKiKCoALEKCRACxCgsQA
sQoKgAqIoKgAqCgiACxCgsQAsQoJEAIiAWgoIAEQARBQtACgg2GhtBApAGwowAwA0EGgg00FGgow
INBBgAlhQkAwAGEA2gAbAESKgHIAG0EA2ACYQCkACkioBSQQCaAByQQCkAIkEA2ADaKAbVwgE0AD
aABsAGECGgBDQANoIBtFAhhANqwAhoIEMAG1YIEtACCgQwBLQAhhAhoAQ0AIYAMAQwBEkUCGEA2A
IYANgCGADaABsIBsAGygG0ADaCBAGiGAJkigQ8yAQygQwgSAaANNACQDQBgBoINgGBQtKxAKKDZF
C0EBEFBEAEQARABEFBYgBogBYkUGiAGiAFiFBokAaIUFiAGQUFRBkaIAWIUFQAZEAWIUFiAFQUGQ
AWJAFiFBUAFQUFQAWJAFiFBYgBEAEQULQAsAIAPsFhXi5aq2b3wJWsZsT2NxSwMVTp7bd35mY65X
XgVs24BxhsO8TLVXa+BGpNiwYivHR0FCHnfrNmeXW3tFcb1s2bcQWlSdeSjHayLJsWCco6LhZZyf
rfwM8u3sivVJuo7vNs04hMYubss2wCxUqUdGQ1pec/1ZGeXX2RAYiu8RLWkacrdhsEFiwODWEj4y
pk/Z+ZK644680Q2OxrxkuEVsRZGMstiOZWBNaL0Z436Sfm7lx/Iza6YYgWl9J/KPIh5q2vj+QkMs
tivs05h/o7Rr0hLhBbX7lzJa1jjsTOltJxwEfE0cnaztuXxJI6ZZa8QUmRpwC8NhJY2ahBXb9XNg
k2LtUqUujVGyzm+9vi+SM8u/sQc8xWIlipOc3eT2m489uw21XJ2WbYQdB0ToqGg6bxFeynb+Hkub
/Lrxbt6Mce3zRSdM6Xnpad3lBebHh+ZuTTjll3CDkVgXDo10b+WtVqy+jWxP0vy9pm12ww35CelP
ST5VehQf0aylJelyXL29W1IZ578QUJm3ASmhdCVNN1NSOUV50tyXx4Ilumsce4X/AE3pil0VorDY
ZLxluvVv6T4t7vhZPEm3fLLsmoOO1ZurJyk22823vZ0eQJoYaeLmqdNOUpOySKSbHY9H4Ch0Gw7r
VmnVkrNra39WPLi+15Wty9p65J05sch03pmrpyq6tR/djuiuC/WZ0k08uWXcINmmB1PoX0PVljMW
koLyoRlsyz1pX3b1x27NvPLJ6en0/WiD6bdMXpuToUXahF7frtb3y4Lte61xx0x1Op3ePQc4ZtwF
m6K9FanSWrZXjSj58/cub9W3rzbp0ww7h0vpZ0opdE6KwOCSVRK2XoJ73xk9vre6+JNvRnn2eIOB
1JObbbu3m2zq8QJg8DU0jUjSpRcpydkl+u97hVk2PQOAwOF8GeEdas1KvNWbW2T+pHhFb32vcjjf
tPbJOlBwbTunK3SGtKvWd29i3RW5Ll7du06yaePLLuuxCM0wO1dAOgsaaWPxqShFa1OEslZZ68r7
t6T6+Byyy9Hr6XT9aK30+6dS6RTdCg2sNF9Tm1vfLgu152S1jjpz6vU7vE4HNDbgLh0P6I1elVay
vGjH95PhyX2n6tr55yy069PDuHWOl/Suj0OoLAYBJVVG2X9mnvfGb259b3X54zfl6Opn2TUHnqcn
Ubbd2823vOzxBxgsDU0jUjSpRcpydkl+u97kNrJsejdE6Kwvg1wjrVmpV5rNra3t1I32Jb32vKyX
G3ue7HGdODi+ndO1dPVnWqvqW6MdyXBc/OluSu2+kmnmyy7hBt+zqy58FyWb7UVgdf6BdClVSxuL
VqaV4RlldL0mt0OC37XlZHPLJ6en0/WiL6b9NXp+ToYeWrhoPyqn1ny4/ZX4t11ccdM9Tqd3HA56
oqMUrNRlbVgvPqPc3wXBd13eRtxFo6NdG6vSKuo5WhbWdrwpLglslN7lmr5y1ne2bdN4Y91HVOku
n6fRSh8kwjUaiXlTeahf0pPbKpLalm35zyWfOTb0Z5dk1BwiUvHxcm3Ci35U3nOpLb2vfbzY5Xbl
Zvq8YLQw0sfqR1Wqcn9HSj503sv8ZtWWaSstVFk2O76NwNDoDhXicU4+NtZRjsV/7Omt9/Sk85Wu
3ZHK+XsknTm6OM6f0xPTNX5TjN6+ioJvKO6/BPb9aW6yaa6SaeTLLu838BFVvItVxWcmlqUllluv
bzYcErNrZZPWKz8R0roT0KnpmSx2PX0Ss6dNqyaWx22KC3Lft83zsZZaejp9Pu80H6cdLo49eKi2
sNwi7SrNcPq019b0nsTtdMYdTPfwHMnF4xKtiHqUVlCEcrpejBblxk72d29aWT28/PI3aWk1rTap
YankrLJcorbKb3797aisi8/AYnLSn0VFKnh4Ztt5LdrTlvlw7oxzs4chXjXW/ZsHF2l50tkp2zz3
Rgttr2W2Tdrqp90GPER0X5FB61Z5Sqrdf0afvntexWWci8cBSow0JnUSniN1N5xhznxl9jYvS+qT
k12jUMPr/tWMlJqTbjG/l1Hy4R4y7Em72GvWjcYVNOS15ONOjTVr7IU47klvb3LOUndu+bHB7Q3V
xDxlsLhIyUG1l6dR8ZW9UdkebvJjnxAaVeGg1q0WpYjZKos1DlTe98Z9kfrNyu+0IoYKGBiq+JV3
JXp0r2c/tS3xh65brLykJNchMKVXT9SVSpJRhFLWm1aEI7kku6MVm+9jhPaG8VjPlCWGw0WqV1lt
nUlucrbXwiso7ru7Yt34gd3h0d2WniuO2NLq3OfPZDdeXmuV9n4htgtHqrF4nEycaV3n6VSW9Rv/
ADSeUebsmST1oTWr1dPVI0qcbRWVOnHzYrft75Se3a2ODfcHVbFQ0PF0cPJSqSVqlZeuNP7PGW2W
xWjtctb7eAnBaOhhoLEYq+o/MprKVRr2Q4y7Fnsm0k9aBSnX6RVkkrytaMVlGEVuW6MVvfa3cvCe
cg6xWNp6Ng8PhndyVqtb632Yb1DjvlvysgtuvECcDo+nhoLE4q/i3+7p7JVGvZBb5diz2NrJrzQ2
qVa/SGsklrTfkxhFWjFLYktiivzb2scJ7QkMRi4aGg6GHkpVJK1Wst/GEPs8ZbZfd2zlbdeJ+IBo
3RkZQ+UYhuNBOyt51SS9GPvlsj12RUxx9aAY7H1NMVIpRsl5NOnFZRW5Jb2972t5jgt2Jec49GU4
wali2rSks1ST9GL3z4v0dizuyctez8RFaL0XLSTlKUtSlDOpUeyK98nuW1vvLazJsF0ppRYlKjRT
hh4PyY75P683vk+5LJAyy3xwH2EwkNCwjiMRFSqSV6NF7+E5r6vBel1bZysnb5oioxr6dr76lWo+
/wByS7kuQ4Z13US2MxlPRNOWGw0lKUsq1Zel9iH2OL9J8rDlu3XiBnonRSxalWrPUw8PPlvb3Rjx
k+5LN5Cpjjv4AWldKvSTSitSlBWp01sive3tb2tlkTLLYlsLh49HYRxFZKVeSvRpP0VuqTX+GO/b
sJy1J2+RBU6dbTNayvUq1H2tvf8ArJGuGOROY7FQ0PTeFw8lKUsq1Vel9iD+ot79J8jPLduvE+Yj
9EaJ+cW5TepRp51Kj3LguMnsS3sWs447C9L6V+XuNOmtShTypw9snxk9rfYJFyy2H2jcFT0bTWLx
Kun+5pP02vSf2Fv+s8iLJrzRB4vF1dKVXUqNynN/6JL1JIrFuxZakl0VpuEc8ZNeU/7qL9Ffbe9+
islnmTl09j4iuaO0fU0rVVKmrye97Et7b3Jb2Vzk2JjS2kKeHp/I8K70k7znvqyW/wC6vRXbtI3l
fSCtWK5hSVgDYBgBhQaIDVgBJQYAaaIBBQYAaaIBBQYAZa4AhqwBoA01cASAIaCBLChDRUCWAIaA
ENACGrlQIAENAA2ggQ0AIaKAbQANoAG0ADYANoqAbQAJoAG0ACaABSVwgEUWUlgUhgCWgBAQIYBp
q5QJaIDRQYAYAYAaCDVgBLQUbQClgZYAbSIBRQf/1voYel8h+VTADADRAJKDQBgBgBgBgBoiDQBp
oqjQBgBgBgBoIMAMIDQBgBlgDViqNAGggwoMAMIDRAYAYAYVBoAwA1YA0VRgBgBhAYAaIg0UGAGA
GAGAGAGAGmgAbKBIBgQYAYAYAaIowAwAwAwAwAwAwAwAywBqwBoKMKg0AYAYEGAGAGAGAGAGAGAG
AGAGEUaAMAMAMCDADQQasFGigwAwAwAwAwAwAwAwAwAwAwA0AYEGgDCAwA1YKNWKDADADADADADQ
BgQaAMAMAMAMsAJsFGgDADQQYAYAYAYAYAYAYAasVRlgDQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBg
BgBgBgBpgCADADYUZYAyxQbAMAMAMAMAMsAbsAZYAywBlgDLAGWIDYQYAYAYAYAYUGwDYUYAYgBa
ANgGAGAC0RRsqDADAoWiAwA2ig2FCiMjaCjZVCiIFEUYUC0AYQCkUCiA2AKQAoA2goWEGwoWEGwo
UiA2UCkQCgDZQLIDADZQYAbRAKAMAMAMANgGFAtEBgBgBgBgBgBgBgBgBgBgBgBgQaYAgKMAMAMA
MANBBgAgKMANBBgBpgCADADABDANAGAGioEsijQBoIMAMAMANhQsINhRtBAsKFoAXEAIgoWAEACI
ihaACxCgqACoAKgoKiAJEKDRACRACoKCogCoALEKCoALEKCoAKiKCoAKgoKgAqCgkQAsQoLEALEK
CogCoKCIAKgoKgAqCgiACEAQKCIAWgAkQoWgBYQbCjaAFIA2FGAGAGAGgg0AJYBgUaCDAg0FCQo0
ECJIARJBANoAGyoBsAGwgQwATQQCaABNFQCaABMIBsAE0ECAAbQQDaABsoBtBAJoAGwAbQAhoIBs
AQwgGwAbRUCGgBAQIaAENXCAYAlqwAhq5QJAENACGggQwAbAENACGgBAAhlANoIBsAQ0ADYAhoAE
wgGwBDQAJlAhgA2BqEsIEgA3kAIaKgS0AIKDRAaCDGrhQhqwQaCjADADaVyAWUGwBSIBQARBQQAI
gAqACIKCIANEALEig0QA0QoNEAMiALEKCxADIKCogyNEALEKCoAMiALEKCxACoKDIAJEgCxCgqAC
oKDIALEgCxCgkQAqAFoKFoAIAOaFF4iSjHawsmxaZzjoinZZyfrfHqMcu3sitObqNt5tmnELpU3W
ajHNsEmxZfJ0TT4yfrfwM8u3siuTqOq3J5tmnKjIRc3ZZtlQWSlTjoyGtLOT/VkY5d59kQFas68n
KW00427ArXALDhMNHAx8ZPb7OXWZdZNCGxeKeKld7NyNRyyuw1KyJvR2BUF4yp1pP2mbXbHH1DLS
GOeKdl5q2c+ZZGMstiJKwJXRujvlL1peYvWS10xx2CaW0lrfRU9m9r2LkSRcsvQVyRpyDvA4CWPl
ZZJbXwJtrGbE/pHHR0XBUqXnW7ub5knl0yvb4gpM3rO7NOAyjh5YmShBXbBJsXVRpdHKN3nN97fw
X6zM8vR7EFCxmKljJuc3dv8AVkbee3YZNXCC96G0RHRcPlFeykldJ+ivj+tpi13xx15oqmm9My0r
PhTXmx975+w1Jpyzy7hX2acxaejnR56RfjaqtSWxfWfw493Vm11ww2HPSfpEpp4eg7RWUpLfyXLj
x2bNskazz9IOfSOjziQ0ToippipqQ2elLcl+ti3kt01jj3DoelNJUeiNBUKCTqNZf8KXuXuRiTb0
ZZdk1ByCvVliJOc23Ju7b3s6PJQKnRliJKEE3KTsktrYNbHXtE6Ko9DaDxGIadVrPfb7MefF+5HO
3b1Y4zCbo5Xp3TdXTtV1KmSXmx3RXx4vedJNPNll3CAkVgdJ6GdDlibYrEq1NZwi/S+0/s8OPVtx
lk9HT6e/NDHpt0xelW8Ph3aivOa9Nr/Lw47eBccdM9Tqb8QczkbecT/Rro1V6SVtSPk04+fPcl72
9y9xLdOmGHcOp9JekVHoXQWDwaSq269W/pS4ye1d7ysnzk29OefZNQcCrVJVpOUm3Ju7b2ts6vEN
4bCzxs406cXKcnZJb2CTY79onRWG8HOFeIxDUq8lZtbW90Ie979ryWXG3ue3HGdObo4d0h0/W6R1
nWqvlGK2RXBe972dZNPJll3UQBXMdg6AdBFiLY3GK1JeVCEtkrelL7PBb9uzbzyyerpdPfmiM8IH
Tt6bbw2GdsPF+U/7xr/Kty37eFrjjpOr1O7xOByo6PMLT0T6KVelNbUh5NOOdSe6K97e5duwzbp0
ww7h2PpR0lodBMOsDgklWt16l/Slxk9qT63lZPnJ3PVnn2TUHnerVlWk5Sbcm7tvNtvezs8QcYHA
1NIzVOnFylJ2SXFkWTY9F6D0JhvB1hXicQ060lZtZtt7IQ69/e8lc429z3Y4zpzdHHOkPSGr0jre
NqbNkIrNJcFxfF+b15HWTTy5Zdwr3O+/rz5cXzeS3biuY6x0E6CrHWxeLVqKzhB7JW9KXFep9WRz
yyenp9PfmhPTrpl87P5NQbVC9vJ86q+C4Q5+k9idhjNJ1OpvxBzezbtaLlFZR/s6a4u+TfG91e13
Juy24Cb6O6ArdJKzp0G7f2uIlfZvUd+fDzpb9VNpS3TeGPdx+I7BprTGF8HmFjhqH7xryVk5PjOX
N8XlyaWq+cnc9OWU6c1BwjGV5V5eMxOcm7xpXe/fJ7Vf+OXFKzOunjt941KnLxiU14yu7RhSSyjw
TS38ILf52+LA7p0d0BT6HUXjca9fEyVss2r7KcFvk9mWW5eSrvlbt7MMezzeRyvpJ0iqaaxGs1r1
b2p015UKd9y3Tm9781br5avSTTz55d1Fd/4jn/fYmT2+cot9+vPvivtPzdMcfEdO6D9BFjJ/KsX5
ed7PNOW+79J327lszd9Xnlk79Ppb80SHT/pzChfCUGpNZT+r1PilvjsbylknGUxxa6vU9IOSTprD
Px2LvOrLNU28+TnvS4RVm19VWb6PNfvCpU/G2xGLbs15EFlKSWxJbIwWy9rbop52h99G9SWk142s
1ToQyiksvu0473xfbKV3mORtOelvo6SVLD083d+THdrTl6Un1XfmxjuLwnIzx3jf2bBxk1LKUreX
U6/qx36uzfJu2Q+6BTrw0N5NFqdffVWyHKnxfGf8P1nOV9kbjhYaJSniFrVXnGk93CVT3Q2va7Lz
nK61yNU8PLSF8VipuNO9tb0pNejBbMtm6MFbkmTnzQpzqabkqVKKhShdqN7Rgt8pSe/jJ7diysi8
HtDdfGwwcXQwt3rZTq2tKf2Y74w5bZb/AKqhvXiAsaENBLWrJTxHo03moc6nGXCG70vqtyuu34gN
DCS0i5YnEzap38qbzlKX1YLfL1RWbtlcmt+aN1a9TTMo0KENWCfkU4+uUnvf1pPYuEVZD2vAc1MV
DQqdPDyUqzVp1lsXGNP3z2vYrLOTld9vAHhdHwwkFiMVfVedOmnaVTn9mHGW17I72m0k15oH9P0j
q7sl92FOC9UYr9XbzcHnIFxWPhg4PD4V+S8qlW1pVOS+rDgtr2vckW3XiA2HwNPRUFWxK1pSV6dH
63CU96hwW2XJZk5Na838A2hTr9Iqzbd3a8pPKMIre90Yrcl1JXyLwnnIGxukYYeDw+Fv4t+fUeUq
jXshwj2vPY0tvpAXC4GnoyCxGKV3JXpUdjl9qW9Q9ct2WYWTXmholX6R1/rTfZGMV6oxS6kkOE85
UPcXjqejoPD4V31sqtXY5/Zjwh65bXlkQt14gRo/RkKcPlOKuqXoRWUqrW5cIr0pbtiuykx9aG2L
xdXTdWKSu8o06cVlFboxX6b2vMcFvcJapWj0bTp0mpYpq06izVPjGD+tulJbNi3snLXs/ERmi9FP
SGtOctSjDOpUe7kuMnuW/qLazJsE0ppRYtKlSWph4ebDe39aT3yfctiyIW7+AkMNhIaDhGviIqVW
SvSov1TmuH1Y+l1bXLUnb5oiYxr6dr76lWo/1ySXclyLwz5yolcZjKeiKcsNhpKUpK1asvS+xD7H
F+l1WRJGrdeJ+IZaK0UsYpVastTDw8+e9vdGK3ye5btryLazjjv4BOldKvSDjCEdSjDKnTWxLi+M
nve8SGWWxJ4TCw0FCOIxEVKrJXo0n6pzXD6q9LqJy1J2+aIS1bTNbfUq1Jdbbf66kuReGPOQn8Xi
IaBpyw9BqVaStWqrdxpwfD6z9LZsM8t37PiCK0ToqWlJPNQpwV6lR7Ix97exLa2W1nHHYPpfSscS
lQoJww9PzY75PfOXGT7kskJFyy34nAPovRtOhT+V4pfRJ2hDY6sluXCK9KXYsxVxnrRFaR0jU0rU
dSpteSSyUUtkUtyW5Bi3YsVOK6KwU5JPGTV4Rf8AZRfpNfXfor0Vm88icunsfEVnD4arpOqoQTnU
m+1t8fa2+s05ybFi0hioaHpPCYeSlKX7+qvSf1Iv6i3/AFnyM8ulvb4nzFWK5DCgwAwAwAwAwAwg
NNACbFBoAyxAIaANFBqxAaaAElBgAloASAaauAIAEtBAlgCGigQ0AICBDVgBDRQIaAEMAG0ECGig
G0ADaAByAByQANoAG0VAJoAGwATQANoAC0ECCiwlgUhoIEsKEtBAgoNAGmgBLVgDADADADQBgQas
AKCssWZALKDAD//X+hh6XyH5VMAMAMIDW0ASUGgDADADADADREGgDLACSqMAMAMANBBgBgBogMAM
AMsAJaKo0EGFBgBhAaAMIDADADRUGAGAGrAGiqMAMAMIDREGFBoAwAwAwAwAwAHLaAJKowA0EGBB
gBgBgBgBoijADADADADADADADADLAGrAGgo0VBgBgQYAYAYAYAYAYAYAYAYAYFGiAwAwAwIMANBB
gBqwUaKDADADADADADADADADADADQBgQaAMAMIDADViqNAGAGAGAGAGgDAg0AYAYAYAasFGgDQBg
BoIMAMAMAMAMAMAMAMANWKo0AYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAICjYUYVBlgDLAG7AG
WIDdgDAgwAwAwAwAwAwAwAwAwAwAwAwAwoMANgGwowA2gBQBsAwAwAWRRsqDADYUKRAYAbRQbChR
GRtBRsqhSIgURRhQKQBsgNooFkBsAUgoUEGwoWEGwoUggUFG0QCig2gBZAbKBaIDADADZQYALRAY
AYAYAYAbANooFEBgBgBgBgBgBgBgBgBgBgQaAEhRoAwAwAwAwA0EGmFCQDADQQYAaYUICDADAAYB
gBoIMKBBFGAGggwAwAwAwAWgDYApBQoIFxCgkQBaCggAtABIkULQAWIUFiAFiFBUAFRAFQAWIUFi
AFiFBUQBEAFQUFiAFQUFiAFRAFQUFQAVBQVABEFBUAFQUFiAFiRQWIUEQAVBQVABUAECghAERVBE
QBIgBIhQtACwgwKFIAUgDYUYAYAYAaAMCDQAkKMANBBgQaaChIAlq4ANhANgCGUA2ggHJAA2ggGw
AUkEApBAJooBNBANgAmEA2gBDQQDYANoAG1cqATQANoAGwBDABtBAhoAG0EA2VAhgCJIIEMAGwBD
QQJeYAgoENACWgAYAhoIENACGAIAENWAESRQDaABtBAhoAGwAbABsAGwgG0ADaABsoENBFhAFIYA
looEEAhlQIYBooNEBoIMAEtACQowAWkRBsoFIihQAoKCIAIgAiACIAIgoKggLEKCxIoNEANEALEK
DIgCxADRCgqCgyIMixACxCgyADIgCxCgsQAqCgqACxIAsQoKgAqACoKCogCxCgsQAqAFoKFoALGL
lktoILfhaEdE03OfnPb8EY5d5O0V2viJYqTlL/Q0427CILWdkVBaMNQjo2DnPzn+rIxy7ydogMRi
HiZaz/0NOVuwKOYQWTB4ZYGPjJ7fZ+ZL5dsZ2+RD4rEvFSu9m5Fc7dhqEE/gMGqK8ZPLeuXMlrrj
jryI7G4x4p/ZWxe8RjK7DFlYEvo7A+M8uezcuP5EtdMcQLSWP8e9SPmr1/kJEyy2Ig05h9o/APFu
781bfgS1vHHYfaT0gqK8VTy3NrdyRJG8svQVlmnEGwuDljZase18ERZNiyYvFQ0PT8XT879Zszy7
W9opdSbqNtu7e1m3AIhSdaSjFXb2IHIudCjT6P0nOec363wXIzy7ydkFJx2Mnjpuc9u5cFwRpwt2
I9lZF10JoaOEj8or5WzSe7m+fDh17MWu+GOvNFe07pqWk5ascqa2Ljzf6yNSac8stiuM05iw6A0A
9KS155Uk/wCJ8F73+lm3TphhsSnSTT6op4bD5JK0mt32V7+4kjWefpBztm3APNG6MqaWqKnTXW9y
XFi3S447HRsdjaPQ+gqVJJ1WsuLf1pcuC7Dny9Fswg5Hia8sVJzm25Sd22dXlt2G0abqtRim23ZJ
bWwg61oXQ1LopReJxLXjLderf0Y8W9/wu3zt29WOPZ5o5p0g07U07V15ZQXmR3JfHi/cbk08+eXc
K6zTmOg9DuiHzg1iMQvolnGL9Lm/s+3qMZZad+n09+aE9NemHy6+GwztSWUpL0uS+z7eraxxOp1N
+IOYM6POJno/0eq9Iqvi6eUVnOe6K+PBb+q7JbpvDDuHV9PacodBcOsLhUvHNZb7X9OXFvcvcrHO
TuenLKdOag4JiK0sRJzm3KUndt7W2dXi5CKOHlipKEE5Sk7JLa2wSbHetB6Ew/QDDPFYpp1ms99r
+hDi3vfuRxt7ntxxnTm6OMdJekdbpLWdWplFZQhuivjxe/qsl1k08mefdRWmVgdY6A9BPnG2Lxat
RWcIP07b39n29W3GWT09Lp780C8IHTv50bwmFdqCynJenbcvs+3q2scU6vU34g5IbeYWHox0ZrdK
K6pU8orOc3sivjwW/qu1LdOuGHcO2dIdP4fweYVYPCJePay32vtnPi3uXuVjnJ3PVllOnNQeda9e
eKm5zblKTbbebbZ2eK0PMFo6eLlGKTbk0opbW3w/XqTtNkmx6H0BoPD9BMM8VimlUt16t/Rjxk99
tvFpNvjbt7ccZhN0cf6TdJKvSOs6lTyYK6jC+UVz5velm99kkl0k082efcK296fbfLL7XBcIr22v
XMdN6B9CXpiSxOIX0C81PLxluC3QX82zZdGMstPR0unvzRK9N+mixV8Hg2nCKtUn6CSytwa5bG7L
PzWxxa6nU34g5RfJy1movKVV+dLioLh7trSaibeYTmgej9TpBUjRjHUp5S1eX15v2b3e0Uk3JS3T
eOPcOx6a0zR6C4eOFwsVLESXkQS/mlbd7e9nOTb1ZZdk1BwirXqYmtKet47EybcqjacY8Wm8svrP
yYrZsUl1ePn4hGGhKc9TD3nVfnVeF/q32Zvzn5TbSSXpCfcO69FuimH6G0Xi8S141Ru5y2RT3R4N
7OL2ZXscrdvZhhMPNHM+k3Sut0rquNDyaUU/KeSUdjbfop7H6Utm9RXSTTz559wqlHyr0sLwevVe
WW/N+ZDdxlv26q05/AdC6DdEVpN+MV1QWUqualUe+MN8YbpS86Syyu0sZZadunhsSnTTpu0/m/Ru
1eRKUN1stSFuG9rZsXEmOPrWup1PSDlClDRTtC1TEfWWcYP7P1pfa2L0bu0l05efgLdOOi25VvpM
Q89R5qL41OMvscfO3xc5OAt0dX9oxjcpSzjTv5U+Dl9WHDe1lFJeUh99CtSWkvp8RLUox8mNlw9C
nH27le8nd5k580ZeemPo6SVOhDN3fkxWzWnLfJ8dr82K2RHC+18BksR/yTYNSevlKVvLqcrLZH7K
27ZN5JQ36QL8ZDQeUGp4j6yzjT+7ulP7Xmx3XdpJyvs/EapYOOFSr4u7cvKjTv5U7+lJ7Yx5+dLd
l5SJrXmjcadTTknVqyUKULJytaMFujGK38IrN7XvZeD2hlXFPG2wuFg1TbVorOc3xnbbyXmx67tw
3vxAZ1oaBypNTxG+os40+UOMuM9i9H6w5X2fiBYbAQoRWIxV9WWcKadp1OfKPGW/Yru7RJPWjaVb
pDU3RjBfdp04L2LvbfGTzHtBeK0hDCwdDC31XlOo1aVTl9mHCO17Zbkmi3XiA1PCU9CJVMRFSrNX
hRexcJVPaobXvssm5XXbz+AbUMPV09UnVqztFZ1KstkVuXXujFbdiVtjhJO4bxukYzj8nwycaN1e
/nVH9advVFZR5u7ZbfSB9DDw6PpSqpTxLzjTeap8JTW+XCG7bLgTlfZ+IZYXB1dNznVqTtFeVVqy
2K/tb3RWb9l4Zk7grSGk4zh8nw6cKCd3fzptelN+yOyPXdtot9IHtLCw0DFVMRFSrtXhReyPCVRe
tQ37XZZNy1rt5DDD4ev0grSk5Xb8qpUk7KK4ye5LcuxLYhwmu4OsdpGFCDw2FuqT8+bylUa48I8I
9ru9kLfSBeC0fTwUFicUvJedOlsdTm+EOL2vYuKpJrzQzq1q/SCulbWnK0YxirJJbFFbEl3Laxwe
chKVsVDQMXSw8lKvJWqVlsXGFN+pz37FltnLW+3j8Qw0Xon5YnVqy8XQh58+L+rFb5Phu2vItrMm
xvSmlfl1qcI+LoQ8ymva3vk977FZE0W7EnQw0Oj8VWrpSrtXp0nsjwnUXrjHfteW1y1rt5EPSpV9
O17K86s3dt+tt7ku5IvDPnKiVxmOp6LpvDYV6zllVrL0vsx4Q9curINW68T8Qz0VolYxOtVl4vDw
8+e9v6sVvk/VteQtTHHfwCNK6VekXGEI6lGGVOmtiXF8ZPe9/UJEyy2JTB4OGg4RxGIipVZK9Gi/
VOa+rwXpdRN7ak7fN/AQs51tM1ru9SrUfW2/12JcgxyJ7E4iHR6DoUWpYiStVqrZFb4Qf+KW/Yic
ulvb49RD6K0VPSk2k1GEVec35sY8X7ltbLaxjjsO9LaVhUisPh044eDvn505fXlz4LYlkJFyy9Jw
F6J0XDUeKxN1Qi7JLKVSX1Y8vrPcuYpjj60R+lNJz0rU152SStGKyjGK2RS4FkTLLYnsJh49G4Rx
FZJ4iSvRpv0VuqTX+FdpnluTt8+ordqmkam+dScutts058iz4qtHo3Tlh6TTxE1atUXoL+7i/wDE
+zqzy6W9vj1FQNOQwAwAwAwA3YihVgDLBAloKNFQYQCWgoSVBhAJaAElBgBpogEWKDADTVwBDVgD
TVwBAAhooEtEQIaKBDQAhq4QIKBDQAhoAG0ECGgAbRQDaABtAA2gAbABsqATABtAAmgAbQAFhANo
oEtEGoSUCGgBIQIaChJUGAGAGmgBIBgBgBgBoINhWS0rAGAGAH//0Poael8l+VTQQYAYAYQGmrgC
bWKDQBgBgBgBgBoiDQBgBqxVGgDADADADQQYAaIDADADADVgBJQYUGAGAGEBogMAMAMKg0AYAYAa
sAaCjCgwgMANEQaKDADADADAAcwBJVGAGAGAGggwAwIMAMAMAMANEUYAYAYAYAYAYAYAYAasAasF
GFQaAMCDADADADADADADADADADADAo0QGAGAGBBgBoINWCjVigwAwAwAwAwAwAwAwAwAwA0AYEGg
DADCAwA1YqjQBgBgBgBgBoINAGAGAGAGWAE2CjQBgBoIMAMAMAMAMAMAMAMAMAMsUGrBRoAwAwAw
AwAwAwAwAwAwAwAwAwAwAwA1YKNhBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBhQYUGAGACiK
MAFIIFBRgBgBgAsgNlBgBsKFIgMANooNhQojI2go2VQpEQbIDZVCkAbIDZQLIDABSChQQKChSCBQ
UKRECiqNogFFBsAWiA2UCkQGwDADZQYAbTIBQBgBgBgBgBsAUmAbAMAMAMAMAMAMAMAMCDQAkKNA
GAGAGAGAGggwASwo0AYwDQQYAJYUJCDADTCBAUYAaCDTAEhRoIMAMAMANIA2AKQUKCDYULQQKiFB
EAEQULQASIAuJFBEAFiAEiFBYgBUFBUQBUFBUAFiAFiFBUAFRFBEAGQARABohQSIAWJFBUAFQUFQ
AVBQRABURQVFAVBQWJFBIgBYgBYhQVBQVABEAERFC4gBIgBEFBEALCDAoUgBSANhRgBgBgBgBoIN
BBjQUJCjADQZGACGGhoIENWABsIENFQDYANgA2EA2gATQQBaABsqAUkACYQDaCAbQANgA2ECGACY
ANoqAbABsAQ0ADaCBDABsIBtACGioEAA2ggQ0AIYQIAEtACHmUCABDQAhhAhgA2gBDQAlgAwBAAN
lANoIENAA2gAbQANhANgA5IAG0AIZQhDQGiGECQAbyKBLQQIYAmwBoA0AaCDADTRAaSAFFBsKFIg
FFBtEUEQARABEAEQARBQVABYgBokUFiAGiAGiFBUQBYhQaIAVAKMgrIsSALEKDIAMiAKgoJEALEK
DIAKiALEKCxACxACoKCoAKiKCxACxAFoKFoAteicCsPHx1TLK6vuXEza7YY68iLx+OeNlf0VsRZH
PLLYZxKyLLozBKgvG1MssuS4mbXbHHXkRuOxjxcvsrYiyMZZbDJBkT+jcF4teNn2fElrrjj6hljs
Y8U8vNWz4lkYyy2GIQTOjsFr+XPZuXvJa6Y4gWkMb8oerHzV6xImWWxFlYElgMD8petLzV6yWtY4
7B9I46/0cNm9+4SLll6CCZXMPMFg3i5W2JbWLVxx2JXH4xYKPiqeT9n5kkdMrrwKuzTiF0MPLFSU
Y7SLJsWatVhoWnqxzk/W+L5GeXb2RTq1V1m5Sd2zbhfICoOo7JXb2IAuODwkNC03Uqef+sl+vUZ5
dpO0U/SGOlj560tm5cEa045XYjWVkW3QehVBePrZJZxT9r93eZtdsMfWiJ09pp6QepDKmn3837kW
RnPLYrLK5Cb0HoOWlZXllTW18eS/WRLdN4Y9wnOkGnI4GPybD5NKza9FcFz48OvZJHTPPXiDnLNv
OHGA0fU0nUVOmrt79yXFjelk2OkYivR6HYfVh5VWXfJ8XwS4dnFnPl6LZhByfF4meMm6lR3lLazo
81uw0UXN2Su3sRWR1TQOg6fRyk8VimlO2/0VwXGT/Jc+du3qxx7fNHPukWn56dqXeVOPmx4c3z/0
NyacM8+4VqRpzF56I9EnpVqvWVqKeS+u/hx47OJjLLTt0+nvzQ66ZdLlWTwmGdqaynJb/srlx47N
m1jivU6npByyR0ecSmg9BVdP1lSprLbKW6K4v3LeZt01jj3Drel9K4foHhlh8Ok6zV0ntv8AXl7l
2bEc5O56csp05qDg2KxE8XN1KjcpSd23tbOzx27AKdKVeSjFNybsks22wg7t0e6P0Og+HeMxjXjb
derf0Y8ZPe+zZdvlbt7cMZhN0ch6T9JavSatrzygsoQ3RXvb3v3G5NPLnn3CrmnMdP6B9BXpdrE4
lWoJ+TF+m1/l9uzic8stPR0un3eaHHT/AKdfLL4PCO1JZTmvSt6Mfs8ePVtY4r1epvxBx9nR5ROd
HejlbpLXVGkrLbOb2RXF+5b2S3Tpjh3Udw01pjC+DfCrDYZJ15K6T23+vP3LfsWSy5Sdz15ZTpzU
HnjEYippCpKpUbnUm7tvNtnZ4bdh7hcDdpW1pN2UUr57lzf62ZqLIO/9G+j9LodQeNxjSq2z36if
orjJ72uq7zk+Vu3twx7JujknSjpPV6S1teV1TX7uHBceV98nnwsjpJp5s8+4Va9rW7Gl6or2t59u
3TmOk9Beg7021XxCth4vKP12ue9cX2Leo4yy079Pp93m8Cb6ddMlKLwmGlqUV5M5x2ytlqU+W6Ut
m7lKY4t9TqekHKZQs1Bxzv5NFX28ZtZ35bdvmKx0ebX9Qk9EaKq6axCpUrVK2+X9nSiuFsnbd6N9
ik2mpbprHHuo7biq+H8H2E1KbUq0s3Ke+T9Ob2222irt7F6TXL2nruunBwnFYyelJTqyk4wk/pKs
vOm+CS9UI5LLWdkmuvDyW7DeEPHwsr0qF7cZ1Gu7WfLKMeTd5VB2/ot0dpdG6HyzGJUlFa0YPPU5
yfpVHs+ze0UrtHK3b14Y9vmjm3SnpJU6Vz8ZUbpYODepHfJrel6UufmwWV7vytyacM8+/wCArNnj
IXf0OGi8t7k/Vrz55KN/RTSNOfPwFy6IdF5dKpZxdLBQea31JLc3ld8XsjeySbMW6dcMO74C4dL+
k/iovR+j3GEYK1Wqso047NVNb92V3uSctmcZ610zz9IOPU5eMvh8Gn5S8uo8pSW+72QhxV+cm8ku
jzb9INwqxwLVPC3nWlk6iTvd7qa2/i857lFXuTeuBiVPQ23VqYjhk4U+vdKXLOK36zyTk9n4gjoL
D/T4xuU5eVGm29aV/Sm9sY/zSWyyesDWuRipT0n9PiJalFeSrLh6FOOSy7Etrd3mXW/NG9apph+J
oxVOjDyrX8mK2a9SW9831RSyRODkani44ZeIwl25eTKpbyp39GK2xi+HnS35eShvXAKqdPQWc0qm
I3R2xp/e3Sn9nzY77vyU5PZ+ITSwnjl8qxcpKEm2s/LqPfq33cZPJbrvIpJ60Y5VdPSUIJQpwTaj
shTjvbb9cndyeWeSJwe0N18fDBxdHC38rKdW1pT5L6sOW2W/6qLbrgFjhaehEpV0p19saL2R4Opz
4Q2/Wssm5NdvIHQw1TTEpYivPVpp+XUl6oxW98IrJLhFXCSb80Zisc8bbDYaDjSutWCzlOW5yt50
uC2LYltu0W78QO7w6O7LTxXHbGl1bpT5+bHm9jlfZ+IaYPR/ytPEYiTjRu7zecpy26sL7ZcXsW1v
i2km/NGYrGT0tKNCjDVpp2p0o55ve98pPe31KyyHC278CQ8ZDo7lBqeK3zWcaXKO5z4y2R3XeanK
+z8QywGjfladevJwop+VN5uT26sV6Un3La3xrMm/NGsdpGWkdWjSjqUovyKazzeV39aT3vsSSyBb
sSKUOjW208Xw2xpde5z5bI83snLfs/ER2A0fPS8pVJy1YRzqVZXaV/W5Pclm33l3pmTYNpHSkakP
EYdOFBO9n5039ab3vgtkd3FyQuXpA7w+Cp6Giq2JjrVJK9Oi/VKpwjwjtlyW2rJrzfwDCMcR0hr7
51JbXsSS47oxS6kkOE85UP8AFY6noqDw+FetKStVrfW+zDhDi9surINW68T8Q30ZoqNWLxGIbhh4
u115039WC3vi9kVm+DWsyet4A9J6UlpJxikoUoZU6cdkV7297ebZNFuxL06MOjSU6qUsU1eFN5qn
wlNfW3xju2vchy17PxELhsNW05WsrynK7lJvZxlJvYlvbLwzJ3CTxukKej6bw2Fd08qtXY6nJcIc
tstr4DTVuvEDfRWiViYuvXbhh4Pypb5P6kFvk+5LNi1Mcd+bwB6V0o9ItRSUKUMqdNbIr3ye9vNs
kTLLYlcNhIaChGviIqVWSvSov1TmuHCO2XUTlqTt838BBylW0xWu71KtR9bbf66kuReGORPYjEQ6
OwdGi1LESVqtVbIrfCD/AMUuxE5dLe34iG0XouelZ6sbRjFXnN+bGO9t/q5axjjsPdK6Ug4LDYa8
cPF3bfnVJfWl7luXMSLll6QZonRUKkXicS3HDwdsvOnL6kefF7EhTHH1vAaaV0pPSs02lGEVaEF5
sY8F73tbLPCZXYmsDhIaCpxxWIipVJK9Gk/8c19XgvSfIm9tydvm/IV6vXqaSqOUm51Jvrbb/WSD
nbsWepNdFIOEWnjJK05LPxSfop/Xe97tiJy6ex8RTtppyGAGAG7BRuxAbsAYEGwDADQBpoKElQYQ
CWgo0UGgg00QCbFUaCDVgBLRFGioNNXAEACWgBIAhooENEQIZQIaAENBAhooEMAG0AIaABtFQDaA
ByABtAA2gATQQDaKATQANgA2gAEkUCWiIEFAhgaJYAhoASwgQUGgDADADABLQBoAwAwAUkBlsAwA
wA//0foael8l+VTADQQYAYAYQGgBLRQaAMAMAMAMANEQaAMAMsAaKo0AYAYAaCDADCA0AYAYAYAJ
aKDQBhQYAYQGgDCAwAwINFBgBgBgBqwBoKMKDCA0RBooMAMAMAEyQAOwBhVGAGAGAGAGBBoAwIMA
MAMAMANEBgUYAYAYAYAYAYAYAYAasAasAasUGAGBBgBgBgBgBgBgBgBgBgBgBgUaIDADADAg0EGA
GrBRqxQYAYAYAYAYAYAYAYAYAaAMCDQBgBhAasFGrFBgBgBgBgBgBoINAGAGAGAGmgoSAYAYAYAY
AZYAywBgQYAaAMAMAMAMANWKoywBoAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwA
wAwAwAwAwAwAwoMAMKDADADABRFGACkECgowAwAxACyA2UGAGwoUiAwA2ig2FCiMjaCjZVCkRBsg
NlUbQQKIo2UC0AYQCgoUEGwoWgg2FCkQCig2gBaIDCgWiAUUG0QCgDADADZQYALRAYAYAYAYAYAb
KBaZAYAYAYAYAYAYAYAaCBIUaAMAMAMAMANBBgBgAgKMANBBgBgAhhRoIMANMIEBRgBoqDTIBIUa
CDADADTANIAUAbQULCDYUKQQKQUEACIKCIAXEAWiKCIAKgAqCgkQA0QoJEgCoKCoAKgAqCgqACxI
AqCgqACoKCoAIgAsSKCxACxCgqACIKCoAKgoKiAKgoKgAqCgkQAsQoLEAKgoJEAJEKCIgCIAWgoI
gAgQYFG0ALANhRgBgBgBgBgBoINBBphRoKMCDQQaYUJChDCBDCAbABsqAbABtBAOQAOQAKQQCaCA
TRQCYQDYQDYANgA2ECGgATAByRUAmgBDQANgCGADaCBDQQDaAEFQDaAENBAhgCGAIaAEBAh5ACZI
oEMAQADaAEtBANgCABDQAOSKBDQANoiBDRQDYANgA2gAbQQDaABtFAhgCGgjRAAhgCGUCGQCGioE
gGAGmgBIBoIMAMAMAFIihRQbIoUkEBEFBEAEQARABEFBEAFiAGiRQaIAWIAWIUGRAFQUGiAFQEoq
CoNEgCxCgqADIAKiKCxACxCgqADIgCxCgsQAkQoMgAsSALEKCxACxAFoKJ/Q+jflL15LyVs5v4Gb
XTDHYJpfSPj34uPmrbzfwEhllsQyNOYndE4Dxz15eatnP8jNrphjsb0lj/lD1I+avWxIZZbEUacx
L6MwPjnry81bOZm10wx2FaRx3jnqR81beYkXPIRRpyEno/BfKHrS81esza6Y47DjSONv9HDZv+Ak
ayyEMVzDzBYN4p/ZW1krWM2JLH4xUF4uGXHkJGssteBXzTiDYbDPFS1V2vgRqTYnMViI6NgoQ879
Zszy629oq8m5O72m3AZTpOvJRirthZNiz+RoanfbJ+t/Axy7eyKliK8sRJyk7tmnG3Yb2vkioLZo
/Ax0XB1avnW7uXWZvl2xnb5FY0lpCWkJXeUVsXD8yyOWWWxFMrIs2g9DeN+mqryVnFPfzfL29W2W
uuGPqGmntN/LH4um/o1tf1vyEiZ5bFVkacRK6H0PLSs+EF5z9y5+wlum8cdiyac0zHRUPk+HspJW
bXor4/raSTbrllrxBziTubeYFwmDnj6ip01eT9XN8gsmx0duj0QofWqS75P3JfrNnPl6fGEHLcbj
J4+bqVHeT/VlyOjy27DFq+wqDp/R/QMNCQeKxVlJK6T9Ff8AC9mzac7dvThh2+aKP0j6QT05PeqU
fNj73z9nt3Jpxzz7hV2achcuinRV6YkqtVWop/xvguXF9i5Yt07YYdwlOmHStRTwmFdopas5LZb6
seXF9hMcWupn6QcqZ0eYSGh9DVdOVVSpL7z3RXF/rMW6axx7h1vSOkMP0Bwyo0UpVpK6T2t/Wly4
LsW9rlJ3PVbOnPA4XjMVPHVJVKknKcndtnWPHbsNI03VajFNtuyS2tsrI7j0a6OUeh9F43GNKrbr
1E9y4yezLqW9vlbt7cMOzzRyvpT0nq9JautLyacfMhwXF8W977Dcmnmzz7hU2ach0foN0Hem5LEY
hNYdPJfXa3fd4vfsW+2MstPR0un3ebwJPp705U08Fg2lTS1ZzjsaWWrG27c2tuxZbZji11Op6Qca
Z0eUTGgNAVukVdUaK5yk9kVxf6z2Et01jh3Udz0ppLC+DPCKhQSlXkrpPa39efLguxb2ucnc9ls6
c8Dz7XrVdL1ZVaknKcneUn+u5LYlwR14eLew7o0FT8mKbk3bZdt8Le5Z+qRFHdei3Rml0UovG41p
VEr2eeouHOT5dWbu3yt29mGHZ5o5b0s6V1Ok1W78mlF/Rw29tvSlz81bFe930k082efcKk9/e87r
rk975fmjbkOhdCOhU+kEvH1k44dbW8nU+yuEdza6l9nGWWnfp9Pu8+gtvTLplGgngMCk3Fas3HKM
UsnG+SSW/YlsbyaeMcfV16nU9IOQQk23OMrtedWeSjwUFx4WV7bFFJs6vMJLQmhaunZqjh04wltm
/OkltfKK3rYsk3KWqnLdNY493A7Vi8ZgvBnhFCCvVkso+lN8ZPcvZsSOXtPVbOnBw7S2kKmkajr4
1uU3nGkstuy/1Vs+00lsVpHWR5MrvzQ0rrxbTxC1p7IUVkorcpW81fZXlPNtp5sl+/8AAdl6I9FF
oqPzjpJpTirwi8lTjuy2J8IrzeGts55XfiPVhhrzRTemnSl6WqWqJ+Lg/o6F7Z/Wq22PhBZpbXHb
LWM05dTPf9gU6vHxb8Zi/KnZatJZWW7WtbUjwirNr6qakacfiLl0W6F1ulU1XxV4UI2tFK11tUYr
0Y77773W25m5adcOnc/NF96XdI6WgaKwuHfioparcNqS2xpr631pvKOe2eRiTbvnn2+IOI2lpON3
ajhoPrV/bOo+/wC7FZdXk5+AyMpY9Ohho6lFZzbdrpelUlstwjsTsknJ3Y58QZGsqT8Rg05Tn5Lq
JeVK+1QW2Mf5pLbZPVQ+6DNanoXzdWpX45OFPq3Slz81btZ2acnsgnyaOE+mxd5VJeUqTb1pXz1q
j2xT2286XJPWBrXIxUp6V+nxEtSjHyU7ZZehTjld8lZK921fOLz5ox1Z6Waw+HhqUlnq34enUlkn
bi7RjuSHCc+IFSxcNFp08M9ao8pVvaqe9LjLzpfZV06b1x+IXHB09DrXxC1qu2NHhwdThyhte+y2
zk1rn8AmnQqaXcsRiJ6tNZSm13QhHK7tsirJLbZDg1vzRqrip6SccNhoONO/kwWcpP603vf8sVsS
zuN78QH8dT0FlSaniN9RZxp8ocZfb2L0frDld9vxA8Lo6MI/KMU2qbzjH06j5X2R4zeXC7yCSetG
TqVukFSNOEUoxT1YLKEI73d7FvlKTu9rY4PaBquOp6Ji6WFetNq062y/GNPeo8ZedLksm5XeuPxC
cLo6GDgq+KvqvOFJO0qnN/Vh9ra9keKbJNeaBuVfpHVUUlkvJivJhCK9UYre31ttjg9oOq2Op6Ki
6OFd5NWqVtjfGMN6jxfnS5LImtluuPxCMHo2FCCxGKuqb8yCylU6uEeMuxXeyknrQGtXrdIKsYRj
f0adOKtGK4JblvbfW3vHCecg/niqegE4UJKeIatOstkOMafPjPsjlm3Le+3gM9HaKWJi69eWpQi8
5b5P6sFvl6ltfNazINaR0m9IatKnHUoxfkU1nm97+tJ732KyyEiXLYk40YdG1rVEp4rbGm840uc+
M+Edi2vPInLWu34iMwuEradqyd7t3lUqSeUVvlJ8P9EXhJO4O8dpKnh4PDYW6pvz6jylVa48I8I9
ru9jS268QZo/RcKUFicVdUfQgspVWt0eEfrS3bFdktJPWhrj9IVNL1FlZLyadOKyit0Yr9NvN5hm
3YmrQ6LrdLGd8aPudT1R5vY5b9n4iFwOAq6ZqNJ3ecpzk8orfKTe729ZeGZO4SGP0lTw9N4XCX8X
/aVHlKq1x4RXox7XmFt14gTozRMakHiMQ3DDxdsvOm/qw58XsiS0mPrQ30ppWWk5JWUKcFanTWyK
97e9vNsSJllsS1DDQ6PQVavFSryV6VJ7I8JzX+GO/a8ictSdvIgvptM1vSqVaj622/11Jcise0J7
EYmHR6Do0JKVeStVqrZFb4Qf+KW/YhrbdvbxyIfRWip6Vm4xajGKvOb82MeL9y2tlvhnHHYe6U0p
Bw+TYa8aEXdt+dUl9aXujsXWI1b6Tga0TomNaLxGIbhh4Oze+b+pDi+L2JZslqY4+t4ANLaVlpSS
yUKcFanTXmxjwXPi9rYiZZbErgcFT0PTjisTFSlLOjRfpfbn9hbl6XUTlqTXm/KCAxeLqaTqOpUb
lOb/ANEvYkVi3Ys+XROG542S6/Ep/wCd/wAq9c5dPY+Ip0pObu829rNOQ0AbIo3YA3YINgGFBgBg
BsijCg0RBqwUJANBBpoATYKNFQZYgENBRoqDABLRFCSoNNACABDVgBLQAhlQIaAENACCoEMgENFA
hoAG0ADaABtFQDaABtAAmADaABsqAckACaABtAAZIAGAIaKgSwBDA0S0AIAEtACQDCoNAGAGAGmg
BNgDABaAywAwAVYgP//S+h9j0PkvyqJKDADQQYAYAYQGgDTQAkoMAMAMAMANWANEQYAYAasFGigw
AwA0EGAGAGiAwAwAwAxoAQ0VBhVGAGAGEBogMAMANFQYAYAYAYAasAaCjADVgg0AYAYAakAIAMsA
asAaCjCgwAwAwAwA0EGAGBBgBgBgBgBogMCjADADADADADADADLAGrAGrFBoAwAwIMAMAMAMAMAM
AMAMAMAMAMCjRAYAYEGAGggywUasUGgDADADADADADADADADQBgBoIMAMIDVgo0UGAGAGAGAGgDQ
QYAYAYAZYASFGgDADADADADADADADADADADADADADADLAGrBRqxQYAYAYAYAYAZYAywBlgDQBgQY
AYAYAYAYAYAYAYAYAYAYAYAYAYAYUGwDADADLBRgBgBgBsAwAWgg2FGAGAG0ALIDCgwA2FCkQGAG
0UGwoURBtAGyqNoiBSANhRtBAoijYApFBsgNoKFoINoAUgoUgBSAFIA2AKIg2VQpEQKCjaKBZAYA
YAYAbKDaIBQBgBgBgBgBgBtACwDADADADADADQQJCjQBgBgBgBgBgBoIMANMKEgGAGggwAwAGAYA
YAJYQJCjADRUCWRRoA0EGAGACWFGkECwDABaAFBRtBAsKCAC0AEQULQAQiggARABUFBUAFiFBYgB
EQBUFBUAFQUFQAWJAFiFBYgBUFBUAFQAWJFBYgBIhQWIAWIUEiAFQUFQAVEUFQAVBQRABohQSIAW
IUEiAEiRQRABAAgAQKFoA2AbQAsA2FG0EGmrBRgBgBgBgBoINACWAYFGggwIEsKEgA2ECGgAckVA
OSABsAGwgG0ACkggDIIByRQCkggG0ACkggQ0ADYQDYANoAG0ACaKgG0AIaAENAA2ggQwAbCAbAEN
FQICAbQAloAQAIaAENBAkoBvIATJACGgAbCBDQAhgCGADaABgCGUA2ECGADYANoAGwgGwAUkAIaK
BAGoQ0ECWAIAEMoENBAgKNBBgQaaChNgDQQYAbChSIBRQbIoWggVEKCIAJEAIgAiCgiACxADRIoL
EANEALEKDIAKiALEKDRAlFRFQaIAWIUFQAZABURQWIAWIUFQAZEAWIUFiAFiFBUAFRAFQUFiAEiA
SejcC8dO3orayVvGbE/pbHLCR8TTyds7blw6yR0yuvArCNOIk9G4F4yWfmra/cS1rHHYl9J41Ul4
qnllZ23LgSR0yy9BX0acRI4DBPFy+ytr9xLW8cdiS0ljVSXioZcbbuRJG8steBAIrkH2DwjxUrbl
tYtXHHYlcdi1hl4uGT9n5mY65XXgV805BzhcM8VKy7XwCybE1isRHAR1IbfZzMuluhXW7mnELo0X
Xkox2gk2LBUnHRVOyzk/XzM8u1+yKzObqNt5tmnEDjB1HZZtlBZqNKGiabnLzn+rIxy7SdorGLxM
sVLWl/oacbdhoyoLRozR6wcfHVcmldX3fn+tpm12xx15ogtKaRePlwgti97LI55ZbENIrAn9DaH+
VPxlReQti4/kS10wx2M07pnx16VJ+QtrW/kuXt6hIZ5bFRZpyEhovRUtKTssorzpcPzJbprHHYtW
l9KQ0JTVChZTt/DzfN/mZk265ZdviDnE25O7zbOjzjeHws8ZNQgryewEmx0enTo9EqGtLyqku+T4
Lgl+szny9PjCDmePx09I1HUqO7fclwXI6R5rdiOZWR0jo70fjoyHyrFWTSuk/RXF8+C3deznbt6c
MNeaKl0k6Qy01PVjdUovyVx5vn7DUmnLPPuFUZpyFr6L9GJaZl4ypdUYvP7T4L3vs27M5XTrhh3C
d6WdKI4WLwmFsklqylHYl9WPve7Z1TGN9TPXiDlEjo8we6L0TV0zVVKkrt7XuS4slulxx7h1zF4r
D9AcMqdNKVaWy+2T+tLhFbl2Lezn7T1WzpwcPx2MqaQqSq1ZOU5O7b/Xcjrw8duwyUXNpJXbySKg
7X0X6M0ui9J43GtKolfP0F75PZ6kcrdvXhh2eaOZ9K+lNTpJVvnGlF+RD3vm/VsXPcmnnzz7hUGa
cx0DoT0Jlp6Sr1k1h4vqc2ty5cX2LO9sZZadun0+74Cd6d9No0ovA4JpRS1ZzjkrLLUjbdub7OJM
cXTqdT0g4tI6PIJXQmg63SCsqNFXb2vdFb2+Xt2bSW6axx7qO643G4XwZYRUqSU681dJ7ZP60uEV
uXYt7OXtPZbOlBwfFVKulKkq+Ik5Sk7u+1+5JcN2SyTTOs8PHz5o3stGK32SXHhxvy87fl5zoO29
E+i9PoxSeOx1ozSuk/QX/CfBbNmbzOVu+Hrww7fNHNul3S2p0mqNebQg/JhfL702tr+ytmzanfeM
04Z59wqCTm0ldt7Lec+SW5frNZLTkOh9Cuhb05NVKq+hg87ea3wX1nxeaWy8tixllp36fT7hbem/
S+OCg8JhZeLivJnUjtVsnCmt7+s9kdl9Yzji69TPXiDjckoJRknGLtq0l58nucn7MvuxSdzq8okM
Bo2ppWtGjGKnV9GksoU1vc2uG9bW/Oet5Lm9NSbHcW6HQHDWX0uJqLknJpd0KceyMVzZy9p6v7bn
3jh+M0hV0nXlU1vG4h5upshBL6t8kl9Z7N2flPo8lu6GVDyZOOH8urtlWeSjxcb+avtys+GrvrM+
4dp6FdDKOhIfLMTZzS1lKeSitutZ7Ot523RzRyyy29fT6fb5oqPSzpvU6QVfEYJPUTyls2ekr7Lb
dZ+atmrm3qY6cs+p3eIKHRawklCh9LXb89K6T+wt7+09norJSe3HjgXLof0Relqus3r6r+kqedCL
4RvdTnzzhHb5V0Ztdun09i+9Lum1HoxD5JhbSrWs87qF98ntcnt472+Occdu2fU7fEHFK0G34/Gt
ylLONPZKS3X+pDhva81W8pdHk++jHCWkEq2Ifi6EcoJL+WnHfzbyvnKTbzHPI0nPSq8XSSpYeGbu
/JX2py2ylwyvujFbC8HIxV7/ALPgoybnlKdvLny+zHktu2TexDfpBnjKehfMcamI+vthT+7ulL7X
mrdd2knJ7IWsJHCfTYy8py8qNK/lSvnrTe2MXt+tLdZPWMrrXIxU6mmX46tJU6MMta1oxW6EIra/
srrbWbHCchUsRLHWwuEg1Tb83bKbXpTfLbbKMe9upvfiAnj6ehMqTU6++os4w5Q4y+3u9H6xOV9n
4hNLAxw0VXxbflZwp38upzb9GP2nm9ye1DWvNGrVukM/RjTpr7tOnH3euUnxkxwe0N19IQw0XQwt
9WWU6jVp1OX2Y/ZWb9JvJIW68QHhg6ehFrYhKdbbGi9keDqe6G1+lZZNyuu3n8AGlh6unZyrVZ2h
G2vUl5sVuSS37owj3JLJwmu4Zi9JKUfk+Gi40m1f69R7nK3qislzeY0W+kDqOGp6A8qslPEejSec
Yc6nF8IbvS+q3K67fiGuHwtXTk51qs7RWdSrLYvi90YrN7ErbHBruBMbpOKh8nwycKPpN+fUa3yt
u4RWS5vMSJcvSBzTwVPQiVTEpSqtXhQe7hKpwXCG177La5XXbz+AZ06WI6RVnJu8rXlOTtGMVvb2
Rity7Etw4TVyDnFaRp4GDoYS9pK1Sq1aU+S+rDlte/gjVuvEGYLRkMPBYjFXVN+ZTWUqnVwjxl2K
72NkmvNDfE4utp2rGKjf0adOCyiuEV7Xte1sa0zb3CUdWHRtatNqeK9KazjS5Q4z4y2LYs8xy17P
xEbo7RktJuU5y1KUc6lWWxX9snuSzb7xtJjsF0jpWNSHyfDpwoJ3s/Om/rTe98Fsju4jS3L0gd4T
R1PRsFiMWr6yvSo7HP7UuEPXLdlmTZJrzfwEfXr19O1le86krRjGKyS3RilsS4FTzkJmdeHRtOFJ
qeKatKos1T4xg98uMt2xcSctb7fiIjRmi56Vk81GEc6lSXmxXF8XwW1stumZNh3pHSkHD5Nhk40E
7tvzqjXpS90di6wty9ICaO0XCnT+U4q6o38mKylVa3R4L60t2xZktJj60MtJaTnpWacklFK0IR82
K3JL9NsSJctiap0IdGoqpVSlimrwpvNU+Epr62+Md217kOWvZ+IgadOtpitZXqVaj623xf6skXhj
2hOYnF09BQlQw0lKrJWq1l64QfDjLbLqJy3b2+J+IidFaJnpSTSajCKvOb82MeL9y2tlt0zjjsPd
KaUhKCw2GTjh4u7v51SX1pe5bERq5ekG9E6JjVi8RiG4YeDs2vOm/qQ58XsSzFqY4+t4DXSulZaU
kslCnBWp01sive+L2tiRMstiVwOAp6JprFYpXbzo0X6f2pcIL+bqI1JrzfwEDjcbU0nUdSo3Kcn/
AKJLhwRWLdizQhHopFSlZ4yS8mLzVFPe/tvcvR2snLp7HxFQnN1W5Sbbbu29rZXMJKDdgDdgg2AY
AYAbsFGEBgAqwBlggSFGrAGgg1YKNFBoiBLQUaKDQQJaIo0UGgg00FCAgS0AJ2gCCgQ0RAlooBtA
CGgBDVyoEACGgAbQANoAG0ADaKgG0ADYAJoAG0ADaKgE0ADaAAyABNBAkAQUCWgBAGiWgBIQasAJ
sFGgDRUGAGAGACbBApBWawA2lcgCAH//0/ogeh8h+VTTQUJAMKDQQYAYAYQGgDTQBooNAGAGAGAG
AGiINAGAGAGrFUaAMAMCDQBgBogMAMAMAMCBNig1YAwqjADCA0AYQGAGBBooMAMAMAMAMsAJsFGA
Ggg0AakAIAMAMAMAMsAasAaCjCgwAwAwAwINAGBBgBgBgBgBgBgBoijADADADADADADADADVgDVg
DVigwIMAMAMAMAMAMAMAMAMAMAMAMCjRAYEGAGggwA1YKNWKDADADADADADADADADQBgQaAMAMID
Vgo0UGAGAGAGAGgg0AYAYAYAasVRoAwAwAwAwAwAwAwAwAwAwgMKDADADADADADADVgo1YAwoMAM
AMIDQBgBoIMAMAMAMAMAMAMAMAMAMCjLAG7AGWKDADYBgBgBgBgBgBgBgBgBiAFoA2AYAYAbQAsg
MKDADYUKIDADZQbChREGwDZVG0RApAGwo2ggURRgAtFBsgNoAWgDYApBQoINoKFhBsKFEQbKoUiA
UAbKBREGwowAwA2UGACkRBsKMAMAMAMANgG0wBQBgBgBgQJbANBRoAwAwAwAwAwA0EGAGACAowA0
AYEGAGmFCAgwAwAQwDQBgBoIEBRjCDQBgBpgCQDQAtAGwBaCjYQKQULCBaCgkQBaChYAQKCIgCIA
KgoKgAqACxCgsSALEKCIAKgoMgAiIAqCgsQAsQoKgAqACoigqACoKCRACoKCRADRCgkQAsSKCoAK
goIgAyCgqACRCgsQAiIoWAEQARABEFBEAbANoAWAbCjaCDbQAkKMAMAMANBBoIMYUJCjADQQYECG
goRIAGwgQwAbKgGwAbCAbABMIAtAA2ggE0UAmggGwgGwBDVgAbQQDkACYAORUA5ACGgBDABsAG0E
CGggG0AIZUCGgBDQQDAENACWgBAQIaAENFAgAQwBDQAhoIBsAQwBDQAOSAENFANoiBDRQCYAhgAm
ADaCAbQAgoEMCwhhFIAEMAQ0UCGAICDQUYEGggwKENWANBApEUKKDZAKQAsKNxACRACRACIAIgoK
gAkQA0SKCoANEALEKDIAKiANEKCoCUZEVBYgBYhQZABUAFRFBYgBYhQVABkQBYhQWIAWIUFQAVAB
URQWIA5w9GWIkoxzbCybFzqzhoOioxzm/W+PUY5d79mCoSm6jbebe024BzhcNLFSUY7/AFEWTYtO
Krx0VTVOHnPZ8WZ5dre0VZO7uzbgHWFw7xMlFdvIjUmxYcVXjo6ChDzv1mZ5dbe0Vq9zTiHGGoPE
y1V/oFk2LBiK0dGwUI+c/wBXZnl1t7RXG9bNmnIEo0XXkox2sEmxYKk46MhZZyfrfEzy7eyK7Obq
Nt5tmnEahB1Gks2wCxwjHRdO7zk/W/gZ5dfZFbr1XXk5S2s05W7AkrhkWTCYWOjoupU872clzM3y
74ztFexuLli5XezcuBpyt2GMisixaK0coLxtTK2aT9rM2uuOPqI3SuknjXqx8xbOfMsjOWWxCMrA
l9EaJeNetPzF6+XxJa3jjsOtN6XSXiaWSWUmvYvf3Ekazy9BT2bcA70fo6ekp6sdm98ES1qY7Fu0
jj6egKSo0fPt3c3z/WwzPLtle3xBzmpN1G5N3bzbNvONUqEsTJQgryexAk2OiYbD0ui1F1KmdR7e
Lf1Vy/15GOXok7IOdaS0hPSVR1JvPctyXBG5NPPbsRjKyOg9HOj0cIvlWJsrK8U9y+s+fDh17MWu
+GGvNFc6S9IpaXlqQuqUXkvrPi/cjUmmM8+4VGRpxFl6N9G5aanrSuqMXm+PJe97jNunTDDuFk6U
dJY6Oj8kwtk0rSa9FcFz4vd17MyOueevEHJ2dXlDrR2jKmlqipUleT7kuL5Et0sx2OuVquH6A4bV
j5VaXfJ8Xwiv1m7nP2nq8dODimkMdU0lUlVqvWlLa/cuXA6x5LdiP1dZ2W0rI7L0V6L0+j1N43G2
jNK6T9Bf8J8N2zacsrt68MO3zRzzpb0qqdI6lleNGL8iP+Z8/Zs4t7xmnDPPuFNZpyF66GdDJdIJ
+Nqpxw8Xnuc2ty5cX2LPZjLLTt0+n3fAWbpx0zjgovA4JqKitWco5KKWWrG3re7Zt2THF06nU14g
4mzo8gkdD6GradrRo0VeT2vclvbe5f6bSW6axx7h3mpUw3g3wip0lr4ia7Zy+tLhFbu7a2zl7T2+
OnPvHD8bip46rKvXlr1JZtvYurglu2W61Z9Y8du/IZyk27b/AH7vyt5XBRCDtPQ/opT6PU/l+OtC
UY3ipeguLX1nuSu03vls55Xfh68MO3zRQOmHTCp0lqasbwoR8yHpP7UuGXcutm8cdOPUz7hTIU9d
XyUV6T81ckvSff3K605C/wDQ/obU6Qy15a1PDelJ+fU5LgntfZ5zs1jLLTth0+74C6dLOmFPRMfm
/R8U5xWrLVyjTS2q/Fb3dW3u5mY7811zz14g4zFupJyi1Oa86q8oQX2V7MuUY3SZ0eUPtEaMq6Xq
eKwqbcnaVaW18bcOdvKazbUW0lulxm+PxHb6FDBeDTCXk71JbX6VSS3JcFw2Le7u5y9p6/HSg4rp
fS1XT8pV68vF0pPrlK2xJZXS7IR+8/K6SaeTLLu80RrXjYXf0OHvktsptd2s+btGOdrN2dZ/Idg6
G9FY4amsZi4qlSj5cKTey39pUbteXC+UdqSvZc7Xq6eGvNFV6X9KZ9KW4wk6WCg/Oe2o1wW2T4R2
LJya3ak059TPu+ApcL4uLhSSpYdW15ye3hrNbXwhFc0m05GnLkWXotoCfSKbpYdOnh1lVrPz5L6q
3K/1VdLbJysiW6dMMe7jgdD6S9I4dGqcdG6Nj9Na1o56i4v7T257POfPEm/Nds8+3xBxaVWGjpXi
1WxDec/OjFvh9eX2n5KezWykury8fEbqUY4BupivpK7z8W28nxqPb+FeVxcdjHHI3KlLFWxGMk4w
a8iKspSS2KEdkYrZe2qtybVgc+aM+k0wrLVpYen1qEb729spvtk9iVlZTg5+A18odT9mwUZWnk5W
8up1282O/VWW+Tla6pv0g34ynoXzNWpiPrbYU/u7pS+15q3XdpKcnshcMGqC8fjHJuXlRp38ud/S
k/Ri+LzluXpKGvWjajV069aTjTo01a+ynTXBLe3wV5Seebuy8J7Q3Uxia+TYSMlGWTdvpKj522Lh
BZcXJ5kXfpAXUp6C87VqYj6uThTfPdKXLzVv1nknK+z8QKjg5Y2+KxU3Gm27yec5veoJ7Xxfmx3v
YmTW/NGVMRU0xKOHw8NWmn5NOOef1pPe+Mnklssshwb34gc/KKegsqLVTEb6qzjDlT4v7e70frNy
u+34gOF0clH5Rim403nFenUe/Vvu4zeS5vIbST1oTVxFbTs40aULRX7ulHZHi89++UpdrssnBvuD
t4qnoJatBqdfZKstkOVPnxn/AA22tyu+3j8Q3wWi1OHyjEycKN3b69R71BP1yeS5vJtknrRmKxtT
S8oUaUNWCdqdKN3m9/GUnvk83yWSa0luw+16fR3KLjUxX1snCk+W6U+fmx3Xeactez8QxwOjp6Tc
q1WWpST8urLPN52W+UnuS63ZZi1JN+QrSGlVWj4ihF06Cd7elN/Wm974LZHYuLaLl6QPaWCp6DSq
YmKlWavCg93CVTgt6hte+y2ze1128/gGMYYjpFX+vN5tvJRit73Ril1JIvDPnKh/Xx9PRMHRwrvJ
q1SvscuMYb1Hi9suSyHLW9cfiG2jtEqrDx9eTp4dO1/Sm/qwW98XsjtfBrSY+tAtJaVlpDVpwjqU
YeZTWxc39aT3t59SyGkuWxK08JT6PJVK8VPENXhReyHCVTnvUO18Ccrrt559wiqdOvp+vvqVZu7b
9rexJdyReE85USuIx1PQ0HQwr1qklapXW/jGnwjxltlyQ5at1x+IYaL0S8cnUqS8XQh59R/4YrfJ
7kut2QtZxx2F6T0qsVFUaMfF4eD8mO+T+tN75PuWxAuW/gHmC0dTwFNYnFryXnTpbJVOb4Q4va9i
4k21JrzRGY7HVdMVNaecnaMYpZJboxS2Lgl7SyM27E8ow6LK7tPGPYtsaPN7nPgtkesnLXsfEQGF
wtbTFXVhedSbbbb722929tmuGJO4TOLx1PRMJYfCvWlJWq1l6X2YcIcXtl1GeXS3XifiI7RWiJaT
bbahSgr1Kj2RXvb3JZtltZxmw60ppWNWKw+HThh4u6XpTf1p8XwWxLJEMsvScBWi9FQnB4nEtxw8
XbLzqj+rD3vYhaY4+t4DTSulZ6UkrpRpxVqdNebFcFz4va2JEyy2JTA4GnommsVilrOWdGi/S+1L
hBfzdRGpNeb+Agsbjamk6jqVG5Tk/wDRJcOCKzbsWanTj0VipzSljJK8YvNUk/Sl9vgt215k5dNd
nxFSqVJVpOUm3Ju7b2tmnIJsAbCDADADADZFGAGAG7AGwg2AbsFGggTYKNAGrBAmwUaANWCBNgo0
AaKg00RQkA0UGmgBAQIaAEtXAEFAloAQ0EA2AIYAhoqBDQANoAG0ADaABtFQDaABtAApAA5AAmio
ByQAJgApIAEAIZQJaIgQUCWAIaCLsgKrCoMANNEAiwUaKgwCbYA2wCbYAbAFpWIDZQf/1Pogel8h
+VTCA00FCQDRQYEGAGAGEBoAwIE2Ko0AYAYAYAYAaIg0AYAYAZYA0VRoAwA0EGAGEBoAwAwAwA0E
GrFBqwBhVGAGEBogMAMANFQYAYAYAYAYAZYA1YASAJYAgAwAwAwAwAwAwAywBqwBoKMKDADADADQ
QYEGAGAGAGAGAGAGEBoKMAMAMAMAMAMAMAMANWANWKDQBgQYAYAYAYAYAYAYAYAYAYAYAYRRoAwI
MANBBlgoTYoMAMAMAMAMAMAMAMANAGBBoAwAwA1YijRQYAYAYAaANBBgBgBgBgBqxVGgDADADADA
DADADADADADADADADADADADADADADVgo1YoMAMAMAEkQYAYFGAG7AGWAMAMAMCjADADZUGAGAGAG
AGAGAGAGAGAGAGAGAG0AKANgGAGAG4hQsiDCgwA2FCiAwA2UGwoURBsA2VRtEQKQBsKMKgWZUYAK
iUCiA2AKQAoA2goWEGwoURAoqjaIBQBtFAtEBsoFEQbCjADADADZQYgBZAYAYAYAYAYAbANphAoK
NBBpsKNAGgDADADADADADQQYAYAJbCjQBgBoIMAMAEsKEhBgBgAhgGgDQQaYAkKNBBgBgAlhQkIM
AFRAFAG0FCyoNkULQQLiFBIgC0FBAAiACIigkQAkQoKgAqACoKCogCxCgsQAsQAqCgiIAqCgsQAs
QAsQoLEAKiKCoAKgoIgAqCgqACRACoKCxACxIoLEKCoAIgoMgAiCgqACIiggARAC0AEiFBIgCgDY
ULCDYUbQQKANNACQowAwAwA0EGgg0wo0FGggwINMKEMAGEA2ADaKgHJAA2gAbQQDkABkggHJBAKR
QCYQDaABtBAhoAGwgGwATABtAA2VANgCGAIaABsIBsIENAA2ggS0UAwgQ0AIaAEACGgBLVwgQUA2
rACZIAQwAbCBDChDCBDQANgAwBDABtFQDaABtAA5IAGwgGwBDQAhlAhgaDaCBLzAEAA2ig0ECbAG
go0EGggwihLQQbQUbKBSIoWgg2FCogBEAEiAEQARBQRABIgBokUFiAGiAFiFBkQBYhQaIAVBWRkQ
BYgBYhQZABUAFRFBYgBYhQVABkQBYhQWIASIAVBQVABUQBohRd9G4SOiqTq1POa7lw6zN8u+M7Zs
VnF4qWMm5y7FwXArlbsChFzdlm2VILlRpx0NS1pZyfrfBGOXeTtgrFWtLEScpbWbcbdjdKDqtRWb
YQWqMY6Ip8ZP1v4GOXf2YK5VqOs3KWbZpxt2NU4Oo0lm2CCzRUdFU+Mn638DPLv7MFeq1HWbk9rN
OFuxqEXN2W1hYLHThHRkLvOT/VjPLtPsiArVnXblLaacbdgSV8kAWLDUI6Pg5z879ZIzy6ydog8T
iXiZaz7FwNOVuw1YQWDR+CWGXjamT3cvzJa644680RGPxrxcuEVsRZGMstiOkVgTei9G+N+kn5q2
Ljz6jNrrjj6gGltJ/KfIh5i28/yEiZZbECacxI6M0Y8fK7ygtr48kS1vHHYk9MaUWGj4mjlbJtbu
S5/raSRrLLXiCmSNOIPg8DPHzUIdr3JcRVk2Lji8VT6PUlTp5zez4szy7W9kHPK1WVaTlJ3b2s28
98gVOm6zUYq7eSQB0LA4Kl0bpOrVzm1n/wAFe/4GL5eiTsFA0ppKelJuc+xbkjcmnnyy2IqRWReu
jnR5RSxOIySzin/ifu7zFrvhh60Q/SXpE9KS8XTypJ/xPi+XBdvVZNMZ57FOZtyE/wBHuj0tNzu7
qlF+VLjyXP2GbdOmGHcLX0l6Qw0PD5JhbKSVm16K4L7XPd17MybdM8+3xByaWZ0eYHwOj6mk6ipU
leT9XN8hasmx1t/J+geG+tVl3yfuiv1mzn7T1eOnBxrSWkKmlKkqtV3k+5LguR1k08luxGtXDI6/
0U6LQ0LD5bjLRklrRT2QXF/a4Ld17Odu3q6eHb5oovS3pXPpDPVjeNCL8mPH7T58OHebk049TPuF
KkacRdOh/Q6XSGfjKl44eLze+T+qve93WYyy07dPp93wFs6adMY6Mh8hwVouK1ZSjsivqx58Xu69
mccXXqdTXiDiTOryB9onRNXTVWNGjG8n3Jb23uS/WZLdLjj3DvkIYXwcYS0bTrT7HOXuivUuLucv
ae3x04OKaT0pU0nUlVqyvKWbfLcuFty3cNZZLpp5LlsRUm+1frrXrk7WVisjtHQ3ojT0LT+XY20Z
RWtFSyUFxa3Pgtq35uy55Xb19PDXmih9M+mUukc9WF44eL8m+2T+tbe+F8o8nm9446cep1O4U6NC
z1Wm5PPUvn1zluXFZc9Xaac9C79EOisukdXXl+6g7SnbyV9mmtjfGTyWbs3ZvGV064YdwvnTLpVD
QtL5JhZeLsrSms3HiocZ8ZbIva9Z5Zxm3XqZ9viDidS0I+WnCm81TT8ufByfDg2rb4xzbOjyB9hd
H1NI1IUNS82/IoRyS5ze7nfy2lm4qzIsm/7A7jCNDwfYVSn9JiJ+TGMVnJ/Ugt0U9vF5u8nY5+09
njpz7xxHS+kqmk67q4j6bESdo045whwjltt9Vb/Obd4nSR5Mru+Qwq/RzvV+mruyUFnGPBO21rdC
OSyTeTiVB1roh0IcGsfpFq6WtCErWilsctytujsS7lzyy9z04dP1oiOnXS5Y+Tou/iovKknZza31
HtiuEF5W96rsaxxZ6mexz+tC9quLb2eRSjk7bstkI79l3tSd9ZbcPiLJ0d6LYnpjOLn9Fho7LKyS
4QW9vfJ3va7cmrGbdOmGFz+A6jp3S9Loph/kuD1abirSm81Tv65VHtUc36TtE5ybejLLsmoOG/KJ
6QcqWGTUZXdSpJ+VJXzlUk8oxvna9r2u5OzOryb3wBwrxwTVPCXnWeXjUne73U1tX3n5T3KOadTe
uBrxdPRGdS1Wv9XbCD+0/Sl9leSt7ecRycBUsO5/tGNlLys4wv5c1ut9WPCTWzKKdsoffRvVq6az
erSw9PrUIX73KT7Zy6lk4Pa+Az5T4z9mwcZWnk3b6Sp122R+ysuLla4PugXeloTZq1cRxylTpvlu
nLn5i3a21Tk9kZTwd18pxkpWnmo3+kqc1fZHjN9ik9lNetG9atp6ShBRhSpq6isqdNb229/GTvKT
yzyROD2hupj4aPi6WFu21adZq0pcVBejH+aW+y8kLvXAXHA09EJTxS1qm2NDZ1Oo1ml9leU9+qs2
5Na5/ADhSrdIJurUko04JKU3lCEdySX8sYq74bRwntBeI0jGnF4fCpxpyylJ+fU67bI8ILLi5PMa
LfSA8cJT0H5WISnX2xo7o86n/AWf1rbG5XXbz+Ab0qFbT85VakrRjbXqSyjFbll3RjFX3JDhNdwV
itJwowdDCpxpvz5vz6nXwjwgsuLbGlt9IHFLR9PQ6VTFLWqNXhQ2Pk6m+K4R86XJZtyutc/gG8Y4
jpHVbebSzbtGEIr1Riv1mOGfOQc19I09GxdHCO7atOta0pcVD6sf5pb7LIaW3XH4geC0XClBYjFN
xpPzIrz6n3eEeM3luV2Nkx9aA4rG1dNzjThG0V5NOlBZK+5Le3vbze9jgt7hJ61Po35urUxX1snC
l1bpT5+bHdd5qcr7PxEdgdHVNLylUlLVgs6lWexX473J7ks2y8MybDjHaVjGHyfDJwo+k359RrfJ
8OEVkubzGmrfSAuE0ZTwUFiMXfVedOknaVTm/qw+1te7imyTXmhji8ZW05VirXeUYQisordGMVsX
t2vMcJb3CZ1qfRnKNqmL3y2xpdW6U+eyO67zJy17PxETgNH1dMVHZ7PKqVJPKK3yk/02y8MybD7H
aUhh6bw2Euqb8+o8pVHz4R4R7Xd7Glt14gHo3RMakPlGIbhh07XXnTa9GC3vi9kd/AWkx9bwA6T0
rLSTUUlClDKnTWyK97e+TzbHCZZbErQwVPQcVWxUVKq1enQfqlU4LhHbLfZGeWpO3n8BDVq1bTVa
8r1Ks3ZJbXwSXDglkjXDFtyE9OrDownCm1PFvKU1mqXGMOM+Mt2xZ3ZOW/Z+Ig9H6Oq6WqakM3m5
SbsorfKT3Li/eW3TMmxLY7SNPBU3hsI/If7yrslU5LhDgt+1kauWvEDPRWiHj7znLxdCHn1Hu5Lj
J7kLUxx2F6V0ssWlRox8Xh4ebDe39aT3yfctiEhllv4A+jNFQjD5VirxoJ+TFedUa9GPL60t2zbs
bJj60MNKaUnpWalK0YxVoQWUYx4Je17WJEyy2JjB4GnoamsTikpTkr0qL38Jz4R4LbLqHLcnb5v4
CBxmMqaTqOpUblOT/wBElw4JF0xbsWaEI9FYqc0pYySvGLzVJP0pfb4L0drzJy6ex8RUqk5VpOUm
3Ju7b2tlcthIQYAYAbsFGEBgBuwBuwQbAMAN2CjADADADVgDTQAkAwAS0ECQowAS0AJAMKDVggS1
YijRQIaAEsIENWAEtACABDRUA2gBDQAgqBDVgAbQANoAG0ADYANlQDaABMAGwATRQDaCATQANoAA
1YAS0AJCAbKBLQAkAQwLskC7YVE2wCbaIBLQUaKg0AYAbAFJEAooMAP/1fogel8h+VTADCA0AJCj
RUGAGAGAGEBoAwIEtFBoKMAMAMAMANWCDRAYAYAYAZYASVRgBoIMAMANEBgBgBgBgQaKDLACbAGF
UYQGgDCAwA0VBgBgBgBgBgBgBgAiSABAGAGAGAGAGAGAGAGAGAGrAGWANFUYAYAYAYEGrAGBBgBg
BgBgBgBgBogMCjADADADADADADADLACbAGrFBgQYAYAYAYAYAYAYAYAYAYAYAYAYRRoIMANBBlgo
TYoMAMAMAMAMAMAMAMANAGBBoAwAwA1YKNAGAGAGgDAg0AYAYAYAYAasVRoAwAwAwAwAwAwAwAwA
wAwAwAwAwAwAwAwAwAwAwA1YKNWKDRAYFGAGAGAGAGAGAGyoMAMAMAMAMAMAMAMAMAMAMAMAMAMA
MAFIIFBRgBgBgApEUKKgwAwA2FCiAwA2UGwoURBsA2VRtEQKANkUYaAsyDABSKBRAbAFIKNhApBQ
sINhQoiBRVG0QCkAbKBSIBRQYgBREGwowAwAwA2UCkRBsKMAMAMAMAMANgCrhAlsKNAGAGAGAGAG
AGAGAGggwA02FCQDADGAaCDADABDCjQQYAaYAgAwA0ECWFGgDQQYAYAIYUaCDADaAFgG0ALANhQp
BASIULQARBQRAC0AEiRQSIAWIUEQAVBQVABUQBYgBYhQWIAVBQVABUQBUFBYgBEFBYgBUFBUQBUA
EQUFQAVBQVABEFBYgBURQWIUFiAFiFBUAFQUEACIgCIKCRACRAFxCgiAFgGwoWEGwoxABADQQJaA
NBRgBgBgBoINACWAYFGggwIEMKBtBAhoAG0ADZUA2ADYQCaABtBAFoAGyoBNBANgA2EAwBDQAJhA
NgA2ADaCAbRQIYAhgA2EA2gBDCAbAEMqBDQAhoIEACGAIYQIAENACWrgCCgGwBDAENBANgCGAIYA
OQAORQIYQDYANgA2ADYANhAgAGygQwNQhhAgAQ0AIaKBJAaKg0AJaCjQQaCDCKMKDaAFIgFBRsAW
gBaACIAIgoLEAIgAkQAqIoMgAsQAyCgyIAsQoLEBRkBkVEUGiAFiFBUAFRAFQUFiAFQUFQAZEAWI
UFiAEiFBUAFQAVEBa9AaN8a/HT81ebzfHs9vUZtdsMfUN9L6S+Wz1Y+ZHZzfH4FkTPLYiUVgW7RG
BWGj46plllfcuJmu2GOvIh8fjXjZ39FbEXTnllsNIlZFr0fhVgIOrUydu5fEzXfGa8iExWKeLnrP
sXBFcrdgO0Miy4PDRwEHUntt3cuszfLvjO0QmJxLxUtZ9i4Go527ACsCx4PDLBR8ZPb7PzMV3xmh
D4rEvFSu9m5GnO3YbBBP4DCLDrxk8nu5fmZrrjNeRF43FvFS+ytiNRzyuwyKwJrR2B/tJ7NqXvM2
u2OIaaRx/wAperHzV6xIzllsRLNOYldG6O+UvWl5q9Zm10xx2F6W0lrfR09mxtezqEi5ZegrrNOQ
e6PwEsdK2yK2v9bybamOxN6T0hHR8PE0spW7vz/1JI6ZZa8ClyzNOAXhsLLGSUIK7fq5sLJsXKrU
p9HaVo5zfrfF8jPLv7AoGIryxMnOTu3tNvPbsN1Bzdkrt7EEF90bo6noGm61bz7d3Jc/1sMW7ejG
dvmilaW0pPSk9aWUV5seC+PE3Jpwyy2IZlZFz6OdHlVtXrryFnGL383y9vVtxa7YYetDLpL0iekH
4qk7Ultf1vy4d5ZGc89ilyNuImtBaBnpqpwprzpe5c/YZt06Y4dwuHSDTsNBU/kuFsppWy9Ff8J/
mZk26559viDk825ZvadHlBMJgqmkJqnTV5SeXxfIbWTY6zTp4foNhtaXlVZd8nwXCK/Wbsc/aerx
04OQaT0lU0rVdWq7yfclwXI6SaeTLLYi2isjrHRPorDRkPlmMtFxWtGMtkV9Z8+C3deznldvV08N
eaKd0u6Vz0/PUheNCLyX1n9Z+5bus1jjpy6mfcKQzbiLf0S6Iz6RT1p3jQi/Klx+yve93WZyy069
Pp9wuPTHpdDQ0PkOCtGUVqylHZBfVX2uL3dezGOO3XqdTt8QcReZ1eQPNGaLq6Yqxo0Y605dyW9v
gkS3SzHY7zRpYXwc4XdOtPbxm17IruXWzl7T2+OnBxXS2lKmlqsqtaV5PuS3JX2Lh3pN+UdJNPJc
tiKk3fnt4duezrflPLZcrI7J0M6Gw0ZBY3GpJxWtCLVlBfWae/hfNZb9nO16un09eaKb0x6Wz6Tz
dOnlh4Pe7Rf2pvf9mK9byNTHTl1M+74Clq1Ja6bin/aNeU+VOO5br5bNq8005C6dE+hs+kErTTpY
eL8pLzpPcpPjy3LPVjdN5uWnbDDu+AvfSfpZDo/D5v0dFeMjGztlGmt93x3tt5bW7mZN+a6559vi
Diyk6s3KL8ZUWcqsvMguV+5N9UY3szo8gd6LwNXSdXxeETnVk/KrS3N71fZvd85tK61c0SrjN8fi
O46O0XhPB1hZVZyUqsvOm8nJ/VW1pb8rt7c3ZHPfc9kxnTg41pXTdbpDVnVT1Y7JVZZWj9VWvqr7
Mbylndy3dJNPLll3CJoeUpRw/kQStOtLJ2fNX1U/qxvKWa8rYtM/Add6DdEaeEj8rrLVgleLnk5L
6zXoQ4LbJZyeq9U5ZZPT08NeRCdK+nlXTs3hcAmoLbU2N23q/mxW3WduORqY65Zz6nd4g53SccHJ
QoLx1du2ta6T+wvSf2n2LZI24cC09GOistMV2pNVJp3qSflQhf6z9Ob3RXk75Nq6M26dMMN0dS6S
dK8P0NpfJ6Xl17ZRvmvtTe7kuFkkla3OTb0Z5zDwOGYh1NKv5Ri5uFN31VbOWeahHfntk8r3bblk
+vDx3z5oRHX0pF06SVLDws5Xfkrg5y2ylwVr7VGK2A5+AyFfVfiMFGTlLJzt5c+KS9GPJZtbXbJD
7oNfRaH2atWv304e6cv5F9rdOTgKeF1f2jGyk3PylC/0k+bb82P2nm/RT2ouvWjLVdN5vVpUKfWq
cE+G1uT7Zy5jg9oaljMvk+DjK0/JcrfSVL7sr2j9lbd7lla6TfpAvUpaE87Vq4j6u2nTf2t05cvN
W/WzScr7IylhJY2+Kxc3GnJ+c85za3QW/hfKMe5Mmt+aMniKumGsPh4atNZqnF8Nspydru22Tskt
mqsicG9+IC/KaWhMqDVSvvq+jD/d32v7b/CvSbld9vAHh9GqMViMXJxhLOMf7Sp1X2LjN5cFJ5BJ
PWjc61bT040aUUoRvqU45Rit7bf805Prdhwe0HDxdPQi1cO1Ov6VbdHlTv8A43n9VLa3K77ePxAM
LoxKCxGKk4Un5qXn1H9lPdxm8lzeQ2knrQmvi6umpQoUoWgnanShsXPi5cZPPqWScLvuD5VKXR/K
m41MTvnthT+7ulL7Xmrdd5jld9vxDXB6Olj9avWnqUk/KqSzbe20VtlJ8N21tIMyb8jMdpTx8VQo
RdOgnlHbKb+tN73wWxbEt7aLl6QPI4OnoJKeJSnX2xovZHg6nuht+tZZNy1rt5/AMoU8R0jrNt60
rXlJ5RjFb29kYruWxDhPOQe19IU9FxdHCO7atUr7HLjGG+Mf5pb7LImtrbrj8QHR+iYyh4/EN06F
8redNr0YLfzk/Jj15FSY+tAtIaUlpDVpwjqUo+ZTjsV973yk97efUshot2JOOFp9Hkp10p4jbGk8
4w4OpxfCH8XAnLWu3nkRdOniOkNd7Z1JZtvYkt7exJdiSLwz5yEpWx1PQ0XRwj1qjVqlf2xp71Hj
LbLkicrvXH4hjozRDxqdWpLxdCHn1H/hivSk9yXW7IqY47BNJaWVeKoUI+Lw8XdR3yf1pvfL1LYh
Ity9IHGD0ZTwUFiMXfVedOknaVTm/qw4va93EbJNeaI/HY+rpionLblGEIrKK3RiuHt6xwlvcJ2N
KHRha00p4vdDbGlzluc+EdkdrzyM8t+z8RBUaFbTVa0b1Ks3dt7ebb4cW8ka4c/OQmq+Np6Di6OF
kpVWrVK69cafBcZbZbrInLe+3xPxEVovRU9KSdmowirzqS82K4t+xbWy2pjjsP8ASOlIRh8mwqca
N/Kk/OqNb5cvqx2LrIty9IB6L0QsTF168vF4eD8qW+T+rBb5PuW1i1Mcd+bwB6V0u9IWhCPi6EPM
prYub4ye9sSGWWw90foynhaaxWLv4t/u6eyVVr2R4y7FmFmOvNEZpLSVTSs9epbJWjFZRjFbFFbk
iyaZt2JzDYOnoCCr4mKlWkr0qL3cJ1OXCO19ROXSTt5/AV7E4mrpKo5zbnUm+1vgvYkuornbsWeM
Y9FFd2ljGsltVFPe+M+C9HaZ5b9j4ipVKjqtyk223dt7WzTkEAGAGyKMAMAN2AN2Kg2AbCjCAwAw
AwA3YA3YASAYAasAJsAaANNACQDQBpoAS0AaAMKBLRAJKBDQAhoIEACWigQ0QCGVANoAQ0AIaKgG
0ADYANoAGwAbRQDaCAUgAUkADkADaKATQQDaAAyQAMAS0UCGiIElAhgCGAJAMANBBhQYAaauQCGr
FBoAVEAWAYAYQH//1voiel8l+VTQQYAYQGgBJVGggwAwAwAwA0QGBBqwBoqjQBgBgBgBlgDREGgD
ADADADVgo0UGggwAwA0QGAGAGAGAGggwoMsAasAaKowgNEBgBgQaKDADADADADADGABCjVgg0AYA
YAYAYAYAYAYAYAYAYAasAasAYVRgBgBgBgQasAYEGAGAGAGAGAGAGAGiAwKMAMAMAMAMAMAMsAas
AJsUGBBgBgBgBgBgBgBgBgBgBgBgBgBogMANBBgBqwUaKDADADADADADADADQBgQaAMAMsAJsFGA
GAGAGgDQQYAYAYAYAZYoNWCjQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgAlhRoKMAMAMAN
hBhQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYgBaCDYUYAYAYALRFGyoMAMANhQogMCDaKo2FCiI
NgGyqNoiBQBsijCgWQGAG0UCyAwAUgoUECgoWEGwoUiINlUKQApEBhQLIg2FGygURBgUbAMAMANg
GFAoiDYUYAYAYAYAYAbANAGAGAGAGAGAGAGAGggwAx5ACAowAwA0EGAGAGmAIAMAMANMIEBRgBoq
BLIo0AaCDADTAEAGAGAGABADABaANgC0ALQULQAUKFoAXEAJEigiACxCgsQAsQAqCgiIAqCgqACx
ACxCgqACoigqACoAKgoLEAIgAsSKCxACRCgqACoKCoAIgoKgoKiALEAKgoLEKCxACxCgiACoAIiK
FxACRACIKCIAWAbChQQKCjEAECDAo0ECWgDQUYAYAYAaCDTQAkKMANBkJkFCGEA2ADYAhlQDaABy
QQCkADkggE0ACaCATKAbCATCBDQANgA2ggG0ADaABtXABsIBlAhgCJIIBtAA2ECGrACGggQUA2EC
GgBLAEMAQ0AIYQIKBDAESQAhoAGwBDQAhhAhoAG1cAGwAbAEMqAbABsAEwAbCBDKBDRAIZRYGwKQ
0ECGAJABsoMIDRUGgBLRAaKDQQYFCkiAUAKCjaQAsAWgAiACIKCRACIAJEAKiKDRACxADIKDIgCx
CgsQJRkBBURQaIASIUGQAVABURQWIAVBQVABkQBYhQWIASIAVBQVAEvovR70hUUfRWcnyJW8cdix
6bx6w0VQp5ZZ23Lh+t3WZkdM8teBVImnET2htHfK5a8vMj63w+JLXTDHYcaa0j45+Lj5q283+RJF
zy2INGnMWLQ+A1vpZ7Fs+Jm11wx9QDSWP+Vy1Y+YvXzLIzllsRyKwLDozBKK8bPZu+Jm12wx9Qy0
hjflUrLzVs+JZGMsthggyJ7RuC1fpJ9nxJa6Y4+oaY/GfKnZeatnxEiZZbEeVkTWjcFf6Sezd8SW
umOIb6Qxvyh6sfNXrEiZZbEaVzEpo7A+PetLzV6yWt447G9J4/xnkR81bXx/ISLllsQppyD7AYF4
uV35q2v3Etbxx2H+k8eqK8VTy3O27kSRvLLXgVmRpxDjB4OWNlqrZvfAjUmxYcbi4aJgqdPzvZzf
MzPLrle0UycnPN5tm3Aao0JYmSjFXbBJsXFKn0epXec3638EZ5d/Ygo2LxMsXNzm7tmnC3YaWvki
si86K0XDRMHXr2Urb/R/P/Qxbt3xx7fNFS0xpaWlJ3eUF5sfe+ZqTTlll3CEZpgWvo70f+V2rVV9
Gtifpc+r29Rm11ww35COkvSH5VejRf0a85r0uS5e3qEhnnvxBSJGnESuhtCz0zU1VlBedLh+ZLdN
Y49wuum9M0+jtJYbDpKdv4eb4t/n15k27ZZdviDlE5Obbbu3m2dHmG8NhZ42ap01rSlkkCTY6vh8
PQ6E4d1J+VVl3yf1VwS3vt4I5+09Uk6cHJ9K6TqaXqOrUd29i3JcEdJNPLllsRMisjqXRPorHBx+
WYuystaMZbIr60ufBbtu3Zzyyenp4a80Vbpd0rlpyXi6d1Qi8l9Z8X7l79mscdOfUz7hRpG3EWro
r0Un0iqa0rxoxflS4/ZXP2dyeLlp0ww7hdelvSuGgqfyLBWjKKs2tkFwX2uL3dezMx35dupn2+IO
Iyd9p1eMSWi9C1dLVI06azls+PJc/aS3TUx7h3KnSwvg7wreUqsu+bXPdFfrNpHL2ns8dODiul9L
VdL1ZVarvJ9iityXBcL+U9qSbOkmnkyy2IiT/W/rXD7zz3lZHYOh3Q2Gj4LG420dVa0YPKMftSvt
fC+zutzuT1dPp680Vnpj0rn0gn4mGsqCfk01lOf2pfVW9J52zazurJpjqZ9wo9tfJastX/k1Drfp
Pvva3l7Dbj+/uFp6J9GqnSOtrRclTi/LrtZ/dprc+e1Kz8nzXm3Tphh3f2R0XpX0ko9FaCwmFapt
K11m4r7K3ye+TyWbu5ZGJNu+efZNQcQrStH6W8IPNU07znzk37XxvGNmzq8Yd4fAVMfOFFxes35G
Hhk+uTd9Xm5XlbhGzRZN/wBgdwoU8P4PMJ42u06rVlGOV39SC222Xk83tk27I5e09k104OL6e0pU
0rVdfHNuXoUE7aq4P6q4+m+V1I6yaeXK7838BHV1a0sT5KS8ijHJ2ffqp8XeUttnfWKzfv8AwHUe
hvRF45RxmOShQh5VKjsjbbrST3dd3La21a/PLJ6OnhvzQw6adK3p1eLhJ0sGnnO3lVWvqxyvFdkd
7adkXGaTqZ93wHPoa2Ng400qOGTWtJva92s7XnLhFLLaorNmnDn4Cd6OaGqafqPD4NOFL+1rNeU1
wy2X3QTz9JtLKW6bwx7vE/EdQ07pyj0IoRwOAjrYiStGKV2m/Slxk9y91k+cm3oyy7PE5HFazhgp
OpXarYhu7Td4xb3zfpS+yvJW9vOJ1eTjnkbqUHJ+Pxsn5STjBZTkt1lshDg7bPNi1si69aNWqaXV
3q0cNTfNQjySzcpvtk97sroc/AZHEOt+zYKEkpZSfpzW/WeyMd+qsl6Tla5TfpBrxlLQ3matWv8A
W2wg/srZOX2n5K3KWUhracBXyNU/p8bKV5eUoX+knfe276sX9Z5vcntQ160a+m06/Rp0Kf4adNPv
u32zk+I4PaGTx8cMvE4NO8vJlUa8ud9yS82L4LN729iaN64C/ktLQuddKpX3Ub+TH/eNb/sLP6zX
mtyuu3kJp0Kumm69eerTWTqSWS4RhFbXwjHJb7LMXwmt+aN1sf45fJsJCUacmk1tnUe7Wa9UVkub
zIb9IDqhS0FnUUauI+pthTf2t0pfZXkre3nEcr7PxA6OEq6YcsRXnq00/Lqy4/VivSfCK2Lgsxwm
t+aNYrSXjI/J8LFwpNq62zqPc5tbeUV5K5vNtFvpA5WFpaCzrpVK+6j6MOdS21/YX4mtjcrrt55D
alh6/SCpKpOWStr1JZRgt3wjFK+5IcGrkD4jScMJB0cJdQatOo8p1OX2Y/ZW3e3uaLlrgLoaMp4C
KrYu+avCinaU+b+rDnte5b02Sa5/AN6tbEdIasYRjd7IU4q0YrglsS3tvrb3l4TzkHzxNLQHk0Gq
mI31dsYcqfF/b/h4k5a9njkMsBouWPUq1WWpRT8upLO74RW2Unw7W0hakmwvH6VVWHiKEfF0E/N9
KbXpTe98FsjuW9pEuXpA8o6Op6IiquLV5tXhQ2N8JT3xjy86XJZjbUmufwDCpVxHSGslZzm8oxir
JJbktiiu5bWOE85CUliaXR1atBqpifSqrONPlT4y4z3ejxJy1vt45EZo7Rc9KylNtRpxzqVZbI34
8W9yWbZbdMybDvHaVhCDw+FThR9KT8+o1vly4RWS5vMmi5ekCsBomFOCxGKbhR9GK8+o1ujwXGTy
W67LtZj60NNJaUnpRpWUaccqdOPmxXLi3vbzbEiXLYlqeEp9HkqmIip4hq8KL2R4Sqe1Q28bbCct
a7eefcIhuvpytnrVKs32/kl3Jci8M+chOSxFPo2nCi1PEvKVVZxp8Yw4y4z3bFxJy1vt+IhdHaNq
aWm4x3ZznJ2jFb5Se5e0vDMmxJ43SdPB03hsJfUeVSq8pVOX2YcI79401brxA10Voh45OpUl4uhD
z6j9kVvk9yQtTHHYJpPSyxMVQox8Xh4vyY75P603vk+5bETRllv4A2jdEwUPlOKbjQT8lLzqjW6P
LjLYusEx9aGelNKz0pJXSjTirQpx82K4Lnxe1ssmkt2JTCaOp6KgsRi1dyV6VHfL7UuEPXLqJvbc
x15v4CFx+PqaUqOpUd5PJLcluSW5Lci8MW7FipYeHRmKqVkpYpq8KT2U+Epr63CO7ayct+z8RW6l
SppGprSbnUm+ttsrnyLO3DoqrK0sY1m9qo33Lc5+qJnl09j4iozm6jbbu3m295pyCQDZFGAGFBuw
BuwQbANhRhAYAYAYAbsAKsQGwDAo1YIE2KDQBgAloASAY0AIaANAGACWgBIBgAhooEtACGgBLQQI
AEMoENBAhoAGwBDyKBDQQDaABtAAmgAbRQDYQCaABNAA2ADZQCkEAmACkADaAEMASVAhgCGAJAE2
CBIUYAaCDCgwAwAQ0AZEAWAYQGwo/9f6InpfJflUwA0EGAGEBoASFGigwIMAMAMANEBgQaANWKo0
AYAYAYAYAaIg0AYAYAYAYAasVQkIMAMANEBgBgBgBgBgQaKDADADVgDQUaIDADAg0UGAGAGAGAGA
AQowAwA1YIMANAGAGAGAGAGAGAGAGAGAGAGWANWANAGFUYAYAYEGgDAgwAwAwAwAwAwAwA0QGBRg
BgBgBgBgBgBgBqwAmxUGAGAGAGAGAGAGAGAGAGAGAGAGiAywBoAwIMsFCbFBgBgBgBgBgBgBgBoA
wINAGAGrBRoAwAwAwA0AZYAwIMANAGAGAGWKDVgo0AYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAJY
UaCjYQYUGWAMsAZYA3YAywBlgDLAGWIDLFBlgDLAGrAGWAMsAZYAwAwAwAwA2gBQBsAwAwAwAIQG
FBgBgBtEUKANhBiKo2FCiINgGwo2ioFEBsijCgUgDZAbKBZAYAKQUKCDYULQQbQUKRAKRQbQAoiD
ZVC0RBsKNlBtAGyINhRgBgBgBsoNoA2RBsKMAMAMAMAMAMAMAMAMAMAMAMANBBgBgAkKNAGAGAGg
gwAwASwoSEGAGACWAJAMANFQIIoxhBoAwAQwo0EGAGAGAC0AbAFIAUAKQULQAQAIgAiChcQBaIoK
gAiACxCgsQAsQoKgAqIoKgAqACxCgkQAsSKCoAKgAqACoKCxACRIoLEALEKCxACRCgsQAsQoIgAq
CgqIAqCgqACxCgsQAsQoJEAJEihaACIAIgoIAEQBsKFBAoKMACBBgUYAaCBDVgDAowAwA0EGgg00
FGgo0EGmAIABsIEMAHIqAbAEMAE0EAmADaCAMggG0UApIIBsAQwgGADaCAbQAJgA2gBDQQDaAENF
AhgAmggQ0ECGgAbCBDRQIaCBDAEACGAJaABsAS0ECGUCAAbIBDKBDQQIYANgA2AIaABtACGioBsA
EwAbQANoAGwgQwBDKBDQGiGggGAJaKBDQQJCjCA0VBogNNACbFBiAFkBtAGwoWgDYAtABUAEQUEQ
ARAC0AGRFBYgBogBUFBkQBYhQZAZoqCgqIA0QAsQoKgAqIAqCgsQAqCgqADIgCRCgsQAsQoKgBxR
pus1GKu3kkRYL/Jx6PYeyzm/W/gv1tM8vR7EFJlN1HrN3bd2zTzh9gMHLGzUF2vgiNYzYtGk8XHR
1NUaeTt3L4skdcrrwKmacRKaMwLxss/NW34Etaxx2JbS2OUF4mHbb2Ekbzy9BXkachMaMwPyqWtL
zV6+RLXTHHYdaUx2v9HHYtvwJIueXoIQrkJbRuB+UPWl5q9ZLXXHHYNpLG6/kR2LbzEhnkIgrmJL
R+C+UPWfmr1ktdMcdhxpHG630cdi2/ASLlkIUrmH+BwbxTz81bfgS1rHHYfaRxiprxcOp/ASNZZe
gr7K5Bzg8I8XKy2LaxVxmxMY7GLAx8XT2+z8yR1yuvAq8nc04BdDDSxUlGO32EWTYstetDQ1PVjn
J+vmzPLtb2in1Kjqtyk7t7TbhQOFN1WoxV29iALhQo09BUnOec36+SM8u8naKZjcZLGyc5di4Lga
jhbsMGVBc9DaJjgY+Pr5NK6T9FcXz/W0xa7Y4680VzTWl5aTlZZU1sXvfP2GpHPLLYgWVzFk0BoH
5e/GVF9Gti+t+XHuJa64YbB+ken1UToUX5Kyk1v5Ll7erbJFzz9IKKzbgJHROiJ6Xqakcorzpbkv
jwRLdNY49wvGltKU+jNJUKCXjLd32nz4fAzJt3yy7PEHKqtR1W5Sd2823vOjyjVDDzxU1CCcpSdk
kCTY6rgsHQ6G0HVqu9WSz4t/Vjy4vtZz5eqSYQcs0vpWppio6lR9S3JcF+szpJp5ssu4REisDpfR
PoqqSWLxSSSWtGMtiX1pe5dpztenp9P1ogOl3SuWmZeKpNqgn/E+L5cF2vPZccdOfU6ncKHI24iy
9GOi8+kNTO8aMX5Uvcufs28E5bp0ww7heulXSin0dprBYOymlZtegv8AhP1bdpjGbds8+3xBxRQl
Xllm2dXkEro7RMsbUjTprXqS2LcufVxbt2MlrUx2O006eH6A4Z1J2lVlte+T4LhFb+O2zbscvaez
x04OL6Y0tV0xVdWs7y4bFFcFuiuu8n2nSTTyZZdwhpbvVl/hX+Z59qKwOudDuhscJH5bjbRUfKjC
TyVs9eb3velsW3q55ZPV0+nrzRBdL+mktNPUpN08MnlJryptb4x9l7Wyzi8iyaY6nU7vgKE4ankN
Na39nHOpP7ztl1W4eTnrG3EWrox0Wn0jqJTsqVN+Uo+ZHlf0pvk3ZWcpZarzbp0ww7h0HpR0pj0f
h8hwCj42Mc3lq0o8Xuv15LfuTzJt3zz7fEHEoSdWcpQfjKm2dafmx5rW9Tlm/Rina/R5P3sOdGYO
rpCr4vCJ1KrflVpbm96vs3vWflu10ou6F8LjN8DuOh9CYbwf4aVaq1KtJeVN5X+yr7Fxe1vi7ROV
vc9eOM6cHINLafrdIK8qlPOaX7x5Rpx+xfKC+2/Kbt5rdjpJp5ssu6iEw/0ctTDLxlXa6rWUeLin
sS268rNbbRtc0xPuHWOg/QOm7YvFfSN5xv5r+1nnLk3k9qTVpPnlk9PT6frQy6c9OKeKbw9B+Min
ml5rf2recuEVlsbb81McWep1PSDm9en4mXjMY3KpupJ2a4a1vMS3RXlWytFWZtwv3ixaB6LYnpfU
i6j8XQisrKyUfsR5/We13d5NMzbpvHC5jrGlcfR6GYb5PhFGEks5S2Rv6Ut8pvdFXb22UUYnl6cr
MJqDhk8dUx05QwylKdS7nVl+8nxbeyEeKTtbzpNbOjyb3wGyq0tE5U7Va317XhF/ZT85/aeS3J5S
LynAJPCxwjdXGNyqSz8Vfym3vqPbFcvPf2bqQXWuRni6mll42tJUqEMk7Wivs04731dcpK9xwnI0
sRLGfs2Dg4wlt+vO2+ctyW22UVtd2tYG9+IN+NpaG/d6tWv9fbCD+yn50vtPyVuTykOT2RiwWr+0
Y2UvL8pQv9JUvvzvqxf1pbdyluGvWjWtW089SCjCjTz1V5NOmvrSb38ZO8pbM8kOD2gqWPp6MThh
LubylXatLqgvRXPzn9lXQXeuPxG4aNp6MSqYu7k840U7SfOb9CPLznyXlDZrXP4DSjX6Qzu7RpwW
3zadOPsXVnKT4snB5yBKmkaejounhL3atOs1aUuKivQj/M97t5I0ndrj8Qulo2no2KqYu92rwop2
lLg5P0I/zPckvKG11rn8AJyxHSOoopLViskvJp047+UVxbzb2tscJ5yDiePp6HThhXrVNkq9rdap
p5xX2n5T3aq2uV328fiBYTRUYwVfFNwpPOKXn1Pup7Fxm8luu8hsmPrRrE42rpeUaFKGrBO1OlC7
z48ZS4yefUshpLe7wHv0XR/6tXE9kqdN+yc1/DF/Wexy17PxDLC4GrpqUq1SVoJ3qVZt2V+e1ye6
Ku31DhmTuBsXpSFGDoYVONJ+fN+fU+9wjwgsuN3mNNW+kBMNoungYKtjLpNXhSWU5839WHN5vct6
bNa5DbE4utp2pGEY39GnTgsorhFe17XtbGtM23ISetS6Oebq1cVxycKT5bpTXHzYvZd5py17PxEb
g8BW01OUm8l5VSrN5R5yfsW17kOEk7g7xelKeEg8PhLqDynVeU6nL7MOEVt333NLcteIEaP0RGUP
lGJbp0N1vOqNboL2yeS68haTH1oFpLS0tIWpxiqdGHmU47Fzf1pPfJ59SyEjNy2JKlgKeg4qrilr
VWrwoeyVTguEdst9kTlvXbz+Aiq1evp2sr3nUlZRSXcklkkuCyReGfOQmnUp9GsqbjUxe+azhS5R
3Snxlsjuu8yctez8RD4HR9XTFRqOcneU5yeSW+UpPYuL95bWZO4SuK0lT0bB0MG73Vqla1pT5R+r
D1y38Ca21brxPxDHReiJaQvOTVOjDz6j2LkuMnuisy7Zxx2DaS0tGrD5Ph06eHTvb0pv603vfBbF
uEi3L0nAXo3REZQ+UYluFBPK3nVGvRgvbLYiWrMfWgGlNLS0k1FJQpQyhTjsive3vbzY0zllsSGD
0bT0fTWJxiyedOjslPm/qw57XuDUmvN/AROkNI1NK1Neo+UYrJRS2RityRZNM27E9RwlPo7FVcRF
TrtXp0XsjwlU90dr3k5dNdvP4Cv4ivV0pVc5tzqTfW29yS9SSK527FlUYdFVd2njHsW2NHm9zny2
R6zPLfsfEVmMamkalledSb622zTnyLPUrQ6LxdOk1LFtWnUWap8Yw+1xlu2LeZ5dPZ+IqLetm9pp
zGiAwoMAN2AFBBgBsijADADADADdgBViA2UGAGAGAGAGEAloASUGAGmgBABgAloASAYAaaAEAGAC
GigS0AIYQIaAENXAEMoENBANoAQ0ADauVAhq4AJoAG0ADYANlAKQQCkADkACaABtFQCYAGSABsAQ
AJZQIaIgSUCGAJCDABNgo0AaAMKgwAwA1YA2QG0goUEH/9D6InpfJflUwAwA0EGAGEBgAloKElBg
QYAYAYAaIDADQQYAasVRoAwAwAwA0EGiAwAwAwAwAywAlooNAGAGAGiAwAwAwAwINFBgBgBgAloA
0FGEBgQaKDADADADAATCjQBgBgBgBgQasAaAMAMAMAMAMAMAMAMAMAMAMAMANWANWAMKowAwINAG
BBgBgBgBgBgBgBgBgBoijADADADADADADADVgDVioNAGAGAGAGAGAGAGAGAGAGAGAGAGiAwA0EGW
ChNigwAwAwAwAwAwAwA0AaCDADLACQowAwAwAwAwAwAwAwA0AZYAywBqwBqxQaAMAMAMAMAMAMAM
AMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMANWAMsVRiAFgGAGAGAG0
ALAMAMAMAFIijYBsqDEFGwoURkbCjZVGwgUQGyKMKBSCDZFGwBaKDCA2goWEG0AKRAKKBSChQQbC
hREGyqFIiBQUbKDABREGAGwowAwAwA2UG0RBsA2FGAGAGAGAGAGAGAGAGAGBBoAwAwAS2FGgDADA
DQQYAYAaYAkKNBBgBgAhgGgDABLCBIUaCDADTAEsA0AYAYAYAKiAKANoAWUCkRQsAIALQARBQtAB
ERQRABUAFQUEiAFiFBYgBURQVABUAFQUFQAWJFBIgBkAEQUFQAVABYkUFQASIUFiAFiFBIgBYhQV
ABIhQVEAZBQRABUFBYgBYhQSIAREUEQAQAIAEChaAFBQpBAoKMACIIMCjADADQQIasFGAGAGAGgg
0EGmFGgo0ECGADkECGAIYQDZQDYAOQQCYAJhAJoAGwgE0UA2ggG0ECGADYANhAJoAG0AIaABhANo
oEMAHJBAhoAGECGrACGggQUCGrBAhoAQwBDAENACAgQwBDQAiSKBDABgCGgBDCAbAENAA2rgA2AD
ZUA2ADYANgA2ECGUCGiAQyjQbCBEkAIauUCSA0VAlogNBRoqDQBhAaSsAbAFBQpIIFBRiACIAIgA
iCgiACIAIgAyIoLEALEKDRACxIA0QoKgMioKDRIAsQAsQoKgAqIAqCgsQAqCgqACogCxCgsQAsQA
kQovfR/ALCQeIqZZZX3Lj2+zrMWu+GOvIr2kse9IVHJ7NkVwRqTTnllsNoRc2ks29gZF6owjoKjr
Szm/W+HUjHL0T7MFQq1XXk5Sd29ptw3sGw2HliZKEdrBJsWzFVo6IpKEPOez3tmOXe3tFUT1ndm3
APMFhXi56q2b3wRGpNiwY/FLAwVKnk7dy+JI65XXgVw04B5gsI8XK25bWStYzYmMfi1ho+Khk7dy
+JI65XQr5pwDzB4V4qVty2slbxmxK47FLCx8XDJ27vzMx0yuvAgDTkHOFwzxUrLZvYWTYmMZiVgo
+Lht9n5mY6ZXQru024AlDDvEy1Y/6Eak2J6vWjouChHzn+rszy629oq85Obbe1m3Eap0nXkoxzbB
JsWfyNDU+Mn638DHLt7IqVetLEScpO7Zpxt2AKLk7LayoLbgsJDRFN1annW7uS5meXeTtFV0hjpY
+WtLZuXBGo45XYjWGRbNC6IVJePrZWzinu5v3d5m12xx9aIfTemHpB6scqa2c+b9xZGM8tiuyNOY
ndB6EekZa88qaffyXvZLXTDHYkekOnFTXyehkllJr/Cvf3Ekazz9IKEzbgHujNGT0rPUhs3vcl+t
iJbpccdi96Rx9LotRVGir1Gsv+FL3fAxJt3t7PA5bXqyrycpO8m7ts6PMBU6MsRJQgm5N2SRUk2O
paO0fR6JUXWrNOo1n/wY+9+4527eqTsm6OaaY0vU0xUdSez0Y7kv1te83Jp5ssu4QrKyOi9FOiqa
WKxKtBZxi/8AFLlw47dm3Frv08PWiJ6W9KnpZujRdqKeb+u+PVwXb1XHHTPU6mxQZG3AWHo30aqd
IKm+NKPny9y5+zb15t06YYdwvvSbpHT6M0lg8GkqiVsvQXvk/wA2Zk27559viDjywzqNym9ubzzf
Hb7/AMzo8uhIYTBzxs1RoxvKTtZe+/Lbfduas1Fk2Ov4fD4foFhnVqtSqy2vfJ/Vjtdlveb9SOft
PXJOnBxrTGl6umazq1X5W5bNVcFuiufnPtOkmnkyy7hCy2Lhuyy7FvfN/ArA630M6GqgvlmMWql5
UYy28dad+9LteZzyyerp9P1oh+mHS56ck6NDOhB5yeUG+L+t9mOx2vaWSVk0x1Op3cCgKVvpFK3G
rLa7bqceXess4LI04iy9GOitbpDK0E6WH9Oo/PmuC6+Hm8dZolunTDDu+A6N0l6R4bobQWEw1ozS
soxzcU9+d/KfF323tLYYk2755zCag4hipt54huKbuqUX5Tb3zbu03xleXBaruuryX7welgqmNnCl
KL1m/Iw8Mnd75Xvq83K8rLPLNF1v+wO4YShh/B/hPHYhx8Y1ZRjsu/Qgnn1yebtduySXL2nrmunP
I45p/S9bTtTx+Nk4Q206Mdtt1k9ie+cs3uTWS6yaeXLLu5/ARU068E6tqOH2xhFZy5pPOT+3J2Wa
T2RDI6h0L6JfLYrEYiCp4VeVCk9s7ZqdRu11vSdlvSS87GWT0dPDfm8Bn0v6X1OkLlhsG9XDRyqV
W7J9b3R4LbLcnsEmmep1O7xOBz3D1PFSVPBpyqPbVt5XPUXoL7T8q2d4q6NuM+4T/Rro5851vF0r
VKiznUavSpr/AJyS4ejf6yzWbW8MNjq2nekuG6DUfEU71K7V7N3bb9Ob9i6kklsxJt6cs5gOJYqp
W00/lOLnqU23bLbxVOO/m3lfzpX29OHkv2vNAYVKmkU6OGj4uis53e5elUm7diyinsjd53g54Go4
qGjnqYXy6ry8bbO/CnHavvPynuUd5N64GPC09FvWxPl1tvir7H/xyS2fdXlcXHe5Na5G/E1NK/T4
ifi6KyTtll6NOCtfqVktravccLzyNfKZ439mwcHGEtqWcp23zllkttsox27cwb34gWp0dDeZq1q/
1ttOD+yvTlzfkrcpZMcnsjUMA6n7TjJyUZ5rfUqdV9i+28uGs8hs160bdarppqhQgoU45qEX5Ktt
lOT2vjKWzdZZE4N93gE+VUtC5UGqlbfVt5Mf92nv+2/wpbW5N9vAHR0alH5RjJOMJZxW2pU5q+xc
Zyy4azyG0160ZPEVtOSjQow1YLONKOxcZSb2u22ct3BZDg33eA58fR0FlScauI31NsIP7CfnP7Ty
W5bJDlfZAMNo54tPE4mbhSbd5vOU3vUE/OfF7Fve4JJvzRrFaRljUsPh4OFK6tTjnKT3OT2ylw3L
ckC3fiB2sNS0DnVUauI3U9sIffa86X2FkvSfojlrXb8Q3o4evp+pKpOWSznUm7Rit136lFZ7khwz
q5A1fSkMDF0cJdJq06rynPil9WPJZve3sTS3LXA1hdFQw8FXxbcabzhBefU6vqx4yfYmxsmPrQHF
Y6rpmUaUI2inanSgnZX4La297d2xwW7EioUuj3natXFcNtOm+e6c1w81Pbd5Kcr7PxEfhsJX09Ul
Nu/pVKk35MVxk/Ytr2JF4ZkuQe19J09HwdHB3s1adZq058l9WHLa973BreuPxAdH6IU4ePxEnToL
Y/Sm16MFvfF+at/AbJj60D0jpZ41KlTj4uhF+TTXHjJ+lLm+pWQ0ly2JClo6noWKq4ta1Rq8KGx8
nU+qvs+c+SJva67efwEbXr19PVle85ytGMYrJLdGKWSS4IvDPnITHjKXRrKDjUxW+W2FJ/Z3Snz8
2L2XeZOW/Z+Ih8Hga2m6r1fKk7ynOTyS3ylJ7FzftLwzJ3CUxGkqei4Ohg3dyVqlfZKX2Y/Vh65b
8siNW68T8Qz0XoeWPTqSap0YefUexcl9aT3JepC1nHHYPpHS8Zw+T4aLp0E80/Om16U3v5LYvWJF
uXpArR2iIuHyjEtwobredUa3QXtlsXWXZMfWhtpTS0tI2ikoUYeZTjsjz5ye+TzYkS5bEjhNF09H
QWIxiyavTo7JT5v6sOe17uJLWpNeb+Ai9I6SqaVnrz6oxStGK3RityDNuxOUsHT6PRVTExU8Q1eF
F7I8JVPdDbxJy3rt559wgMRiKulautNudSb623uSXqSRrhjkWRRh0WV3aeM3LbGj17nPlsjzZOXT
2PiK5CnV0lVstapUm+ttsrnyLJOtDownCk1PFtWlUWap8Yw4y4y3bFvM8t+x8RXMJg6uk6ip005T
k/02/a2Vzk2LFXxlPQEXRw0lKs1apWW7jGny4y2vdkTl0328fiKmacxgBsoN2IDLBBsA2RRgBgBg
BgAqwBuwBsAwAwAwAwAVYA3YgE7Cg0AaauRQm1ioNAGmrgCWrAGgDTVwBLVgDQBjVwBDVgDTzKAb
QAloAQECGgBDRQIaCBDABsAG1YAQyoBMAGwAbABMoBtAAmggEwAcgAcigFIIAyQAMAQ0UCWiAQUC
GECGgBIBoAwqDViA1YKNAGioMAMANoihSCDZQf/R+ibR6HyX5VElBgBgBoIMAMIDADTQUJsUGggw
AwAwAwgNAGBBoAywBqxVGgDADADQQYQGgDADADADADTRQJAMAMAMIDQBgBgBgBoqDADADABIUaID
ADRUGAGAGAGAAmFGgDADADADADADADVioMIDQBgBgBgBgBgBgBgBgBgBgBgBgBqwBoKMKDADAg1Y
AwAwIMAMAMAMAMAMAMAMANEUYAYAYAYAYAZYA1qhBqxQaAMAMAMAMAMAMAMAMAMAMAMAMANWIDQQ
ZYKE2KDADADADADADADQBgQaAMANNBRoAwAwAwAwAwAwAwAwAwAwAwAwA1YKNWKDQBgBgBgBgBgB
gBgBgBgBgBlgDQBgQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYUGwDYUYAYAYAKiAKAM
AMAMChSIDYBsqDEFGwoURkbCjZVGACyINkUYUCkEGyKMAFooNkBsAWgDYApEUKKgUgo2RAoqhREG
0FCkUCkQGAGyg2gDZEGAGwowAwAwA2UCiIMANhRgBgBgBgBgBgBgBoIMAMAMANNhQkAwAwA0EGAG
AGACWFCQgwAwAwIBhRgBoINMASFGggwASwoSEGAGAGAGAG0ALANoAWAbQAQAWgoJEAWgoWAEIoKg
AiACoKCxACxCgsQAqIAqCgiADIKCIALEgCxCgsQAqCgqACoAIiKCoAKgoJEAKgoLEAJEKCxACxCg
qIAqCgqACoKCoAJEKCxACIihaACABAAiCgiAFBQpBAoKMAFoINhRgBgBgAloIEhRgBgBgBoINACQ
owIEMAQ8wgGAIYAORUA5ACJIADIIByQQCkACYQDaKAcggGwBDCAbABsIBMAGwAbABtWKBDRECGig
GwgG0AIYQIauAIKgG0AIaCBIANgCWgBDAEMAQ0ECGrgCCgGwBDQAhoIBsAQwAbABtWAENAA2EA2U
A2ADkACYQIYAkoBsCwhoCkMIBgCWUGiA0VBpogEhRoINFBhAbAFIKFIA2AKSAFoAIgAiCgiACABE
QBUAFiFBUAGiFBYkAaIUFQGRUQBohQWIAWIUFQAVEAZBQWIAVBQRABUQBYhQWIAWIBP6B0Z841PK
8yOcufL9bjNrphjsS/SPSeu/EQ2Lzuvh2e3qJI3nl6Cro05C56B0eqS8fUyy8m+5cfgZtdsMfURG
kse8fUv6KyiiyMZZbDFK5WYLpg6EdEUnUn5z2+5Ixy7ydsFZr4iWKk5y2s0427GqNN1WorNsqC2+
Toelxk/W/gjHLv7MFYnN1W282zbiDUaLryUY7WQk2LHVqR0XTUY+c/bxM8u1+yK05OTu9rNOVB6F
F4iSjHaEk2J+tUjo2GrHzn+rszy7X7IrspOTu9ppyBKNF13qrawSbE/UnHRkLLOT/VzPLtfsiuTk
5u7zbNONG6dN1WorawkmxYW46Kp8ZP1v4GeXb2YK1Vqus3KWbZpxt2BKLm7LNsoLNQow0TT15+c/
1ZGOXaTtFZxeJlipa0v9DTjbsNHmVBadG4COAj42rk7d35ma7YzXmivaS0hLHyvsiti/W8sjnlls
RTKwLHoXRHjLVqvmrNJ7+b5e3qM2uuGPqGmnNMfLH4uD8hev8iyJnlsViRpyExofQ70nK7ypra+P
JfrIlum8cdia07pmOCj8noZNKza3LgufHh17MyOmeWvEHP2dHnDnAaPnpKoqcF1vclxZLVk2L9i8
VS6K0FTp51Hs5v6z5f6GOXot7IOX4mvLEyc5u8m7tnR5bdgEabqtRirtuySAOn6L0ZS6L0XiK7Xj
Ld32Y8+PwMW7enHHsm6Od6a0xU0zU15ZRXmx3JfHizcmnnyy7hBMrAv3RXosq9sTiFams4xe/m+X
t6tuMq74YetDLpb0qekm6FF2pLa/rP4e3aXGaTqZ78QUBm3ATvR7o7U0/UsvJpx8+fDkuf8AqZt0
3hh3DomndNU+jdJYTBpKaVr7oc3xk9vreW3Em3oyy7fEHJdTVbk23NvNvbd9+fe9+aOjyhWHw88d
NU6avKTskv17Ni3xWQJNjruEweG6CYZ1arUqrVr72/qx4Le+O13yOftPVJOnBx/TOmKumqzq1G7+
ivqrgt0Vxe17TpJp5csu6iHjT1lfJRT2vzU/bJ9/aisjrPQzolGmvlmJVkleGvta+s16K4Lbxdsj
nlXp6fT9aIXpl0qemZ/J6d3ST8yO2bW+b3RX1duV3qu1rjNM9TPfgUG3jHq2VSUdkVlTguLex83e
2xuUthpwFh6NdHp9Iq+T1oxtr1WvIivqwi8m+F1qr6uxuW6dMMe4dI6S9IY9HKXyTBWVRLypt5U7
75N7Zvalm3ts8k8Sbd88+3xBxGnNzcpUneV7zxE9ze9XvZ8HnN7rO6OjyfvYJo3CVMbUVPBxcqje
dWWVr/V+r15zdsrZoq4zfA7hoTQGH6BYeVeq1Ou15U8l+GLexcW9rze5Llb3PXjjOnNjkWmekFXT
+I1oLxlTPVdvIpr7Cfe6k7cbRsmdJNPNll3UQcdWjO0f2jESe2zlFN8F6cub8nlJZlY/jR1Hol0B
eKksbpCWt6Sg3dO2xyexrkstmdroxcnow6W/NGdO+lkcRfDqTjRW2Ecp1Ot+hDr8qX1dVpkxh1M9
+BzOcZ42CnWao4dX1IpbeOpG95Pc5N8nLYjbhyJbQWiq3SefybCx8VQVvGS2u3GcstZ8IqyvnZZs
l8NY493iDq+lNKUOg1COCwUNfEyXkxSu7v0522vgvYkYk29GWXZ4nI4ria0MNOVStJYjEyd3neEX
9prz3yXkrjJeSdXlvj76E1MO6tq+Nm0pJasF58lustkI8G1a3mxlawNetGk6umFqwUaWHhm87Qjz
k9spPtk9kVbIcHPwGRxkcK/FYNSc5ZOrby5X3QSvqp8ryfFJ6oTeuBv5LS0RnXtUrf3Sfkx++1tf
2YvrkvNG11oKWHqaV/aMTPUpLJSayy9GnBWvbgrRW9ohz5o08XLF/s2Dg4wlk0s5z5zfDfZWittr
5g3vxAr6HQv1a1fvpwfsnL+Rfa3OT2RqGDnjr4nFzcacn57zlNrdCO/hfKMd72IGt+aNVMZPSFsN
hYONNvKEc5TfGb9J90VuSCb34gLajoPbq1sR306b9k5fyL7W5yvs/EBpYKppVyxOInq07+VVlm2+
EVtk+SyW9pF4TW/NG8RpPxkfk+Fi4UpOzW2dR7tdrbyivJXBvMaLfSB0sHS0JniEqlfdRvlH/eNb
/sLPi1sc5XXbz+AbQp4jpHUc5NWilrSfkwpx3corglt2JNjhPOQcVNJU9GRdPB3u1addq0pcVBeh
H+Z72lkOV3rj8QnC6JjRgq+KbhTecYrz6n3U9kftvLhd5DZMfWgeKx9TS7jRpQ1aadqdKF2rvfxl
J75PN8lkOEt2H3i6PR/z9Wtifq7adN/a3Tly81b77By17PxDGhhq/SCpKcpX31Kk3aMVxb3Lgl1J
DhJLkHlbSdPR0XSwd81adZq05co/Ujy8573uIty1x+IFgdEKUPH4iTp0Nz9KbW6C385PyVxvkVJj
60D0hpZ41KlTj4uhF+TTW98ZPbKXN9SSQ0ly2JCGj6WhEqmLWtVavGh7HUe5fZ8577Ib23rt5/AR
tWtiOkFZKznN5RjFZJblFLJJdy2jhnzkJbxtLo5lTcauK3z2wpv7O6UvtbFuu8yctb7fiIvBaPra
aqSad/SnUk8orfKUn/q912XhiTuEjiNJ09GwdHB3zVqlZq0p8o/Vhy2vfwGm7dcfiGmjNDvGxdWp
LxdCL8qo+P1Yr0pcl1uyFrMx2CaQ0uq0PEYePi8Ons9Kb+tN73wWxbuI0ty9IDYDREKcFiMU3Cj6
MV59R8IrcuMnkt12S0mPrQ10npaekmo2UKUMoU4+bFe9ve3myyJllsSVDRtPREVWxivJq9OhscuE
p/Vjy2y5LMb21Jrn8BEY7H1dL1NaebyUYpZJboxS2Lgl7Rwzb3CehhafRtKddKpidsaTzjT4Opxl
whu38Cb23rt+IgalStperd61SrN9bb5fDcHPkWG9Povs1amM47Y0urdKfPZF8WOXT2PiK9QoVdK1
dWKc6k31tve2/a2XhiTYsVTFU+jidPDtTxLVp1lshxjT58Z9xOXTfbxyIDA4CrpSoqdNOU3+m29y
4tltc5NiexGPp6Fg6GEetUatUrrfxjT4R4vbLqM8t29vifiIXRujKmlJ+LprPa28lFLa5PckViY7
EzjNJU9G03hsI7p5Va2xz5R4Q9b382m7deIKuacxsA3YgN2CDYUYQGAGAGAG7FBuxAKsAYAYAYAY
AYAKsFG7EBsIMANBQlqxQaCDCKENFBoIMAENWCjQQYAIasAaAMAENWAENFAlgA2gBLQQIYAhlANo
IENACGrgA2ioBNAA2ACYANgA2igEwgEwAbQAJlANgAZBAJoASwBAAhooEtBAgAGwDADADQQYUGmi
KEgGggwAUgoUVBgB/9L6KHofIflU1YKElBgBoIMAMAMIDADQAlqxQaAMAMAMAMIDQBgQaAMAMsAJ
KowAwAwA0RBoAwAwAwAwAywAloqDQUYAYQGgDADADAg0UGAGAGACQo0QGAGioMAMAMAESQAmwBoK
MAMAMAMAMAMAMAMKg0AaIDADADADADADADADADADADADADLAGrAGWANBRhQYEGrAGBBgBgBgBgBg
BgBgBgBgBogMCjADADADADLBBqwAmxQYAYAYAYAYAYAYAYAYAYAYAaAMANEQasFGigwAwAwAwAwA
wA0AaCDADLACQowAwAwAwAwAwAwAwAwAwAwAwAwAwA1YKNWKDQBgBgBgBgBgBgBgBgBgBoIMAMAM
AMAMCjdgDLAGWAMsAZYAywBlgDLAGrAG7AGWAMsAZYAyxUGAGFBhAbCjADADABaIDZQYAYAYFCkQ
GwDZUGIKNhQojI2FGyqMAFEZCiNDCg2ggURRgAuJQbIDYApACgBSIoUVBsKFEQKKo2iAUgDaKBRE
Gwo2UGACiIMANhRgBgBgBgApMoNkQYAbCjADADADADADQQYAYAYAabChIBgBgBoAwIMAMANMASFG
ggwAwA0wgQFGAGggSwo0AaCDABDCjQQYAYAYAYAYAEAMAFoA2AEQASIULiAEQULACABERQRABUFB
UAFQAWJFBYgBYhQVABUFBUAERAFiFBYgBUAFQUFQAVEUEQAVBQVABUFBIgBYhQWIASIUFiQBYhQV
ABUFBUAFQUEQAREUEACIAIgAiChaAFhQpBAoKMAFoINhRgBgBgBgAloIEhRgBgBgBoIEsA0FGggG
AIYQDYAhlQDABsAE0EAmADYQCYQDYAJlQDYAhhANgA2ADYQDkADYAhq4AMIBsoEMAHJBAhhAMoEN
EAlhANlAhoIENACABDAEtACAAbCBDQAhooEPMAQADaABsIEMAQ1cAG1cAG0ACZUA2AIYAJgCAgQy
gQ0QIQyjQbCBEkAIZQJIDADRUGiATYKNBBhQbIoUggUFGIAWQColARBQVABEALQAREAWIAaIUFQA
aIUFiQBYhUoqAgyACxIoLEALEKCoAKiAKgoLEAKgoKgAqACoigqAHWHoyxElCKu27ILJsdDxVWPR
3DqEPPezm977PgjHL0X7EFBvrZvaaecTehtHPSE8/MjnL4dpLW8MdiZ0/pG30ENi863qRJHTPL0F
ZRpxFp0Ho+/009i82/tM2u2GPqGWldIfLZ2XmLZz5lkZyy2I5FYFs0ZhFgYOrUydu5fFma7YzXkQ
mLxTxc9Z7Ny4Isc8rsAS1nYrItWHpR0ZTc5ec/1Yxy7ydor1eu8RJyltZpxt2Ewi5uy2sKLLShHR
lPWl5z9vAzy6z7MFfq1XXblLazTlvYTGLm7LawCx0oR0ZT1pec/1Yzy7T7Ir9as68nKW1mnG3YGk
5ZLaAWPD0Y6Ng5y85/qyM8usnaK/ia7xMtZmnK3YbpXKyLHg8LHARdSpt9n5mK74zXkQOOxjxkrv
ZuXA05W7DCRWRY9FaOVJeNqZWzSe7mzNrtjj6iK0ppJ412XmLZz5lkYyy2IZlYE3ofRPyp+MmvIW
xcfyJa6Y47G9OaX8b9FTfkra1v5Ll7eoSGeXoKpI05CR0VoqWk522QXnP3LmS3TWOOxYtMaVjouH
iKGUrWy9FfH/AFMybdMsu3xBz6WZt5wbCYOePmqcFdv1Liwsmxf6lSj0VoasfKqS75Pi+CX6zMcv
RfsQczxWJnjJuc3eT2nR5rdhqoOo7JXb2IIOlaH0TT6PUniMRbXt/DyXN/l14t29OOPb5ooenNNT
0zPWeUF5seH58TcmnDLLuEDIrAu/Rbov8stiK6+jWcYv0ub5e3q24tdunhvzQPpZ0p+W3w9B2pLK
Ul6XJcvb1CQ6me/EHPWbecTOgNAVNPVNWOUF58uC+PBEt03jh3Dpel9LUui9FYbDJa9uu3N8ZPht
32srGJNvTll2eIOTVqzqvWbu3m3x5/nsv6S2HR5dgNGhPGTVOCvKWSS3+y/PZHi2Ek2Ou4HA4foP
h3XrNOrJWb3t/Ujy6luuc7e565J05ujkmmdL1dOVvGTvd5RitqXCK3de17eR0k08uWXcIqNJZrKV
tqT8lfelv6k+p7isjqPRLonCSWMxecYq8FJWiks9bVytHer2vtst/O16On0/WiH6X9L5aUbpUpOn
huK8+pzSyajwbsnnm/NLjNM9Tqb+AoM0qK1ZJ04v+zWc5cNZ7l1q2xqD2mnEWXo90Wq9IampP6Oj
F3lGO77z+tyd5LhFWJbp0ww7h0HpD0nw/Q6ksHhIp1bWUI+jffJ75Pbvb2vamYk27Z5zDxBxXGVX
UlrYluU7tqlF7G9us9ze/bN72nmdHkv3hccJPF1I06icpt2p4eGVr8d0ed7zdvKt5xV1v+wO24LC
0OgWFeIxLj4y1lGOxN+hBb+cnm7Xbslbl7T1yTpzdHH9PaYr9I5+OxknTo7adJbWt2rHfznKy22v
bVOkmnmyy7uRFJSxNPK1DDX27XJr11Jcsoxf1Eysc/dB0/oR0TjiI/KKkfF4e2Sl59VcZvdD7Kyl
vckrvGVejp4b8+gb9K+nlTSc/kmjk9XY5x2u31eEV9btVkrtMTPqb8Qc0fitHu7tWrd9OL/zv+T7
6Zt5+BZ9BdFK3SHEftDlrZOUd8Vu1t0F9WPnPdGMfKUt06Y4d18jsGl9I4foXhlSo6lPhlez422y
ly6taSWZzk29OVmEHBa2kK2l5zhh1Ly7upOTWvJb3OeSjH7KtFZXva511p4974DTx1HRWVK1Wt9d
q8Iv7EX5z+1JW4R2SLynAJPBrDt1cbKTqSz8Xfy5X3zbvqLrvJ8Encm11rkb1K2mleTjSw9Pspwv
uSzcpP8AFOW132jg9obWNVH6HBRleXkupb6Sd9ySvqp8I3b3yayUN+4Z8mo6HzrWq1v7tPyI/fa2
v7Me2SziOTWhioVdMfT4iepSWWu1ll6NOKte31Y2S3tLMcGt+aNTxzqr5Pg4SjGeTtnUqfea3fYj
lxu8wb9ICeIo6F/e6tav/dp3hB/ba85/ZWS3t5xLyeyBww1bTTeIrz1aaydSWxW2RgltfCMdnJZj
hNd3mjK2k1CLoYSLhCWUpf2lTk2ti+xHLi5PMaN+kBVgKWhvKxS16u6gns/3jWz7i8ri4729rrXP
4AKhiOkc3JtasFm3aNOnH2RXBLNvYmxwauQPLSVPRScMHdzeUq7VpPioL0Fz858lkOTeuPxCcNoq
NKCr4tuFN5xiv3lT7qeyP23lwUnkTZMfWhOIxtXS7jQow1ad/IpQu8+L3ylxk8+pZAt34/gHvi6O
gPO1a2I+rtp03z3Tly81b9bYOV9n4hnQwtfT9SVScslnUqzdoxXN+yKzexIcMyXIOa2lKej4ulg7
q6tOs8pzW9R+pHks3ve4aXeuPxA8FoiMYKvipOnRfmpefU5QXDjJ+SubyG1mPrQPHaUnpBKjTjqU
U/IpRzz4vfKXN9llkNJctiRjgqWglrYlKdfbGhujzqNf4Fnxa2DlddvP4CObxHSKtvnUexLJJLhu
jFdiQ4Z85CTeKo9H8qDVXEb6u2MOVNPa/tv8K3k5b328ciNwGjaul5Sm3aKzqVZvyY33t729yV22
XemZNh9idKwwcHQwacYPKdV5Tqf8GP2Vt3tk0ty14gFo7Q/joePry8XQT87fJ/Vgt757FvZdpMfW
jWktMfKoqjSj4uhF3UE82/rTfpS9S2JISFy2HOF0VTwUFXxl1Fq8KSynU5/Zh9p5vct42sx15oYa
R0nU0tJXSUI5QpxVoxXBL2va944S5bEzTwNLQCU8UlOs84UNy4Op7VDa99kTlrXbz+AhsRia2mqt
5XnUlZJJdySWxcEi60xb3Cc1aXRnOWrUxe5bYUnz3SmuGyL4snLfs/EQVOnW0zWstapVm+tt8X8d
iReGddwn3iKXRtatBqpidkqqzjT4qnxlxnu3cTPLe+3jkQeCwNXS1TUppym7ttvZxcm9i4tlYk2J
utpCnoSLo4R61Rq1Sv7Y0+EeMtsuSGttb7ePxEPo3RlTSs9SmtivKTyjFb3J7kW3TOOOxL4vSdPR
0Hh8G8mrVK2yU+S+rDlte8jdy14gjdF6KnpSTUbRjFXnOWUYri37FtYtYmOxI47StPDU3hsJdU35
9R5SqdfCPCPfmTTVvpAx0VomelJOzUacVedSXmxXPnwW1l4THHYfaR0tCFP5NhU40fSk/OqNb5cu
Edi6xI1cvSCumnMbsQGwg2FGEBgBgBhQbsAbsAKIDADADADADYUbSAFEBgQYUGAGwo0AYRAloqhI
BhAJaANFBoIEtBQkIMAEtBRoAS1cIEACGigS0AIYQIaAENAA2ioEMAG0ADaKgG0ADaABtAAmgAbK
AUkACkEApAA2ADaKAMkEAmAIYAhooEtEAgqAbyAEtACQDADADQQYUGiAS0FGggIUGAGyKP/T+ih6
XyX5VMIg0FCSgwA0EGAGAGEBgBgAhooNAGAGAGAGAGiAwA0EGAGAGrFUaAMAMANEQaAMAMAMAMAM
ANMqBIUYAaIDADADADAg0UGAGAGmgBIUYQGAGioMAMAEyAEgGAGWANWCjQBgBgBgBgBgBgBgBhUG
gDADRAYAYAYAYAYAYAYAYAYAYAYAYAZYA1YA0FGFBgQaAMCDADADADADADADADADADRAYFGAGAGA
GAGrBBqwBooMAMAMAMAMAMAMAMAMAMANAGBBogNWCjRQYAYAYAYAYAaAMCDQBgBqxVGgDADADCAw
AwAwAwAwAwAwAwAwAwAwAwA1YKNWKDQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgB
hQbAMAMAMAMANAGwDADADABZAbKDADADAoUiA2AbKgxBRsKFEZGwo2VRgAojIURoYUG0ECiKMAFx
KDZAbAFIA2AKQULCDYUKIg2VQpEBsAUUCiINhRgBsoMQAoiDADYUYAYAYAYAKTANhBgBsKMAMAMA
NBBgBgBgAlsKNAGAGAGAGggwAwAwASwoSEGAGAGACGEGgowA0VAkijTCDQBpgCADADADADTKgxAG
yKFoA2ALQBsAIgBcQoJEAWgoIAEQAuJFBUAFQUFQAVABUFBYkASIUFQAVABUFBUQBUFBYgBUAFiF
BEAFQUFQAVEUEQAVBQRABUAFQUFiAFiRQWIUEiAFQUFQAVBQVABCKCIAIgBaACRCgkQBYApACgow
AWgg2FGAGAGAGAGggS0AaCjADADQQaCBLCjQAiQAhhAhgA2ADZUCGACkEAmACYQCaABsIBsqAbAB
sIENAA2gAbCATABsAQwBDABtBAhooBsIBtACGggQwBDKgQ0AIaAEBAhoAQ0AIYAhoAQwBDVwgQUA
2rEAhooENAA2ECGADYAN5AA2gAbQQDaKAbAByABsIEtACCgG0BohgCGEAwDTRUCSKMANFQaIDTQU
JAFIIFIKNgCkQGygWgAiCgiACIAIgAiIAkQA0QoKgAyCgsSALEKlFQEGQAWJFBYgBYhQVABkQBUF
BIgBUFBUAFRAFiFBYgF/6N6PWDpvE1MrrK+6O99vs6zFr0YTXkVrSWPekajm9myK4I05ZXYBQoyr
yUYq7bsgk8i/V5x0Bh1GPnvZze99nwM8vRfswUhtyd3tZp5xKaLwDx9S3orOTJW8ZsTum8cqS8RD
LLO25cCR0zvoKyacRP6F0f49+Ml5q2c2ZtdMMdjNK4/5TLUj5q9bEhnlsRKNOYsmisGqa8bPsv7T
Nrthj6hhj8Y8XL7K2fEsjGWWwxDAsmj8IsLHxk8nbuXxM13xmvIisXinipX3bkajlldhqEFhwWGW
Ej4ye23d+Zmu2M0InFYp4qV3s3I0527DQILBgcKsLHxk8nbu/MzXXGa8iKxmLeKlfctiNSOWWWwx
YQT2jcEqS8bPLer7uZLXXHHXkRmkMc8XKy81bF7yyMZZbEZIrAm9F6N8Z9JPzVsXHn1GbXXHH1AN
LaS+U+RDzF6/yEiZ5bECacxKaK0Y8bLWl5i28+RLW8cdh7pnSigvE0sksm17F7+4kjWeXoKgzTiH
mj9HS0jPVWSW18ENtY47Fo0npCGhKao0fPt3c3zMybdcr2+IOfVJObu8295t5xvD4aWLmoQV5MEm
xf0qXRajd+VUl3yfuS/WZjl6PYg51jcXPHTc5u7fq5I289uwxtd2RWR0XQmhoaFpvE4iyklfP0V8
X+Ri3b0449vmim6d03PTE77Ka82PvfP2GpNOOeXcK6zTmLl0Y6M/ODVasvolsX1vy9pi12ww35C+
lfSfx98Ph3aCylJb+S5e3q2pDqZ78Qc7kbcBN6E6P1NNVNVeTBZylwXx4Et03jh3Do2lNJ0eilFY
fDpeMt12v6Uub3Xt3WTxJt6Msuyag5NXrSrNyk7t5tv3399l9k6PKA0qMsVJQgnKUnkrXb7N/W7J
Z5BOR13R2j6HQug69drxrWb2u/1Y+/vOfL1STCbo5XprStTTdXxtV6q2QW1pfYj/AJntexrYdJNP
Pll3CL1LXhZ3e2Cd5P78ty4rlmltDI6N0V6Hqqo4nF28XHyoU9kPvO+1c3tte7RjLJ3w6frQw6Vd
MXpe9HDWVCL8qpLzW+rfyWbe3VyTVmOkz6m+Bz6Dec4O2edae2/2Vnn1XlvvFXNOH72Jvo1oCrp2
pagnCmn5deXnc1Hg3wV3xlZ2JbpvDDu4/EdL07pel0Qw6wuE1YSStrPNR4t75TfBbMm7RtfEm3oy
y7JqDiiqSra06bcItvXrzflSb255vP6sbyzzbWzo8n72FaNwtTGzVPBRd27OrLJ58Nur1RvJq+bW
QpJvgds0H0dw/QWhKvUevWa8qTsvwxvklxbee1u1kudvc9eOE6c2OSac6Q1NPYjWivG1dkFa8IL7
EXte9zkvwqyZ0k082WXdRX6jhhpOVR+Prt7L3inze2b5LyeclkVz4+8dN6J9BamkZrGaR8xeZTeW
zitkYrdHLmksni5e56MOnvzQvpp0q+co+Jpz8Vhdjml5VW26EcvI+07RfHc2MXqZ7+A5rTlPHRlC
hFUaC8+Te3hrz9J8IpdUbm3DngTXRzRUtKVvE4FO6/eYiS81fYXo8vTfGKulLdNYY74/EdQ01pzD
eDzDrDYZKVeSvZ5u79Ob9i37FZIxJ3PRllOnNQcZxUamOl8px9SS180vTmvsx2Rjzdo8FLYdPg8t
8+aERlV0snToxVKhGzlnaK4SqSfnPhfqjFbBwnIyOLp6OerhU5VXl45rO/8AxuPo/eflcNXYOV3r
gbeDp6Netiryq7fEp53/AOOS9HnFeVx1dpDWuRvUraa+kqONOhDJNq0I/ZjFbXyV5Pa97HB7Q18v
VL6HBRktbyXO30k77lbzU/qxzexuQN+4b+S0dD517VK26kn5Mf8AeSW/7EXfjJbBya1yNKjW043W
rSUKUcteWUIr6sIrfwjFc8ldl4PaGVNJRoJ0cHFxUspTf7yd92Xmxf1Y7d7kNJv3BawFLRHlYry6
u6gns/3kls+6vK4uI3tda5/ADUcR0indtKEFtfk06cfYlyWcnxY4POQLLSVPRScMJdz2SrtWl1QX
oLn5z4x2DW13rj8QmhomNCKrYtuEJZxgv3k+pPzY/al2KQ2mtchFbF1tNSjQow1YX8ilC9r8Xvk+
MpepZDgt7vEDq1DQX1a2I76VN+ycv5F9onJ4x++gGHwdbTkpVqs7RT+kqzeS5c3wis+CsOCTf9kH
r6Vhg4ujg04xatOq/wB5Pl9mP2Vt3tjRctcDWG0TDDQVbFtwg1eFNfvKnUvRj9p9iY2THXIDi9IV
dLuNGnHVpp2p0oJ2u/XKT3yd2+rIcJb3B/8AJ6OgM6qjWxG6nthB/ba86X2Vkt7ewct67Qxp0sR0
jrNtuc7XlJu0YxW9vZGK7EtiHDHnISEtIUtCJwwj1quyVe2ziqaexfaflPdqjW2t9vH4hjo/RE9I
J1aklToxfl1ZbL8FvlLku2yzFrMx2D43S8YQeHwqdOi/Ob8+pzm1u4RWS5vMaauXpArB6HjTgq+L
bhSfmxXn1Pup7Fxk8uF2Nkx9aAaR0tLSCVOMVTox8ynHYub3ylxk8+pZCRm5bElS0bS0LFVMYtao
1eFC9nydR+ivs+c+SG9tzHt5/ARWLxlbTdVXvKTtGEIrJLdGMVsXJDhm3uEz4ql0bzqKNXFbobYU
39rdKX2di33eROWvZ+IhoQr6drelUqzfb+SXYkuReGPOVE48TS6OeTQaqYnfV2xp8qfF/b2LdxJy
3vt45ENgsDW0xUcYeVJ3cpN5Jb5Sb2Li2XhmTuEvW0jS0NF0sG9ao1adfY3xjT+rHn5z5Imttb7e
PxEVozRVTSsmo2UY5znLKMVxb921lt0zjjsSmL0pTwMHh8HdReVSq8p1OX2YfZ2veRq5a8QMdF6I
npJuV1ClDOdSXmxXvfBLNjbOOOw8x+l4U4PDYROFH0pPz6j4ye5cIrJc2JFuXpA30Vod6QTqTkqd
CHn1HsXJcZPckW0xx2D6R0uqkPk+Gi6eHT2elN/Wm974LYiaXLL0gRovQ7xqdWpLxdCHnVH/AIYr
0pcl2i1Mcd/AE0nphYmKoUI+Lw8XlHfJ/Wm979S2ISFy34nA1ovQ3yuLrVZeLw8fOm97+rFb5P1b
WNrjjv4DNKaY+VxVGjHxeHi/Jhvb+tJ75PuWxFkMst/AQqQYG7BBsijADADCg2AbsAbsAbIDADAD
ADADYUbsAKsQGFQYAYAbCjABViAywAmxQaIg00FCbFBoINNEUJsUGgg00FCbAGgg01cKEtACGioE
sAQ0AIaAENBANgCGigQ0ECGgATQANoqAbQAKQANoAE0ADaKATQQCaABsAFIoBSAAhAhoASwBBQIY
AhoIEgGioE2Io0AYAaCDCgwgE2AFFBhFGwD/1Poqel8l+VTQQYQGgBJVGAGggwAwAwgMAMAEtACS
gwAwAwAwAwgNAGggwAwAwA1YqjQBgBoINEBgBgBgBgBgQJaKDQUYAaIDADADADQQYUGAGAGmgBIU
YQGAGioMAEyAEgGAGAGAGAGrAGWCjQBgBgBgBgBgBgBgBhUGgDADADRAYAYAYAYAYAYAYAYAYAYA
YAZYA1YA0FGFBgQaAMCDADADADADADADADADADRAYFGAGAGAGWCBNgDRQYAYAYAYAYAYAYAYAYAY
AaAMCDRAasFGigwAwAwAwAwA0AaCDADADViqNAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGrBRqw
BoAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwoNgGAGAGAGAGAGAGAGAGAGAGAG0ALAMAMAMANhQp
EBgBsqDEFGwoURkbCjYUYUCiIFEUYUG0ECiKMAFIoFEBgAtBRsIFIKFBBsKFkQbRVG0AKIg2VQsi
DYUYAYAbKDaIg2AYAbCjADADADABaCDADADYUYAaCDADADNgAm9wo0AYAYAYAaCDADADADABAUaC
DADADABDANAGAGmECAo0EGAGmAIAMAMAMAEMqDcQBRFCogCgBUQBQAtABIhQtABEFBEALQASJFBI
gBYhQVABUFBUAFRAFiFBYgBIgBUFBUQBUFBYgBUAFiFBUAEiFBUAFRFBUAEQAVBQVABEFBYhQWJA
FiFBYgBYhQVABUFBEAFIoWgAkQAkQAkQoWgAgApACgowAWgg2FGAGAGAGAGAGggQ8gowAwAwA0EG
gBIAlgCAgGwAbAESKgGwAcgATCAUkEApIAHJBAJooBsIEMAGwgQ0ACaABsIBsAQwBDVwAbCAbKBD
CAcgBDCAbKBLRECGADKBLQQIauAIAEMAQ0AIYANhAhgCGUCHmADAENAA2gBDCAckADYANgA2VANg
A2ADYAgqBDIBDQFhDKihsARJACQDTQQasFGgDQQaANWANgCgo2gBQBsAWgAiCgkSAIigXEgCIALE
ALEKCoANEKCxIAsQqUVAQZABYkUFiAFiFBkAFRAFQUEiAFQUFQAZEASIUTug9GvSdVJ+ZHOXVw7S
Wt447Fi6T6SSth4bFbWt6l7+4zI6dTL0FPRtxF76P4FYODxFTLLK+5ce32dZiu+E15Fc0jjnpCo5
vZsS4I1HK3YDSputJRirtuyCQXmbjoKhZZzfrfHqRjl6PZgpspObbebe024B9gMG8bPVWze+CJVx
mxYdK4tYSCo08nbPkviyR1yuvArETTiJfReB+VSu/NW3nyJa3jjsPNLY7X+jjsW34Ekazy9BDGnI
TOi8D4168vNWzmzNrphjsJ0jjflD1Y+avWxIZZbEYacxNaNwd/pJbFs+Jm11wxANIY35S7LzV6+Y
kTLLYjisiZ0bgr/ST2bviS10xxDfSGN+UOy81esSM5ZbEYacxL6OwHjXry81bFx/Iza64Ygeksf4
96kfNXr/ACEiZZbEKzTmJPRuj/lT1peYvWS10xx2DaW0jf6KGzY2vYSRcsvQV1mnIPdHaPeOlwit
r9xLW8cdiY0rpFYKPiaWTtnbcviSRvLLXiCms04A+DwUsfNQj2vghtZNi2YzFU9AUlTp5zez4szy
7W9ooNWo6rcpO7e1m3AIp0ZYiSjFXk8kgmti/YehS6NUXOedR+t8Fy/1McvRJ2Qc/wAfjp6Qm5ze
b2LclwRuOFuxHsrIv+gtCR0bH5TiLJpXSfori+fDh17MWu+GOvNFW09pyWl52WVOPmrjzfP2GpNO
eeXcK2yuYtXRro29JvxtVWpL+Z8Ori+zqzbp1ww2HvSnpKmnhsO7RWUpL/CuXHu2bUi55+kHPY0n
U2d5tw0JzQ+g5aSqKEN3nSeyK+PDjtWVzNreOOx0DSmk6XRWiqNFJ1HsvxfpS58EvYYk275Zdk1B
yWvXlXk5yd5N3bfHnw9cuo6vLbsAp0pV5KEU3KT8lJZt8l73uz3A5HXNE6Ko9EaDr12vGNZu/wDK
m9r48Tnbt6sceybo5nprTE9MVPHTdoq6i3sS4QjvfGT3283I3Jp58su4Q0/o3neLl21JX/wp+tP0
isfv7x0Hop0Qde1bExUKSzjS+tznxXJ79yWTxlk74dP1oa9L+la0nL5Nh7zhvUdkrcWvRXBbdrkr
WLJpOpnvxBz1/SyUX9LNbIRypx47LX4u1o73J5m3ATugej8+kNazevq21pf2cFwVraz4RVo77yVz
Num8Me4dH6Q9I4dF6ccHg469drKKV9VcWlv4LJJZ5JJPEm3oyz7fE5HFMTVdeprVm8RXk/NTvFN7
m1t+7Cy+1tR0eS/iNrDSxNSMKl6tZ+TCjDYuTayiuMY57buLBrf9gdq0fg6PQfDPE4tp1bWSislf
0Ka9r2va3ZHPl65Oybo5Jp/S9fpHLx2Ln4qhtp01m2vsxyu/tysttn6J0k082WVy5ENDWxUGqSVD
D7JTb87lKVrze/Virb9VZsrPPwHUOgnROE0sTKLjSWcZTynPnbZCHVeUt8tXJ88q79LD1AemPhBj
iL4XBLXXmuVrxb4Rj6S6/JfCSsXHE6nV9IOaV6Kw8nUxknOq/wCzTz/HL0furyt3k5M24X7xOaF6
OYvphOKyp0I7MrRivsx3vi97Wcrkt01jhcx1nHYuj0JoLCYKClWavm1ZcalWWSS4XsnsVkc+Xpt7
JqDiGJ0hGjUlUT8fiJO8qsleKf2Iva+DkrLdFWTOryW/OhFTBrDt1cbKTqSz8Xf6R85t31F13k/q
pZk2mveN2raZXo0sPB/dpw9rlJ/im+Y4Xn4DSx0cL9HglLXeXjWvpJX3QSvqJ8ryf1rOwN64GfI6
Wis8R5dX+5TyX+8ktn3Y58XFjk1rkb8XW039LVkqdGGWs1aEV9WEVtf2Ypt7XvZeD2hqWkVh14rB
xktbJ1H+8nfcrean9WOb2OTGjfuClgaWiM8T5dXdRT2f7yS2fdXlcXEcmtc/gEqGI6QPWk1GnTVr
vyadNcFbJdSvKT3Njg1cguWkqejE4YS+tslXatJ/cXoLn5z4rYNbN64/EZS0VDBpVcY3G+caS/eT
5u/mR5vN7ovaNmtchM69fTso0KULQWcaUMox4t32vjOTvzsODdyB/GUNB+Zq1sR9fbTg/sp+fLm/
JW5PaTk9n4gFDAVdKuWIrz1ad/Kqzu7vhFbZS5LZvaWY4STfmjeJ0tGlB0cJF06bylJ/vKn3mti+
wsuOs8xouXpAanoqnoxKpjL3avGgnacucn6Ef5nuW8b2vbrn8AGtia+n5xpQjksqdKCtGPUvbJ5v
a2OE3cg91qGgdmrWxPHbTpvlunLn5i+0OV8Y/fQyw2Dr6dnKrOWSzqVZvyY9b9iV29iQ4SS5B3V0
rT0bF0sHdXVp1mrTlxUfqR5Lynve4aa7tcfiBYHQ6nDx+Il4qhudrynyhHfzfmre9w2kx9aNY/TD
xEfE0Y+KoJ+YndyfGb9J+pbkhIly9A7o6Kp6LiquNvdq8KCdpS4Ob9CP8z3JbRtqY65/AMMZj62m
pxjbZ5NOnBeTHlGK/wBXvbHCW9wlVh6PR7Oqo1cTup7YU39t+lL7KyW97ictez8RFpYjpBW9KpVl
7PYkuxJF4Y85US/ymj0eyoNVcRvq7YQ/3ae1/beXBbyct77eORE4LAVtNVHq5vzpzk8orfKUns9r
5svDMncJSrpOnoiLpYNtyatOu1aT4qC9GPPznyWQ1tru1x+Ij9F6HnpK8rqFKPn1JebH4vglmxaz
jjsP8ZpaGHg8PhE403lOb8+p18I8IrtuyaW5a8QNtGaHeMi6tSSp0Ivyqj4/VivSlyXbYtqTHYLp
DTCnD5Pho+Lob16U2t83v5LYvWJFuXpBmjdDKvDx9eXi8On53pSf1YLe+exbxaTH1o1pLTDxcVRp
R8XQi/Jgt7+tJ+lLm9mxE0ZZbBtH6Hi4fKMU3TobvrVGt0F7ZPJAmPrQDSmmJaQtTilTow8ynHYu
b4y4t5lk0XLYd4DQ8KdNYnFtwo+jFefUfCK3LjJ5LrJasx9aGmlNLz0naNlClDKFOPmxXvb3t5sa
0mWWw+wGiIUaaxOLbjSfmQXn1Hwjwjxl3ZjazH1oZaU0tPSjSaUKcMoU4+bFcufFvNiRLdh/o/RE
KNNYnFtxo+hBefUfBcI8Zd2Y21MfWhhpTS09KSV0o04q0KccoxXLnxe1lk0zllsRiQYCiKMAMKDY
BhQbsQCrWIDADADADADADdgoVYA2EGAGAGAGwowA3YA2QGwgwKNACbFBoA0QGmigSAaaIBNig0EG
WChLQAkA01cAQECGrFAloAQwBDQAhoIBtACGVAhgA2gATRQDaCATQAJoAGwATRQDkggE0ACaABtF
AJgAWggQwBDAEMoENEAkqAYBgBoqDVgBJFGAGggwoMAMIDYUKCD/1foqel8l+VTADQQaIDABJVGA
GggwAwAwgMAMANNACbFBoAwAwAwAwgNAGggwAwAwA0yqNAGggwgNAGAGAGAGAGBAllBoKMIDQBgB
gBgBoqDADADADTQAkKMIDADRUCZACQDADADADADADADADVgDLAGgowAwAwAwAwAwAwAwINWKDADA
DRAYAYAYAYAYAYAYAYAYAYAYAZYA1YA0FGFBgQaAMCDADADADADADADADADADRAYFGAGAGBBqwAm
xQYAYAYAYAYAYAYAYAYAYAaAMCDQBqwUaAMAMAMAMANAGAGBBgBooNBRoAwAwAwAwAwAwAwAwAwA
wAwAwAwAwAwAwAwA1YqjQBgBogMAMAMAMAMAMAMAMAMANlBgBgBgBgBgBgBgBgBgBgBgBgBgBgBg
ApEAooMAMAMANhoKIgwA2VBiCjYUKIyMAFBoYUCiINkUbKDaCBRFGAG0UCyAwAUgBQBtBQsiDaKo
WiA2VBsKFEQbChSCDYBsKMANlBgAoiDADADYUYAYAYAbQAoIMAMAMAMAMANNhQkAwAwAwAwA0EGA
GAGAGACWFCQgwAwAwA0wgQFGAGgg0wBIUaCDABDCjQQYAYAaZUCAo2ggWRRtACwDaAFlApEARBQt
ABQoWgAkQBcSKCxACxCgqACoKCoAKiAJEKCxACxACxCgqACIgDIKCoAIgoLEALEKCoAIiAKgoKgo
IgAqACoKCoKCoALEigkQAsQoLEAKgoKgAiIAiCgkQAkQBcQoIgBYAtACgowAWgg2FGAGAGAGAGAG
ACWggSFGAGAGACQyNMKEgCGADkECGADZUCAAbQAFhANoIBMAEwgGwAbKgGwBDCAbABsAGwgG0ADY
AgAQ0ADaCAbRUCGADYAhhAhhAhlAhogEMoEBAhoASwBAANoAQwBDCBBQDeRAIaKAbQAhoIBsAQAD
aABtAA2EAmUA2ADYAloIENAA2UWENAUhoIENXABgGAGBAloA0FGgg0AbQBsKFkBhQKSChSCAiCgk
SAIigJEgCRACRACoKDIALEKCxIAqCsjIAKgAsSKCoAMgoKgAsSALEKCxACoKCoAKiANTi5uyzbCj
ptOMejWFu7eMfrk93Uv1tMcvT7EHPZTdRuTd23ds284m9B6N+caiv5kc5fDtJa3hjsTXSTSOs/EQ
2Lzrepdn62GZG88vQVZGnIXXQWBWFg69TLLK+5ce32dZmu2E15EDj8a8dUcns2JcEWOeV2G8IOo0
lm3sKkF0io6Eo3ec3638EY5d/Zgqc6jqtylm3tNuAcYTDPFSUV/oiLJsWXG4iOjoKnDzmu7n1mZ5
dsr2ism3ASGBwjxcreitrJW8ZsSmksWqK8VDLjyXAkbyuvAgEVyElgMH8pld+atvwFrWOOw80ljP
7OGzf8CSN5ZCEK5iS0fg/lLu/NXr5Etaxx2HGksbf6OGzf8AASNZZCFK5B/gMF8qd35q28+Qtaxx
2Hek8bqrxcNm/wCBJG8svQQBpxDzA4J4yXCK2slreOOxJ6Txywy8VTyds7blw6ySN5Za8CryNOIc
YPByxstVbN74Eak2LBjsZHRcFSp+dbu5vmZnl1yvaKbJ62b2m3Abw+Gli5KEFdsEmxcKk6fR+lZZ
zfrfHqRnl39iCiYitLESc5O7e01Hnt2ARg6jUYq7eSRQXvA4On0fpOrV89r9RX69Rjl3k7RR9J6Q
npKevLZuW5I3HDLLYjGVkXfQGg1h18pr5WV4p7ub93eYtd8MNeaIHpBp16UlqRypLYuPN+5Fk055
57FYZpzFk6O9HnpWWvPKkn/E+C97/Szbp0ww7hL9JOkCpp4XDZWVpNbEuC973bCSN55+kFCjhlHz
s+X6/S6jbhoSejtHT0rUVOn1t7kuOXqtv2PcS3TeM2L7j8dR6J0FSpWdVrJb2/rNL2ZLdkYk27W9
kHJ8TiJYmTnN3k9rb9r90dx1ea3YbwpyrSUYpuTyikrvsW7rfWEHWtC6HpdFqLxFe3jGs3wv6Kb3
8Xs6kc7dvVjj2eaOc6a0xPTdR1JW1Y5Rv5kepbZS45fhtY3Jp58su4Qjlby72v8A2kvOf3I+/d9a
OwrIvnRHox8o/aa0dWltSl50+cnujyXnb21txa7dPDfkN+mXSj5XehCThR3286pyS3Q5vbtSayLj
E6me/A59UXio2n9FB/2a8+XDW+MrLfGLNuAntBdG62n5+L/c0VZyS85rdfi3u1st8Y2uZt06YYdw
6PpnS2G6FYdYeg1Gdsl50s/Sa3t7r2XcovEm3fLKYTUHF61WeKTnJ+KpTd3JvWnUzz4Ofqgntszo
8nIzA4apj34vCx1ISeq5vzpX3XWf4YLZtva4pJvgdp0H0cw3QihKvU8qrbypuyt9lXdkuOfbaxzt
29eOEwmxybT3SKencRrQXjamyCs3CC+xFrynxlJZ/VVkzcmnmyz7qK9W8XhpOdeXj6z2x1rxT+1J
ed1RdvtbisXxz5HR+iXQurpeUcXpBWpR/d0mrJr7uSjDllfbs25uWnow6e/NCumPSmWmYuhhpKnh
IvVnWeSm16MLZyXKO3faObYzR1M9+JwOb4eu2/FYGDTad6jtrtb3fZTjxs9m2TRtwn3Cb6OdHVpG
sqVFKrUWc5tXpU1/zklwWUW/rLNS1rDDf78Dr+mNPYXoPRVJNzrSV7bZPdrSexLctyWSi0rHOTb1
ZZTAcQxOLxPSRynJqFHWvNttQT4yeblLgs5Wyiksjpw8dtyDaGMjgmoYNOVR5eNa8tv7Ec9Xrznz
jsBvXAx4Slox62JevV/uk9j/AOOSWznFeVxcWDWuRvxdbTS8ZVlGnQhkm1qwj9mEVtfKN29re1jg
9oaWPVD6HBRknLJ1LfSTvuVr6qf1Y5vY5Muk37hv5HR0TniPpKv9zF5L/eSX+GOfFxeQ5XWufwGK
nX099JOShRhlrPyacF9WKW/7MU5PbnmxwnnIZLScMAvF4NNN5Os/3kuUfqLqvJ75WyGl3rgKjoun
o1a+Mb1tqoxflv779BcvOfBbRs1rn8BpzxHSCSpwilThmoLyadNb228lzlJ3e9snB5yBfldHQuVC
1WtvqteTF/8AG4va/ty7IraOTfbwBUNGyxK+U4qbhTk29eWc5vfqJ5yfFu0Vve4bTW/NGsTpR14/
J8NB06TaWqs5ze7Xe2T4JWity3jRcvSBwsDR0LnivLrbqCeS/wB5JbPuLyuLiOV128/gG37T0kqW
26q2ZRhTj6oxiv1dl4TzkHfyyjoTLDWqVt9ZryY/7uL3/blnwS2k1trfbx+Ia4PRc9IJ1609Slfy
qs7u73qK2zlyXa0i7SY78g2K0xGnB0MLF06Tyk359T7zW77Ky43eZNFy9ICUNEQwUVVxjcYtXhSX
7yfP7EftPN7kxsmOuQ2xmkaul3GlCOrBO1OlBOyvy2uT3t3bHBbsSKwlHQGddKriN1JO8IP/AI41
tf2F2vcOV1288+4R/wC09I62+pUa6lFLuUYrsSLwz5yEn8po6AyotVcRvq2vCD/42n5z+28uC3k5
a8Y/ERmC0fW01OUr5LOpUm/JjzlJ/wCr3JjhJO4SNXSlPRcXSwV7tWnXatOXFRXoR/me97icrctc
fiGmjdDyxydWclToRflVJbOqK2ylyXbZF2zMdhxjdMRhB4fCxdOi/Ob8+pzm1u4RWS5vMaauXpAn
AaGU4ePxEvFUNz9KbW6C39fmre9w2TH1oTpHTLxUVRpR8VQTuoLe/rTfpS68luSGkuW/gHOC0PDD
wWIxbcKbzhBefU6lujxk8uF2TazH1oa6T0vPSNoJKFKHmU4+bH4vjJ5ssiZZbEhh9E09HQVbG3Sa
vCispz5v6see17lvG2pjrzfwEZpLStTSklrWUY5QhFWjFcEva9r3iTTNy2JejouloeKq4xXm1eFC
9m+c/qx5ec+SJvbUx7efwERpDSVXSs9ao9mUYpWjFblFbkGbdiapaOpaDiquLWtVavCh7HU4L7O1
77Icta7efwEJj9IVdK1Neo7vYktiW5RW5cEi8M27E9SwFLQKVTFpTrNXhQ4cHU4L7O177InLeu3n
8BBY7HVdKVPGVXrSeS4JbkluXBIrFuxYKWApaAiqmKSnWavChw4OpwX2dr32RnlvXbz+Agcdj6uk
6jqVXrSfcluSW5cEjUjFuxP0cBS0DFVcWtaq1enQ9kqnBcI7XvyuTl0128/gIDH6QqaTqOpVd5Pu
S3JLcuReHO3YapBkbIowoNlBgBtIgFWIDADADADADADdgoVYA2EGAGAGAGwowKFWIgwA2EGFUbsA
YFGWIg0AJsUGgDRAJaKDQBoAS0AaANBAloKNACWgBAQIKBDQAhoAQ0EA2igQ0ADaCBDQAJoAGyoB
SABtAAmgATRQCYANhAKQAKQANlAGSCAbAEMAQwBJQDYAiQQaAMANFQaANNWIo0AaCDCg2RQpIINl
B//W+ip6XyX5VMAMANBBogMANWCjRQaCDADADCAwAwA0AasECSqMAMAMAMIDQBoIMAMAMAElUYAa
CDRAYAYAYAYAYAaCDTKDQUYQGgDADADAg0UGAGAGAGmgBJFGAGACWEGgo1YIMANFBgBgBgBgBgBg
BgBlgDVgDVgowAwAwAwAwAwAwAwqDQBgQYAYRRoAwAwAwAwAwAwAwAwAwAwAywBqwBoKMKDQQYAY
EGAGAGAGAGAGAGAGAGAGiKMAMAMANWCDVgDRQYAYAYAYAYAYAYAYAYAaAMCDVgBNgowAwAwAwAwA
wAwA0AZYA1YoNWAMANAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGrFBpkUaAMAMAMAMKDYBgBgBg
BgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgAQAwAwAwAwKNhQoiDAg2UGwoxACiIMAFBoYUCiINgGwo
xBAsijADZQLIDABSAFAG0ALIDZQKRFGwgUVQoiDaChSANhBgBsKMANlBtEBsIMAMANhRgBgBgBtM
AUEGAGAGACWwo0AYAYAYAYAaCDADADADADTYUJANBBgBgBgAlgCQDADQQJYUaANBBgAhhRoIMAMA
EsqBIUYEBCKMACAGABABSAFoKCABEFBEALiALRFBYgBYhQWIAVBQVABUQBUFBUAEiAFiFBUAFRFB
UAFQAVBQWIASIAWIUFiQBIhQWIUFQAVBQRABUFBUQBUFBUAFiAEiFBYhQVABURQRAC4gBIgBEFBE
ALAFoAUFGAC0EGwowAwAwAwAwAwA0EGmgBIUYAYAaCDQQJYUIkAIeYQDAEMAGyoByQAKSCATABsI
BNAA2ggHIqAciAQwgGygGwATABsIBsAQwBDQAhhANlANhAhoAQwgG8igS0RAhgCGUCGgBDVwgQAI
aAENACGAIYANoIENACGUA2ADYAhhANgCJIAFIAHIAGyoBsAG0AIAEFQIaAENAaIYQDYAhoASAYAY
ECbAGgo0EGwoUkEGwo2AKSIBSKAiCgiIAiKBaIAkQAkQAyCgqACxCg0SBRUFZGQAWIAWJFBUAGQU
EQAWJAFiFBYgBUFBUAFRAXXolovx03XkvJjlHm+PZ7eoza79PH1DLT+k/nGq9V+RHKPPi+32FkZz
y3REUqbqtRirtuyRWB0Wbj0cw1l+8frk/cv1tMcvR7EFCcnN3ebe004Cb0Lo75fUz8yOcvh2ktbw
x2JbpBpDWfiYbF53w7P1sJI3nl6Cto04i3aEwKox8fPLLK+5cTNdsJryIjSGNeOnf0VklyKxcthp
Ba2SKyLhh6UdEUnKXnPb17kY5d59mCs1arrycpbWacbdhdGk68lGO1gk2LPWqR0XTUY+c/bxM8u1
+zBWG9Z3e004hzhcO8TLVXa+Aak2J3GYhYCCpw2+zn1mZ5dMr2iumnEOsLhnipWWzew1JsTGNxKw
kfFwydu78zMdMroV405BzhcK8VKy2b2Fk2JfG4lYOPi4bbd35kjpldeBXJFcQbC4Z4qWqu18Asmx
OYzEx0dBU4ed7Ob5meXW3tFVm7m3ALoYeWKkox2siybFlrVYaGp6sc5P1vizPLtb2in1Kjqtyk7t
7TbhQinSlXkoxV29gNbFvp06egaWtLOb9b4LkY5d/ZFKxeJljJOc3dv1cjccLdhpbWyRUF20Zo6G
h4OvWylbu5Ln/oYvl3xx7fNFS0rpOWk56zyivNXD8zUmnHLLYh5FYFw6P6CTtXrZRWcU/a+XDvM2
u2GHrRHdIdPPSD8XTdqa/mfHq4d/VZGc89ipyNOQndA6BlpaetLKlHa+PJe/gS3Tphh3C0ae0vHB
x+T0PJsrNrcuC5893XszI655a8Qc/bUMll+v1z5NG3nBsBgKmk5qnTWe97kuL4et8Eib0smx0DFY
qj0So+LprWqyV7b2/rS4L/TiY5ei2YDlWKxMsXKVSbu5PNvZ8X1LJdR0eW3YFGi5tLO7yirXk77N
WO79WKaHVdC6Ip9HKTr1klUaz3tcr73xeS6ldvnbt6cce3yOe6b0vPTlRyflRj5sb2hBcZPK755K
+xtZG5NOGWXcIP8AeeUrStlryVoR5Jb+Stn9UrAvPRPoysa/lNdOUdsXP0rb0t0Vubze7V34yrt0
8N+aEdKelk8dejhWoUVlOq9jfCP5Xb2qyV2kM+pvj8RzynvlSyz8qtPjy22fVrT3prYbcP3sSnR/
Q89M1tTDp2Wc68l5v3VsT4bZb7xzJbprDHu4/EdK0vpSn0Uo/JcGlKta7batG+2dSTyu91/ZZPEm
3oyy7PEHGJVPG1G43xFeTu5NNxvxSecuuVor6rWZ0eT+I0qXjaiUr4jESaSineKfBted1RtFfWay
B/Edl0bgKXQzDvF42SlWtbK1o32U6ayS52st+w527euTsm6OU6f0rX6Qz8di5+Ko7adNZu32Y5Xf
GcrLbZ+ibk082WVy5EPBzxUJRopUaGyc5Pb96Vryf2IrPao3zKzyOmdBeiNOdsTKL1FnGU1aUucY
+jHg85PanFZPGVejp4eoH026e0Zp4bD/AEi2Ss7QfJtZyXJWTyu2rxdxxTqdX0g5lXoSqWq42bir
eTTSWu1uUY7IR4N2W9RkbcPiJPQujMR0rn8nw0fFYdNObV7LnOW2cuC7lFXtLdNYy5+IOsaU0ph+
gOHjhMJHXxEvNjtbb9OVtvJb9iskc/aejLKdOanI41ioxozlVxknVryd3TT3/bktn3Y57m4HR5b9
4Q6dbS8VUqyjSw8ck7WguKhFedLja73ye8cHI1DG6r8TgYSTllr2vVnyVvNX2Y57nKQN+7+ka+TU
dE51rVav93F+RF/bktr+zF9clsLya0N+JraZ+mrSVOjHJSatFfZhFbX9mK5u20cJ7Qz5xVH6LBRl
HWyc9tWd9yt5qf1Y5vY5SC79w38gpaJzxPl1d1GL2f7yS2fdj5XFxG9mtc/gMUcR0gd3aNKnv82l
TXsXUryk+LHB5y/fgLekKWivJwmc99eSs/8AkGvRX2n5f3dhOTu1x+I1T0UqCVbGScIyzUFnUnfe
k/NT+tLsUhs7feE1MZV0u1h8PDVp38mlDO74ye2T5vZushwm9+IDamH0J52rXr/V20oPm/TfJeRz
lsHK+Mfv/IAp4fEaflKtUlaMfPqzdoxW5fCMVfghwmrkDT0pT0anDBppvKVaWU3936i6vKe97i6X
euPxCMNodUoqti5OnTecY/2k/up7F9qWXC7yGyY+8IxelJ49KhRhqUr+TSjduT3OT2zl17NyQ0W7
8B38ho6EzxNqlbdQTyj/ALyS/wAEc+LiOV128/gGkpYnpJVSS1pJZRVlGEVwWSjFdi3scJ5yD/x9
DQOVLVrYj+8avTg/sJ+c/tPLgntJyvjEMcJo+tpuUqkpeSs6lWb8ldb3vgldvchwkmw+q6Vp6Ni6
WCum1aVZ5TlxUfqR6vKe97ho7tcfiG2A0M8RDx1aXiqCfntXcnwhHbJ+pb2htJjsExumE4Ohho+K
ob1e8585y38oryVw3jS3L0gJhdDxw8FXxbcKbzhBfvKnUnsj9p5cExtZjrzQ30hpeePSpxSp0Yvy
aUdi5vfKXGTz6tgkZyy2JCloqnomKqY2+s1eNBO0nzm/Qjy857kto21Mdc/gI3HaRq6YnFPYsoU4
q0YrhGK/1e+41pLdiWjgaOgPKxSVSv6NC+UedRr/AALPi0TlrXbz+AiMTiq+nKqcrznKyjFLZwjF
LYuCReGLbkJtUKPRzOoo1sT9TbCm/tfWl9lZLe3sJy3rt+Ihpzr6brZ61SrN9bfVwXqSLwx5yE5e
j0b+rWxXfTpP2Tmv4U+LROW/Z+IgoQr6ZrWWtUqzfW2/12JF4Y85CfVSj0a/duNXFb57YU39ndKX
PYt1ycuns/EQNGjW0vV1YqVSrN9bb4t+1sOftCwOvR6N5UnGrit9TbCnyh9aX2ti3Dl032/EV+hQ
raVq6sVKpUm+tt8W/a2Vzk2LE69Lo15NJxq4rfU2wp8ocZfa2LcTl132/EV6jRq6TqasVKpUm+tt
/rayuXIsjq0ujOVNxq4vfPbClyjulLnsW4zy6ez8RW6dOppGpZa06k31ttmmORZ9al0X2atXF8ds
KT5bpT57E+JOXT2fiKpVqyxEnObcpN3bebbK5WhKQQbIowoNlBuxAKsQGAGAGAGAG7FUbsAbsAbI
gwAwAwKN2AMChViINgGFQYFG7AGBRsA3YiDGgBJVGrEQasAJKDVgDTRAJKDQBqwAkA0AaaAEgCGg
BDVyoEACGgBDQQDaAEMoBsIEMAE0ADaKATQQCYAOQAJoAE0UAmggG0ACYAKRQCkQAmVAlgCGADZQ
JkQCGVAgAwAwA0EGFBqxFCQDQQKSChRUGEUf/9f6KnpfJflUwAwAwA0EGiAwA1YKNFBoAwIMAMID
ADADQBoINMqjQBgBgBogMCDQBgBgBjKBIUaCDCA0AYAYAYAYAYAaKgSFGAGiAwAwAwA0EGFBgBgB
gBpoASRRgBpgCQDADADQQYAaKDADADADADADADADADADLAGrAGgowAwAwAwAwAwAwqDQBgBgQYAY
RRoAwAwAwAwAwAwAwAwAwAywBqwBqwBhQasAYEGAGAGAGAGAGAGAGAGAGAGiKMAMAMCDVgBNigwA
wAwAwAwAwAwAwAwA0AYECWgo0AYAYAYAYAYAYAYAYAYAaCjVgDCg0AYAZYAywBlgDLAGAGggwAwA
wAwAwAwAwAwA0wo1YAyxQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAKiAKAMAMAMA
MChSIDYBsqDADYUbQBsiDABQaGFAoiDaANkUYaAsyDADYAtFBhAbQAsA2ALRAbKBSCjZECiqFEQb
QUbRQKIgwA2FGAGAGygURBgBgBgUbAMAMAMANp2AFBBpuwBoKNAGAGAGAGAGggwAwAwAwA02FCQD
QQYAYAYAYAIYBoAwA0VAkijTANBBpgCADADADCoBsAwKMAFoINkULQBsAWgBSACIKCABEFC0AEiA
LRFBUAFiFBIgBYgBYhQVABURQVABYgBYhQWIASJFBUAFQAVBQWIAWIAWIUEiQBYhQWIUEiAFiAFQ
UEQUFQAVEAVBQVABYhQWIUFiAERAEQUEQARAC0FBEAEAFoAUFGAC0EGwowAwAwAwAwAwAwA0ECWg
DQUYAYAaCBLAEgAwBDCAbABtFQIYAJgApBANhAKSABNBANgCCoBsAQwgFIAG0ADaCAbQAhgCAAbQ
QIYANoqBDABtBAhoAQwgQ0UCGiASUAwgQ0AJaAEAA2gBDAEMIEFAN5EAhlAOQANhAhgA2gAbQANg
A2EA2UAwAbQAlhAhgA2UahDAEMIEAGmgBABgBgQJsAaCjaAFAGACkgBRAKRVC0AFQAtABEQBEAEQ
UFQAaIAWIUFRBKKgqDRACxACxIoKgAyCgkQA0SAIgoKgAqCgyAHuCwssbUjTjtk7fmRZNjoenMTH
QuHjh6eTkrdm99b+JieXozvbNDnqNvOLx0W0cs8RPYr6t/W/d3mbXfp4+ohtMaR+carkvNWUerj2
lk0xlluhlRputJRirt5IMwX6tOOgMOox89+t731L4GeXov2YKQ25O72mnnEvonAfLp5+as38CWt4
47EtpzH/ANjDYvO+BJG88vQV005Cz6FwKivHT2LZ8TNrrhj6iP0hjvls8vNWz4ljGWWwyRWRa8HQ
WjqbqT85r9IxfLvJ2iBxFd4mTkzTjbsChBzaSzbBBZ4Rjound5yfrfwM8u3swV2pUdVuT2s0427C
qVN1morawsmxYZyjoynZZyfrZnl29kV2UnNtvazTiFUaTryUY7WCTYsFScdGU7LOT/VzPLrfswVu
UnN3e1m3Ebp0nXkox2siybFhnKOiadlnJ+t/Azy6+zBV6s3VbbzbNuITCm6zUYq7YILPFQ0NTu85
P1v4GOXb2RU8RXliJOUtrNONuwCMXN2WbZUFtweFhoem6lTzn+rIzy7ydoqeOxksdNyl2LgjUcbd
iPYZFw0RouOCj4+tk0rpPcuPX+tpm12xx15orumNKy0lLLKC2L3vn7DUmnPLLYg2VgWjQGg/lVq1
VeQtie/8vaZtdcMN+QLpDp35U3RpPyFtf1vy9okM89+BTpG3ETWhtBT0rPPyaa85+5czNum8cO4W
zTOl4aKh8noZSSzt6K+PP13MybdcsteIOeynf9ev88utm3nBMFgp6RmqdNXb7kt+fDqsuscLJsdB
q1aPRGhqx8qo+y74vhFfrO7McvR7EHMMViJ4+TqVHe7zbyj2b3bhu6jpHmt2BKFmrXTdrNq8nfZq
x3cvU9wQdN0HoinoCm8RXVqjX3pK+6++T5dXN87dvTjj2+aKHp3TM9NVLSu4rzaUXkucmsm+NtnF
G5NOOWXcIKX0j1fPazUI5QjzbW3m+3WZpzF16NdFfnJqviXrU4+bFZRfVxXG1k3vkrmLXbDDfmhX
SfpXHF3wuFWutkmsotLdltit+xc2rppFzz34g51P6SSUvpqmxQj5i5ZbeqNo77vYbecS+h9BT09W
UJPX1fOS/dwXBtZdUYbfrLMlum8ce4dH030hw/Q2isPSSdS2UVZW+1Lcu7PhYxJt3yzmHgcdx1Wp
inr4qWpFvWVNec299n/im722ayyOkeW+eQnD4erpBKFNeKpTdkldym/8U33QT+qDWx2fQmgcL0No
OvUsqlvKnJq6+ynsV+XVd2u+Vu3rxxmE2OU6d6ST07iL04upPZDK8Y/cg9r4ykrv6sbI6SaebLPu
ordeNPDSc68vHVntipXin9ua29UX+JbCufHI6J0T6IVNNOOKxytQjnTpW1U193Yo7/tbXltzbp3w
6fd5o30v6VT03rYbBtQw0cqtZvVi/sp8OSu5bk1tSaXPPu8Tgc2p4iGFkoYSLqVW7Ko43d/+Nwzt
ybvLetVm3n3rgT3R/opLS9fVqPxlS95pO8Y86k1v+xF6z3yjZkt06Y4bo7PpfSVDofhlTpuEHa0b
rJc9VZyfJb9rSdzlPL1ZXsg4LV0rV0hUlHDRm6lS+tUedWfG7Xmx+zGySybaR108W98f0hp4uhor
z7Vqv1U/o4vm1575R8n7Utg5TxASWHq6SSr4qfi6WyLa2pejTgrXXVaK3tFXnzRqONlW/Z8FCUVL
J2zqT+81sX2Y2jxva40b9IM8TQ0R+8tWrfUT+ji/tSXnP7McuMnsHKakG1Qr6a+mrzUKUcteWUVb
0YRW37sVzdlmOF1vzRt6SjhF4vBxcb5Oo/3kr7lbzE+Ec3scmDu1wFLRtPRflYttz3UIvyvxv0Fy
zlyjtJs1rn8AlzxHSCShBJU4ZqK8mnTXFt5LnKTu+LY4TzkCfKqGhsqFqtb+9a8iL+xF7X9qXZFb
Ryu5OAKjo6eNTxOKm4U5O7nLOU3v1Ftk+eUVvaCa35oyvpXyXQwsXTpyye+dT70l/hVo8m8y6Xfp
AdaMpaJWti7upuoRdpf8hH6K+z533do5O3XP4AE62I6QzjThG6jfVpwVoQW922JcZPPe2ODzkHPj
MPoPzNWvX+s1elB/ZT89835K3KW0cr4x+8NaGCr6dlKtUl5Kfl1qj8ldu98Iq74Ib0mu4Op6Vp6N
Tp4NNNq0q7ynLlH6kerynve4nJ3a4/EBwehtaCr4iXiqL2O15T5Qjv8AvO0Vx3DZMfWjWN0x4yHi
KEfFUN8U7ynznL0nyyityGkuXpA6paIp6NiqmNbV1eNFZTlzl9SPN+U9y3jbWtc/gGuN0lV0u404
xtBO1OlBeSr8Ftbe9u7fEa0zb3CQWCo6CzxNqtfdRT8mP+8a3/YWfFrYOWtdvP4COqVcR0hrJZzm
8oxSyS4JLJJdiW0cJ5yEp9B0f+rXxK7aVN/55L+FfaJy14x++iMpUMR0grPbUqSzlJvYuLbySXYk
XhjzkJb5XR0Blh2qtffWa8mH+7T2v7b7FvHLe+3jn3iKwWAraaqPVzfnTnJ5Jb5Sk9nvG9MydwlZ
6SpaFThg3rVGrSxDVnzVNeivtec+RNba328fiIvRuiqulpNxsoxznUk7RiuLfu2vgW3TMx2JWrpW
nouLpYK92rTrtWnLlH6kf5nve4mttd2uPxEfozRFTSd2mo045zqSyjFc3vfBLNl3pmY7EhidL08D
B0MEnGLVp1XlOfJfVjyWb3saauWvEDDReh56TvK6hSh59SWUY/F8Es2LdM447EhitLwwkHQwacYP
KdR+fU6/qx+yu25GrlrxAy0Zoeek7yTUKUPPqSyjFe98Es2NszHYf4vS8MJB4fBpxpvKdR+fU6/q
x4RXbcSNXLXiBhovRFTSbbVo045zqSyjFc3x4JZstqY47Eji9LU8HB4fBXjB5TqvKdT/AIMfsrbv
Jpq5a8QR2i9E1NKSahZRirznLKMVxb921i1iY7EritK09HwdDBXSatUrPKc+S+rHlte8aauWvE/E
ROjdF1NKz1Ka2Zyk8oxXGT3IvCY47E1iNJ0tEQdHBu8mrVK+xy5Q+rHntfUTW2rdcfiKtYrmFBBs
ijZQYUCkiA2QGAGAGFBuwUbsAKsAYRBgBgBsKMANhRuwQbAMCDAo2AYFGwDdiINgGAGAGrAGiqNW
IgS0AaKo1YIEtEAkqjAgS0AaCjQQJaAEWAEMAQ0VAhoAQwAbQQIYANooENBAJoAHJAApFQCaABtA
AWgAbKAUkACYQCYANooASAEMIEMAQygQyAQygQAaauECADADADQBhUGmgBJFCyoMANkUf//Q+i7R
6HyX5VEgGFBgBgBoiDQBgBlgoSUGggwAwAwgMAMANBBoASVRgBgBhAaANBBgBgBgBplUaANBBhAa
AMAMAMAMAMCDRQJCjADRAYAYAYAaCDCgwAwAwA00AJIo0ygSAYAYAYQGAGgDAgwA0UGAGAGAGAGA
GAGAGAGAGWANWAMsFGgDADADADADADCoNAGBBgBgBgUaIDADADADADADADADADADLAGrAGgDCg0A
YEGAGAGAGAGAGAGAGAGAGAGiKMAMANWCBJQYAYAYAYAYAYAYAYAYAaCDVgBIUYAYAYAYAYAYAYAY
AYAYAYFGrAGig0AYAYAYAYAYAYAYAYAYAYAYAYAYAYAaCDADADADADADADADADADLFBqwUZYA1YA
wAwAwAwAwAwAwAwAwAwAWgDYBgBgBgBsKNogNgGyoMANhobREGwgwAUVoYAKIg2gDZFGGgLRlBgU
YALRQbIDYAsA2AKRFCioNoKFEQbKoUiINgCkVQoiDADADYUYAYAbRQKIgwAwAwKNgGAGAGAG7gGg
DADADADADQBgQYAYAYAYAabChIBoIMAMAMAMANNhAgKMAMANBAgKNBBgAlhQkIMAMAEsqBIUYAYA
KiECiKFRAFACogC0ALQARBQRABEFC0AEIoIgAqACxCgsQAsQoIgAqIoMgAiACxCgsQAsSKCoAKgA
qCgqACIAKgoLEgCRCgsQAsQoJEALEKCRADIKCIgDIKCIANEKCIALEKCxIAiChaACIAIFBAAiAFoA
UFGAC0EGwo2iA0AYUGAGAGAGAGAGggQ8gowAwA0EGmAIAEMARIIEMAGyoBvIAGwATQQCYQDaABMI
BsAGyoENEANlQDaABtAA2EA2ADYAhgCGggGwBDKgGwBDQQIAENWKBDIgQAIZQIaAEMIEACGgBDQA
hgA2ECGgBEkAIZQDYANgA2ECGADYANgAmADZUA2AIYAgIEFAhgWBsCkMIEAGgDTQAgAwAwINAGAG
wo2lcAWQGygUgoWgAiACIAIiAIAEQUFQAWIUFiAGRBkVABYhQWIAZEUFQAVBQWIAWJFBEAGQAVAB
UFHReieAWEpyxVTK6dr7ora/1w5nO16OnNeRU9JY96SqyqPfsXBbl+t5uOWV2F6NwUtIVI01v2vg
t7JSTdFz6RY2OBpRw1PK6z5R/P8AW0zHbO68Cjo24C79G8AqMXiKmWT1b7lvZiu+GPqIPSePekKj
l6OyK5GpNOeWWw2pU3WkoxzbdkGYLxVnHQdBRj579b3vs+Bjl6PZgprbk7vabcBKaMwLxs7eitvw
JWsZsS+mcaoLxMNm+3sJI3nl6CuxNOQsGh8Drvxsti2fEza64Y+oBpPG/KpWXmrZz5lkZyy2GBWB
Y9HYVYWPjZ5O3cjNdsZryInFYp4qV3s3IsYyuw3SuVgWPC0Vo+DnPb+sjHLvJ2iDxFd4iTkzTnbs
CinLJbQgsVGlHRsNaXnP9WM8u0naICvWdeTk9ppxt2BRi5Oy2lQWOjTjoyGtLzn+rIxy7SdoruIr
vEycpGnG3Yb21nZFQWfC4eOjIOpPzv1kjHLvJ2itYzFSxctaXYuBpxt2GbKgtOjcBHAR8bVydu5f
H/QzXbGa80V7SOPljpX2RWxfreWRzyy2IplZFo0LopRXjquSWcU/a/d3mbXXDH1oitNaWePerHKm
vXz+BZGM8tivs05ie0HoX5e9ef7tfzP4ce4za6YY7DnpDpvW+govyVlJr2Llx7tgkazy9IKfGk59
XE04iY0Voh4+dlsXnS4fn611Etbxx2LTpbSkNDQVCjlO3dffzb/MzJt1yy7fEHOZz1m2+t/nz72d
HnCsNhZ46apwV3L9Xt72Qk2OjRhS6K0G15VSW1t5yfN7or9Zsxy9HsQc2xmKlj5OrUes29ryguSW
12/1TR0ee3Ya7bPNX2SavJ/cju5buDQQdG0JoenoSm8TiMp2veWbV/8AM+C6s2Yt29GOPb5opun9
OVNKztNuFPZGlHzn97g3wd7ZeS9pqTTjnlsV6p5C1ZeSn/Zw85/eefru0/RRWBcOjvRaekbVK6UK
Cd1TXpNfW39+e1ZGbXXDDfIc9L+kcYp4anLVgspKPnP7K3Rjxbze6LjtYxepn6DndVOMbVPoqbz8
XHzpcL7+2XXFbjbgJPQ+g6+nX4ukvE0X5z2tri9jl6o3WVmS3TWONyHSNIYqj0Nwyo4fVUvrS2J7
5StnJ8IpN8lFGJ5ei3sngcc+UTxU5SopyqPOdadrrnn5MFzu3wa2HR5N74/ENqUIqahSXyivJ5Np
uN+UXnJ85WX2XtCfxHYNFaLpdD6MsbjZ61dqze23CEOe7LLqijnbt65OzzRzLpBpOrp6p47FydKl
/Z0lnK3KOW3fOVk917WNyaefO93IhoOpi4yjRiqNDZOTe3789sn9mKz3RuVjngdI6EdEKdS2IlFu
CzjKas5c4x9GPCTvJ7Vq78ZV6On0/Ub6b9NaLTw1KWutklF2T5SkvR4qOb2OUbWbHE6nU9By+rSq
Y6MamIkqVFeYrWy/43BWvzeSvtlc6PPzyJTQWAq6fqfJ8FHxVP8AtKjzlq/allt3QjZPfezZm+Gs
Z3eIOoaY0xhvB3hlhsMlKs1dJ7b/AF5+5b9iskYk7noyynTmoOO4mjUx0vlOPqOOvmr51JL7McrR
4N2jwvsOjy3z5oHDEVdI3w+EhqU2vKSebS31Ju2XXqwXBA3vxAnWw+ifNtXrcWvoo9Sfnvm7R5SW
ZU8T7wp4Opjf2jGVHCEtjlnOS4QjlluTygtl9wXW/NGljZ4r9nwdNwjLJqOc5/elvX2VaK4bwb34
gUsPQ0R+9tWrfUT+ji/tSXnPlHL7T2Dk8Yjao19O/S1ZKNKOWvLyYRX1YpLujFX5bycHnIblpSGj
lqYNNS2OtLz391bILqvL7W4aO7XH4jIaKjgl4zGNxvmqS/eS5u/mLnLN7osbO3XIRPFV9NNYehDV
he8aUNnXJ7W+MpPLkhwm+7xAbVw+hdurXr8NtKD5v031eRzkXlfGP3/kBU8NiNPylWqStBZSqzdo
RW5fCMVfghwauQNLSlPRa1cGnrbHXkvLf3F6C55yfFbBra71x+IFhtD+Sq+Kk6VJ5rfOf3I/5naP
NvIbSY+tGsVpV14+Iw8fFUW15Ec5Te7Xltk+CyityQLl6QOo6MpaIWtjLue6hF2l/wAhH6C5ec/s
7Sb2a1z+AaVsViNPzjTjG9soUoK0Y9S9ree9scJu5B7qYfQXnatfEfV20oPm/TfJeSuMtg5a8Y/f
f4BlTpYnpHVcm3OVrylJ2jGK4vZGK7FuQ4Z1cg/+W0NB5Ya1WvvrNeTH/dxf+OWfBLaOWtzHj8Qy
wWja2mHKpKVoJ3qVZvyVfi9rb3JXb4F4ZmOw9qaWp6Ni6eCTTatKu8py4qP1I9XlPe9xNNd2uPxD
XR+hpYyLrVJKlQTzqS3vhFbZS5LtaFqTHYPi9MxpQdDCRdOk8pSf7yp95rYvsrLjcaW5e4awGhde
Hj8RLxVDdJq8p8oR39fmrextJj63gbx2mfGw8RQj4qh9VO8p85y3vl5q3IaLl6QEwehowgq+Lk6d
F+al59T7i4faeS5jazH1oBpHTMsXFUacVSoJ5U473xk9spc32JCRLlsOsHoWNCCr4xuFN5wgv3lT
qT2R+08uFyWrMfWhvpLTEselTilTox82nHYub3ylxk8+osiXLYeYXQ8MLBV8Y3CDzhTX7yp1L0Y/
afYmNrMdeaGWk9MT0jaCSp0Y+ZTj5q583xk82JEyy2H2E0PDCwVfGNwg84U159Tq+rH7T7ExtqY6
80NNJ6XnpG0LKFKPmU4+bH4vjJ5sjOWWw9weh4UILEYxuFJ5wgvPqdS3R4yeXC4amPrQ00npiekb
QSVOjHzKcfNXPm+MnmyyM3LYd4DQsYQWIxbdOj6KXn1OUFw4yeS5k21MfWhvpPTEtIJU4JU6EfMp
x2Lm36UuLfqLpMsthxo7QqqQ+UYiXisOt/pTfCC3vnsRLSY+t4CNJ6ZeMiqNKPisPF+TBb39aT9K
XN7NwkLlvx6Dei9CvGRdarLxWHj51R739WK9KXJbN5bVxx2F6S0yq0PEYePi8On5vpTf1pve+Wxb
iSFy9JwIFIrAUEGwo2AYUCkrEBsgMANlBgUbsAbsAbIgwAwA2FGAGwo3YIN2AMCDAo2AYFGAG7BB
sgNgGwowAwoMIDTQQJKDRFGmggSUGgDTRAJKDQBpoASFGmECGgBDRQIIgQygQ0ADaCBDQANlANoI
ENAAmgATRQCkACkEAmgATKAbABMIBSABMoAyQQDYAhgCGAIYAhlAhgGgg00AJaANAGAGgDCoNAGw
DZFGAH//0foweh8l+VTTQAkAwoMANAGEQaAMAMYUJKDQQYAYAYQGAGACQg0yqNAGAGAGEBoINAGA
GAGACSqMANBBogMAMAMAMAMAMCDTKBIUYQGgDADADADQQYUGAGAGAGmgBLIoQaBgBgBhAYAYQGAG
AGgDLBBgBooMAMAMAMAMAMAMAMAMAMANWAMsAaCjADADADADADCoNWAMAMCDADADCKNAGAGAGAGA
GAGAGAGAGWANWANAGFBoAwIMAMAMAMAMAMAMAMAMAMANEUYEGrACSgwAwAwAwAwAwAwAwA0AYECW
go0AYAYAYAYAYAYAYAYAYAYAYFGrAGrFBoAwAwAwAwAwAwAwAwAwAwAwAwAywBlgDLAGAGAGAGAG
AGAGAGAGWAMsAaCDADLFBqwUasAYAYAYAYAYAbQAsAwAwAwAwA2FCkQGAGyoMANhobREGwg2FGyq
MAFEQbQBsijDQFoiDCKMAFxKDZAbAFoAwAWiKFFQbQUKIg2iqFIgNhBsKFhBgBgBgBsKMAMAFIoN
kQYAYAYFGwDADADADADADADADQQYAYAYAYAYAabAEhRgBoIMAMAMAMAEMA0AYAaCDTAEhRoIMAEM
KNBBgBgQDZQYFGAGACohAoijcQBYBuIAsAIgAiCgkQBaCggAsigqACoAKgoJEALEKCxACoigqACo
AKgoKgAsSAJEKCoAKgoKgAqACoKCIigsQAsQAkQoLEALEKCRACxCgqIAqCgqACoKCoAKgoJEgCIK
CIAIAEACIKFoAIgBQUYALQQbCjEQGwo0VBgBgBgBgBgBgAloIEhRgBgBoIEMARIAQECGADYAiRUA
5AAZBANoAFJBAOSABNBAhhANgA2UCGEA2gAbABtBANoAQwBDABtBANooENBAhgA2ggS0ADYQIZQJ
ZAIKBDAENBAhgCGADaAENACGECCgGyAGygGwBDABtBANoAG0ADYANlQDaAEAA2gBDCBDAEMo0GwB
DQQJAMANNEAmxQaAMCDAowAWlYgNlAoKFJEAtABEAEQARAC0FBEAFQAaIUFiBKKiCDRCgsQAsQoK
iAKgAqCgsQAsSAKgoKgAqCiV0TgHpKtGmtj2vglt/XElaxmxdulePWFhHC08sle26K2L9cOZiR26
l14FCibcB0jQWFjofDyxFTJyV+zcu34GL5enGds2KTicTLGTlUltk/0jbz27D3ROAekaihu2yfIl
axmxZ+kWPVGKw8MslrW3LcjMdc76Coo04i6aBwSw8XXqZZZclvf63dZmu2E15EFpDGvHVHLdsS4I
sc7dgFKm6rUYq7ewqQXOpKOhaNlnN+t8epGOXf2YKjrObu82zbgH+j8G8ZO25bXyI1jNib0rjFRX
iYZZZ8lwJHTO68CvGnETOi8F4968vNXrZm10wx2N6Txvj3qR81etiQyy2ItFYE7ozB2+kns3fElr
phj6hnjsX8qll5q2fESJllsMCsif0fhVQXjJ5ZZckZrrjNeRGYzFPFSvuWxGnO3YZhkWDAYVYWPj
J5O3cviSuuM15EPjcW8VK+5bEVi3YZFYFh0fglhl42plllyXxM2u2OOvIhtIY14yX2VsRZHPLLYj
pFZFh0Vo5QXjamSWaT9r9xm12xx9RGaU0k8bKy8xbOfMsjGWWxDMrAntDaJ+UPxlReQti4/kZtdM
cdgWnNL/ACn6Om/IW18fyLIZ5bFYZpyEvofRD0jK8sqa2vjyRm3TeOOxMab0r4lfJ6GVspNbEuC5
8RI3nl6QU5UlDbm/1+uZpxD7AYGekp6kdm98F+tnHemRqTYtekMfT0DSVGl59suX2n+rdisZk262
9o51VqOo3KTu3tbe3t2vsyNvPRqjQliZqEE3J7Fv7ti6+0Emx0ahh6XRei5uzqPa+L4Xexc/yRjl
6JOyDnuOxs9IzdSb1ubyhHkltft5M3PDhbsMXn5XdOS9UY/62+yVkdA0FoWnouDxWIyla957UuL4
N8M2tl29mLdvRjjrzRV9O6fqaUe3xVFeb9eXNL/RbVdmpNOWWexW7eKjdfRRe95zkuWzLq1Y7m2V
zFo6L9H3pF+McXCgt/pT5X3R42tfZntWbdOuGGxI9J+kLcfEYaSp015MqmxZejC2btv1fUsxI1nn
6Qc6o5XdBWS21Z5W6t0XwSvLg9xt559we6G0Y9KVvF0Fry2zqzXkx5qL2vhrXb4LaS1rHHfA6RpX
StLohSVCgnUxE9iecm36Ut75LfsVkssSbd8suzxORyDHVXVm6mLm6lV+gns62sor7Mbvd5LOkea/
eM+TVMbqxqfRwbWpSivKd9mrDa7/AFpvNb3sCa2OxaE0Vh+iNB162rTlbNt3a5a29/dSXBb3zt29
eOMwmxzDTvSepp+v9BFyksoXV9VcYx2J8Zu73rUtY3Jp58s+7gVmrGlhG5VpeOqvNxUrxT+1NZy6
ou329xXPgX/or0Sq6dccTjVahHOnTtqpr7uxR/xbdmbxbp2ww7vNC+lvSqpplywmByoxVqlRPVjb
ZbW2KO77WxZbUmlzz7vEHNFWo6OypJVqv15LyE/sxfndclb7G828/AseheiNbpDX/aZSUsnJbZpf
avlDkn5XCNs1Llp0xwuV8jrGkMXR6HYfxGDhFTtdtu0Y39OpJ7+CzlK1krI58vTb2TUHC8VpWFKp
KpButXk7utNZX+xB+pyz4Ri0ddPHcv6wKpgPEvxuOnJSln4u96svvXvqLnK74RaBr3jI1a+mE6NC
Cp0Y5uMcor7VST29cnyVtheDzlwNePoaJ/dWrVfryX0cX9mL8585K32d45PECvkE8V+0Yyo4Rlmn
LOc/uR3rm7RXHcNmvWjHj54n9nwdNwjLLVj5U5/eks391Wjy3kN78QK+S0NEZ1mq1X+7i/Ii/tyW
37sO2S2Dk1IEqGI6QvWk0qcMtZ+TTprgty6leT4Njg85BfzjS0TlhVrVN9eSzX+7j6P3neXDVGtm
9cfiE0tFOS8fi5unCWavnUqfdi9v3naPNvIpMfWjVfSkq6+T4aHi6cstWOc58NeW2XUrRW6I0b9I
DfN9HRGeK8upuoRez/eSWz7q8rjqje11rn8AGVTE9IpqEVdRT1YRWrCC3vhFcZPtbHCbuQc+Mw+h
PM1a9dek1elB/ZT89835PKW0nK7mP3/kG9HB19OylWqS8lefVm7RXbx4RV3wQ4ZkuQcy0pS0UnDB
p62x15Ly39xeguecnxWwa2vdrj8Q3weh5YiPj68vFUb+fLNyfCEdsn6lvaGyY780LxWmVCDo4WPi
qTyk73nP78uH2VaPXtGi5e4Lw+ho4aKrYyTpwecYL95PqT81fallwTCzHXIBjtLyxsVRpxVOinlT
jvfGT2ylzfYkWRLlsPIaKpaJSnjb622NCLtN/ffoLl5z4LaN7Xt1z+AZYzSVbTDjBK0VlTpQVoq/
Bb2+Lu3xGtM29wk1gKOgvKxVqlbdQTyj/vJL/As+LRnlvUx5/ARmJxdfTtSKd5S2QhFZJcIxWSXU
Xhm25CWWGodH862rWxG6mneEH9trzn9lZcXuHK6mPPmiKqVcRp+sr61SpLJJLdwSWSS4KyQ4Z85C
X1MP0f8AO1a+JXo7adN8/ry5LyVvuTlvxj99ERKWI09W9KrVm+t/kl2JIvDPnITSVDo99Wvie+nT
f+eS/hT4k5a8Y/ff4CH+n03W9KrVm+tv4L1Jci8MechN/QdHfq18Uu2nTf8Ankv4U+Nict+Mfvog
26+ma3pVKs31t/ruS5GuGPOQnVGh0c26tbFLdtp03z+vJfwp8bGeXTxj8RBznW0vVu9apVm+tt/r
uDHtCweJodHM6ijWxX1NtOm/tfWl9lZLfcct+MfiK/iMTW0rV1puVSpJ9bfBJexIvDnbsWGODo9H
fKxCVXEbqO2MOdRra/sLtJy6a7eeRAYzG1dKVNepJym8vgkty4JF4Yt2LBT0bS0ElUxi1qrV4UL9
zqPcvs7XyVzO9t67efwEHpHSVXSk9eq7vYkslFblFbEjUjFuxNYbRNPRsFXxt0mrworKc+b+rHnt
e4m25jrn8BF6T0tU0rJOdlGOUIRyjFcEvftZZNM3LYjUgyFAGAGygwAWlYyDADCg2FG7ACrAGEQY
AYAbCjAo2AbsEGwgwA2FGAGBRgBuwQbsQGwDdgowoMANgG0iINNFBoijVgBLRUGgo00RAmxQaCjT
RECSg0FGmggSAJYAgAQygQwgQADYANhAhgA2igG0EApIAGygE0ACaCAUgATABMoBMIBNAAmACkig
E0AIYQJYANlAhgCGAJCDADQAloA0AYAaKgwAwijYAoIP/9L6MnofKflU0EGmgBIBhQYAaCDCA0AY
AaYUJKgwAwAwgMAMANBBoASVRgBgBhAaANBBgBgBgBpooNBRgBoINEBgBgBgBgBgBoINNFBoKMID
QBgBgBgBoIMKDADADADTVwARVGAGAGAGAGAGEBgBgBgBhAYAasEGAGigwAwAwAwAwAwAwAwAwAwA
ywBqwBoKMAMAMAMAMAMCDRQYAYEGAGAGBRhAaAMAMAMAMAMAMAMAMsAasAaAMKDQQYAYAYAYAYAY
AYAYAYAYAaIowIEtAGigwAwAwAwAwAwAwA0AYEGmgoSAYAYAYAYAYAYAYAYAYAYAYAYAaCjLAGig
0AYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAasAasUGgDADABUUAKAMA
MAMAMANhoKIgwA2VBgUbCjaIg2EGACitDABREG0AbIow0BSIg2RRgAqJQKIDYApAGwBSChREG0VQ
siDZQKQUbIg2FCkEGwDADADADYUYAbANoINgGAGAGAGwowAwAwAwAwA0EGAGAGAGAGAGgBIUYAaC
DADADADABLYQJCjADADRUCWRRoA0EGmAIAMAMAEtlQJCjADADADaCBZFG0ALANoAWAEQAuIUEiAE
QULACEUFQARABkFBIgBYhQWIAVEAVBQRABkFBUAEiAFiRQWIAVBQVABUAEQUFRAFQUEQAWIUEiAF
iFBYgBYhQWJAFQUEQAVBQVABUFBYgBERQtABAAgARBQRAC0ALCjABaANgG0QCmgBIUaKgwAwAwAw
AwA0EGmgBIUYAaAEsIEBAgKEMIBsAQyoBsAEwATCAbCATABsIBsAQyoBtEANoqAbABsAGwgQwAbA
EMAQ0EA2ADZUCGgBDQQIAENBAhoAQwBDKBDRAJKgG8gBDQAhoAQwAbAENACJBAORQDYANgCGEA2g
AbQANoAEwgGygQwBDAEBANgCGUaIaAEBAloASAYAaaIgS0UGgowAUkAKIDZQKRFCkALiAEQASIAS
IULQARABYgBYhQZAZFRAFiFBYgBUFBkQBEAFQUFiAFiRQVABUAFQUdO6M4SOisPLE1MnJX/Ctnf8
DnfL04TtmxRMXipY6pKpLbJ3/I289uxLdH9G/OVZJ+ZHOXw7fZclreGOxOdKtJeNkqEXlHOXXuXZ
+thJG+pl6CpRNOQ6NgaUdAYZ1J+e82ue5fHtMXy9E+zBRqtV15OUndt3ZpwEpojAPSFRL0VnLq/M
WtYzYnekGP1bUIbFbWt6l+uRmOmd9BWEacRb9CYNYeLrzyyy5Lj+t3WZrvhNeRC4/GPGzct2xLkV
zt2AU4Oo0lm3sKzBb/J0PR4yfrfwRjl39mCquTm7vNs24B3hMM8XNRXa+CI1JsTukMSsJBUoZO3c
viSOmV14FdK5CS0dg/lMrvzVt+BLW8cdh3pPGX+jjsW34CRc8vQQxXMS2jcF4568vNWzmS10xx2N
aRxvjnqx81esSGWWxFFYExo3Ba/0kti2fElrpjiA6Rxvyh6sfNXrEjOWWxFMrAmNGYHX+knsWxce
ZLXTHEN9J4/5S9WPmr1iRMstiHkacxMaL0d4968/NWxcfyM2umOOwnS+kvH/AEcPNW18fyEhnlsV
805iV0Toz5a9aXmL18viS1vHHYd6a0okvE0skspNexe/uJI1nl6Cos04iQ0ZoyWkp22RXnP9bxbp
rHHYs+k9IR0bDxNLJ23bl8eZmTbrldeIKVKX6/X65mnAEwmEnj5qEO/guP8Apa/FhZNi44rE0+jl
FQhnN7Pi+XBdnEzy7W9kHPK9WWIk5Sd3J36+pb+TfUbefewmnQlVkopNzexLOXfsj7t6BodEwWEp
9HKLqTtrtZ29ib9r/Ixy9EnbBQNIY6ek5upJ61tl8oR5Le363wZueHC3Yj35flbbZa8sorlGO/qz
+6isi96C0HDCL5ViPOSunPcuNt3K97cnksWu+OOvNFf050glpd2prVoxeUpbG+NuPBZtbVZ3LJpj
PPuFYj5V5Qz41Z7L8lnn/FLekjTmLN0a0AtJz8bNOUE85y9J8Ip7uMnfkk9mbdOmGGxLdIulDi3h
cItaSVpS3Liuze3ktjvmSRrPP0g5tUcXLy261R5KKvqrldZvqjZcGzo84ktH6HqaaqqnN3a9CNko
Lm15MepXk3k0nmS3TUx7h0nH6QwvQ2gqcLRm1dRSu2/rNX9r3Wuc+XptmEHIq2KraScqi+jhJ+XU
k85cnK139yCtb0d514eS3YZ4Va01TwkHOo/Tau/wxzUet3a23iKk+4dV0JoOl0RpSxmMles9r22v
6MeMnvfuu3zt29OOPZ5o590j0lPTNTxmLk6dNfu6Kznbmtib3ylnwTRuTTjne7n8BBQdTGwcaSVG
gspSbsn96W2T36q7IorHI6F0K6J061sRKOtBebKa858Yx3R+07ye7VMZV36fT9Qbpv0vpWeGhLWj
snGDtrcnLdHileT2PV3pDqdT0HL3GtpSClNxo4eLy9GCe/VWbnLi/Klxdszbz8/AS3R/R89K1vE4
CLjbz8RJeUlxW6HJK8n9a17S1vGb4/EdO0rprC+D3DrD0Vr1mr2bzbfpzfu37FZZrEnc75ZTpzUH
GsVWxXSRuviJqFJN+VLKCe9RSzlLqTk9/E6cPLd5eaG8dIQwL1MHF67y8bJeW39hK6h2Xl9pbBo3
rgY9H09HvWxkm57fExfl3+3LNQ6s5cltKa1yNqeI079HTioUYZuK8mnDnJvf9qTcnsXAcHnIbWIo
aJ/cpVqv95JeRF/Yi9v3p/wraOTcgUsBPFftGMqOEJZ60s5z+5Ha+t2iuO4hrfmhM9JOa8Rg4OEZ
ZO3lVKnKUln+GNo8m8xpN+kC/kFHROeJevU/uYPZ9+a2fdjeW5uI5XUnP4BGtiekUlCKShBXUVaN
OmuL3Lm3m97bLwnnIF8fh9DfurVq395JfRxf2Ivzn9qWXCO8cr4x+8DpYCtpa+Irz1abflVajeb4
RW2T5LZvshvRrfmglTS0MCnTwacE1aVV/vJdq8xco58ZMHdrgZR0NHDRVXFydODzjBZ1J9Sexfal
ZcFImzt94HitKzxiVChDxdJtWpwu3J7nJ7Zv1LckNJct+IHPzbR0Pni3rVN1CLzX+8kvN+6ry46o
3tddvP4BrWxWI0/ONKMbpZQpQVox6l7W897Y4POQeeLw+g/P1cRX+qs6UHza898l5POWwcrqY/f+
QZxhieklW+c5Wzbsoxiu6MYrsSLwnnIPvlOH0FlRtWr/AN615EH9iL85/allwjvJy1uYhhhsDiNP
TlNu++pVm7RjzlJ+pbXuReGZLkJB6So6G8nB+VV34iSs1/u4vzfvPyvuk5XumPH4hhgNE1dK61Rt
Rpp3nVm/JV+L2tvgrtlt0zJsSFTS9PRidPBJptWlXkrTl936kerynve4mmu7XH4hlo7Q09IJ1JNU
6MX5VWWxclvlLks+obSY7D6vpmGCi6OCThFq0qr/AHk+30Y/ZXa2NFy1wGujdCyxsXVm1SoR86pL
Z1RW2UuS7bC0xx2HWJ0zHDQdHBp06bylN/vKnW1sj9lZcWxpblrgNtG6FljYurOSpUIvyqktnVFb
ZS5LtsLUmOw7xOmY0IOhg4unTeUpv95U+81sX2VlxuTS3L0gb6N0NLHRdSTVOhHzqktnUltlLkvU
XaTHYd4rTMcPB0MGnTpvKU3+8qdbWyP2VlxuNLcteIGejNDT0inNtU6MfPqS81cub4RWbFqY47D7
E6Yhg4Ohgk4QeU6r/eT/AODH7K7WyaauWuAx0ZoeppNtxtGnHOdSWUYrm/YlmxazMdiUr6Wp6Mi6
OCurq067ynLlH6keW172NNXLXH4iJ0bourpWTjTWSzlJu0YrjJ7kW3TMx2JqppOloROng3rVGrSx
DVnzVNeivtec+RNbb328fiIPA4CrpSpqU4uUnn8W3uXFsu2JNiwPF0ejq1cO1VxG+ttjDlTT2v7b
7DPLe+3jn3iu0qVTSNTVipTqTfW2zXDnJsWb6Hox9Wti++FJ+yU13J8Wicuvs/EVfEYmeMm51JOU
pO7b2srnbsCSDIUFGAGygxK5AL2EBgBsoMChVgDZEGAGAG7BRgBuxQbsAbIgwA2FGAGBRsAyxEG7
AG7AGygwKMAMAN2CBViA2FGACWgBIBgAloASUGWIBDVioNBRjQQIasAaCjLBAhgA2gBLQAMIENWK
BDABtBAhoAGygG0EAmgATQAORQCkgATQQBYANlAKSABMIBMADIAGyoEMAQAIYANlAhgCADAgwA0A
aaCBIUYAaCDYUKQQbCj/0/oyel8l+VTGQGggSwo0UGAGgDCINAGAGMKElBoIMAMAMIDADABIQYwB
JVGAGAGEBoINAGAGAGAGmiqNAGggwgNAGAGAGAGAGAGioNNAGgowgNAGAGAGAGggwoMAMAMABgGr
AGrBRhQYAYAYAYAYAYAYQGAGAGEBgBqwQYAaKDADADADADADADADADADADLAGrAGWCjQBgBgBgBg
BgQaKDADAgwAwAwAwKNEBgBgBgBgBgBgBgBlgDVgDRQaAMCDADADADADADADADADADRFGWCBNgDR
QYAYAYAYAYAYAYAaAMCBNiqNAGAGEBgBgBgBgBgBgBgBgBgBgBgBqwUasAYUGgDADADADADADADA
DADADADADADADADADADADADADADADADADADADADLACGrFBizACAGAGAGAGAGBQpEBsA2VBgBgUbC
hSIgwINhRsqjABSIg2gDZFGFApBBsijABUSgUQGAC0AbAFIAUQGygWiAwAUiqFEQbQUbKBREGAGA
GAGwowAwA2UCiIMAMAMAMANhRgBgBoAwIMAMAMAMAMAMAEBRgBoIMAMAMAMAMABgGAGAGAGioEEU
Ywg0AJYUJCDADABDKg0FGAGAGgg2FBAgwiggBgAQAIgBcQoJEAWgoIAERFBEAFQAVBQVABYhQWIA
SJAFiFBUAFQUFQAVABYkUFiAFQUEQAZABEFBUAERFBUAFQUEiAFiFBYgBIhQWJAFQUFQAVBQVABU
FBYgBERQsAIAEQARBQRAC0ALCjABaCDYUbRALKDTRAJCjRUGAGAGAGAGAGggS0AaCjABLCBAAhgC
JBAhgA2VANgA2ACYQCYQDYANhANgA2ECGADZUA2ADaABsAGwgQ0AIYAhgA2ioBsIEMAQwBDQQIaA
EMIBsoEsgEFAhgCJIIEMAQwAbQAhoAQwgGwBAANlANoAG0ECJAApAA5AA2ADYQIZQIABtACGVAhk
FhDKihsA0QCWigSAYAYQCWioNIKFkBhQKSChRECiqFogCIAWgAiCgiAFoALEAMgpRUQZFiAGiFBI
gBUFBkQBUAEiFBYgBokUEQAZAExoXR70nXjT3bZdS2/DrZK3jNi49MNIKCjhoZJWcrepe/uM4x16
l9BRImnAdPwkF0bwbnL9483957F2b+0xy9U+xBzyU3Ubk3dt3bNvOLL0Z0b8sqeMkvIhn1vd8TNr
phjsF6R6R+V1PFxfkw9b3/ASGeWxAwi5ZLaysDoNOMdAYe789+uT3dSM8u/swUmU3UbbzbzZpwEt
onAfLqmfmrOXw7SWt4zYltO47+xhsXne5Ejed9BXTTkLVobBqhHx08ssuS4ma7YTXkRGNxjxs3Ld
uXIsc8rsN4Rc3ZbWVkWyEY6JpXfnP1v4GOXf2YK3Um6rcntZpxBMPQeJkooLJsWHFVlo+ChDb+sz
M8uuV7RWzbgHmDwrxUrbltZK3jNiU0hilQXi4ZZZ8kZjpldeBAmnIPsDg/lUs/NW34ErWM2HuksZ
qrxcO34CRrPL0EEacQ/wGC+VSu/NW3nyJa6Y47DrSeNt9FDYtvwJIuWXoK+zTkH+j8A8ZK781bfg
S1vHHYfaW0gqa8VTy3O3sJI1ll6Css05B7o7APHStsitr9xLWscdiY0rpBYKPiaWTtZ23L4kkdMs
teIKeouWw04h9gdGvGS1e97kv16ybamOxZ8djIaHpqlT862XLmyTy629oo9Sbm7vNt7ef64Z8zTg
MoYeWKkoQV2/Vze5etgk2LrOVLo3R3Ocu+T9tkZ5d/YgoeIqzxM3Oo3rPtfYt36sbee+QKMHN6sU
3J+jHOT65buztQBfdGYCOg6Tq1bKVs0ti5Xe182/UYvl3xnaKTpLSEtK1HJ+UlsV7Qiubyu+eWfF
ZG5NOOV7hFv6TNeW1veUI9mXrt1MrIuugtAxilicQ72V43yilxs93C9urYYtdsMPWiJ09p/52l4u
inKEc88o9b5cL2XFMsmmc898CqP6SW+rPclfVXsyXKyXNGnIWLQfR56Zlr1pXhHK0co/dTWXXq5c
75GbdOmOHcJvpJ0hpaOh8mouzSs1DKy4J7FzebXDepI3nnrxBzmqnq2qNUqe1QS8p87Xu+Tk+rgb
ecO9F6Nr6Xfi8NHxdN+dN7Wt95bX1Rstl1vFulxly4HRqsqXQ/D+KoR16zV88vxzexRW67XDizny
9HsTwOR4rExqVHOb+UVpPbnqX5LJy5LKK+0jq8tvzA6uHlUmvlEnKeyNKFtbkssoLlZv7INe8db0
No6n0YoPEYnVpu3mrZHlvcp83fgrLbzt29WM7ZujnemulVbpDWthoNWvqvbJLe1ujzltX1ksjcx0
4ZZ3LgVWUaOBd5vx1Tgm9RPnLbL8Nl9plcvE+8Xvox0Tq6elHE426oR8ynbVT6oqyjHqtreszbp2
ww7vNBulfSqppVvB4D93FWqVFkrLdrZKMOLyT2bNsk0uee/EHNm8Po3ZavV4u/i49mTm+u0eUkbc
PE+8T2h+i2L6U1VKtJwjZO8turu1Y7lw2R4XtYlum8cLmOn4/GUuhtBYTAw167V0ttuNSo8suuy6
ksscvRb2TU5HFcViKVCcqtaXynESd3m/Fp83k59StHnJZHR5LfnQCeGraUtXxM1TpbIykrKy9GnB
beqKUVvaKa35oTHSSoPxWChKLllr7asr7lbzU+Ec9zkxo37v6Rv5upaMzxT1qn9zB5/jlmo9SvLc
9XaNmtchSniNPeRBKNKGeqvJpwXGTeX4pNyfFk4POQ38ow+iP3SVar/eSXkRf2IvzvvTy+zvHJuQ
ajgKukP2nFVNSEv7Sd3KXKEdsuy0VvaBrfmjJ6WVBeKwcXTUsnPbVnfc2vNT+rG3NyLo7vd/SFx0
TT0atbGNqW6jHz3955qC67y+zvGzt1z+AHUxdfTTWHowtC/k0qay63vb4yk31pDg3vwD+Jw+hvP1
a9Zein9FF/aa898o2j9p7ByvjH7wKNPE9I5uTd1FZydo04R9UYrgl2JsnCecg4+W0NDZYe1Wt/fS
Xkx/3cX/AIpZ8Iocm5jx+IbYbRtXSutXqz1ad/KrVG83wW+UuSu+NkN6STfkHnpeGj04YJON8pVp
fvJdX1FyWfGT2DS92uPxA8JoW8FXxMvFUXsbV5z+5Ha+t2iuI2TH1o3itNWg6OGj4qk8pZ3nP78t
/wB1WiuG8uluXuBKGhY4SKq4yTpxecaa/eTXJPzV9qXYmNnbrkN8dpieMj4mlFUqN8qcd74ye2T5
vsSGkuWw8p6Hp6LSqY1tN5xoR89/efoLr8p7lvJtda5/AM8dpWrpTVpxSjTT8ilBeSn1bXLm7tl0
zctiQjoujoda2M8qpuw8X5X/ACEl6K5Lyuom9tduufwEdjtJVtMSjG3krKFKCtGN90Yrfzzb3tjh
LdiUjo2joTysX5dXdQi9n+8ktn3V5XGw5a1MefwEZjdI1tMzinnbKFOKtGPKMV/q99y60xbchLLR
1HQflYv6StuoRez/AHkls+6s+LRN7b7e3n8BE47SNbTE1rZ7oQirRityjFbPa+Y1pm3Yl46No6DW
ti/Lq7qCez/eSWz7q8rjYm9ta7efwEVjtI1tLzTnnbKEIq0YrhGK2e18y6YuXcJiGi6Whkp4zyqm
2OHTs+uo/RXLznyJvbfb28/gInSOlaulZLXsoxyhCKtGK4RX6b3ssmmblsS1LRFPRUVVx17tXjQT
tOXOT9CP8z3Im9tduufwEZpLS9TSjSlaNOPmU4q0YrkuPFvN8S8M3LYk8LoaGEgq+NbhB5wpr95U
6l6MftPsTJtqY680MtJ6ZnpBKCSp0Y+ZTj5q5vi+LeZZGcsthzgNCJwWIxMvFUN3158oLf8AeeSG
1mPrQjSWmnio+JpR8Vh08oLe+M36T68luQkW5DNGaEljIutUkqVCPnVJeyK2ylyXaS1Jjv4A+O01
FQeHwsXTovzn6dTnN8PsrJcxIXL0gaaL0PU0o242jTjnOpLKMVzfsW1lt0Y47EniNL09HQdDBXSa
tOs8pz5L6seSze8mmrlrj8RWDTmFJEQbCjYBhQbSIBRAYAbKDaQUKsAYRBgUbsAbKowIN2ANkQYA
bsFGBRgBsA3YIN2AN2AMAMCjADYBuxEG7AGwowAwAwAwA00AJKDRAaaAElBogEtACSgwAS0AJANN
BAhgA2AIaKBLVwgGwAbABtBAhooByCATABMAE0UAmACkEAmACZQCkACkEApAAZIoBsAQAIYQIYAh
lANgCWgBIBgQYAaANBAkKMAFJAGwg2FH/9T6MnpfJflUwijQZGmFCSgwAwA0EGiAwAwA0woSVBgB
gBhAYAYAaCDQBplUaAMAMANEBoIMAMAMAMANNFUaANBBogMAMAMAMAMAMCDRQaaANBRhAaAMAMAM
ANBBhQYAYAIANAGAGAGrAGWANBRhQYAYAYAYAYAYAYQGAGAGEBoIMAMANFBgBgBgBgBgBgBgBgBg
BgBlgDVgDQUYAYAYAYAYAasVBgBgBgQYAYAYAYRRoAwAwAwAwAwAwA1YA0VRoIMCDADADADADADA
DADADADRAYAJaANFBgBgBgBgBgBgBgBgBqwAloqjQQYAYAYAYAYAYQGAGAGAGAGAGAGAGAGrBRqx
QYAaAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMANgGAGgDErFBsAwAwAwAwA2FG0QG
wDZUGAGIKNhQpEQYEGwo2VRgApEQbQBsijCgUgg2RRgBtFAsgMAFIAUAbQAsgNlApEUbCBSKoURB
gUbAFIA2EGAGAGAGwowAwA2mAKCDADADADADdwo0EGAGAGAGAGAGAGACWFGgDQQYAYAYAYAYAJbA
EgGAGAGgg0wBIUaCDABDCjQQYAaZUCAowAwA0EGAGwoWgg2RQtBBsKCIAWgBcQoIgAiCgiAFoKCx
IAiACoKCoAKgAsQoLEgCxCgiADIKCoAIiALEKCxACxACoKCoAKgoIgAqIoKgAiCgqACoKCIALEKC
xIAsQoLEAIgoMgAiCgqACIiggARABEAEQULQARACwowAWgg2FG0QCygwA00QCQo0VBgBgBgBgBgB
oIEMKMANMIEMAQwBAQDYAhgCJFQCkACkEA5AApBAOQQDYAgIBsoEMgBsqAUgBDABsAQwgGwBDABt
BAhgAyoENACWEA2AIYQIaAEMoEsAQyAQVANgCGgBDQAhgA2AIYAOQQDkigRJAA2ADYQDYANgA2AD
aCAbKBDAEMAQwgGyhCGBoNgCQgwgNNXAElBoAwgNIINlUbQAsgNoqjYAQgFgBEAEQUEQAtABYgBU
FZoyIAsQAsQoKgAqIoKgAsQAsQoLEAKiKCoAKgDqHRfCx0VhpYmpk5K/4Vs7/gc75enpztmxQcVi
ZY2pKpLbJ3NuFuxYei2jfl1bXkvIp5vm9y9/YS106eO6HPSnSXyur4uL8mnl1y392zvJIvUy3RXq
NN1moxV23ZI05jo2Lmuj2FUI+e8k+b2vs3dhjl6L9mDn6NvOLd0a0d42XjpbI+b1/l7eoza69PH1
DPTWkPl1TLzI5L3v9bhImeWxG04Oo0lm3kisC9PV0HQsvPfrfwRjl6PZgprk5u72s24CU0Xgfls8
/NWb+BK1jNiU01jb/RR2Lb8CRvPL0EBE05Cy6Iwaprxs+zq4ma7YT1EbjsW8XO+5bEWOeV2GyVwy
LPQpx0ZTcpec/wBWM8u8nbBX6lV125PazTjbsZSpus1FbWCTYsVScdGU7Lzn7eJnl39mCuSk5O72
mnEGw9B4mWqgsmxN4qusBBQht/WZnl0t7RXHmacQ4wuGeKlZbN7CybExjsUsFBU4bbd35mY65XQr
RtwB8JhXi5aq2b3wI1JsTePxcdHwVOn51u7n1knl1yuvAqkszTgDYXCSxktWPa+CI1JsWTF4iOiq
ap0/Ot3c2Z5dbe0VJ07u8nds24g1Cg8TJQgtv6/W0iybFnrVYaDpWjZzfrfF8jPLrb2ik1qrrNyl
m3m/18TbhQKnSliJKMVdvL9Pf2ZbwTyLtQpU+j1LWnnN8N74Izy7ydkFMxmKni6mtK+s9iWcupfV
9vWajjbsM0rvVW1+jHNvrl8MuorIvGiNGLRcHWrWUrXstkV73zd7bDFu3fHHt5FS0tpJ6Vqb5JbI
J+SucnvfG1lzNSacssu4REvpHbz2vRWUV3eu1lv1mVgW7QfR/wAfatXacVnGC83r4W6sntu0Ztds
MPWhn0k07HGvxNNuUL+bH0nzfDgle/FPZZGc89ipVnq5VXZLZTh73mk+b1pcUachOaH0BV0s7SXi
qCeaW18uN+ctl7pGbdN44dwsen9KrRlNYfDtU0lZz+quEVtcuLWze09kk26Z5a8Qc1otu/iI2ttq
ytdduyPLbLg9xt5/gC6PwPy2qqdFeNqPNylfUjxdnm+uVuGqxVk2OlY3H0ehtBK/jK0lv2yfF8Ir
clkti3s5ybei3sg5dpDEVtJvxuKnqQlmo2zf3Y7XylJpWy1tx0jzW28hph/GYjyMLDUWxzb8rPjL
K1/qxtfZ5TKk88Dp2gejVHotB4nENSqW22yjfdFbXJ7OO6yzvzt29OGHZ5oonSbSz0rU1sS3GEfM
oRfldc3mot773a2au83Jpxzy3z+Ary8bj4NRUaOHTzeajfm85Tly8p8EkVz5+AvvQzovTxDVdxbp
rZOazm/sx2Rj9p3k92rmYyrv08PUPOmvSulBPDQm2tk4web+y5bIx42vJ7LRWbYxep1PQct+m0rD
LVpYeL+7TT9blL+KfYbebzfgJXQGjPnGsqWCjrSXn4iayiuMY5pcr3k9q1c7St4zd8fiOp6S01hO
gtHxSbnWlna95yb2zm3s63fkmkYk29FynTHF8Rj8V0klNQWrBvWnZ2j96pN7eTk7LYkth04eXdyD
LxuH0V5iVer9Zr6OL5Rec+uVo/Ze0J4n3jc8FVx/7Ri6mpB7JSzlJcIQ2tblsgtl0U1vzQlaScPo
sFBw1stbbVnfddbE/qxtwbkDfu/pC/m6jovPFPWqf3MHn+OWaj1K8tz1dpN7Na5/Aa8bidPvxVOK
jThnqR8mnBfWk3l1yk23xHB5yCvGYbRHmWr1vrNfRRfKLzm+crR+y9o5PE+/8gmGDr6ZbxFeerT2
OrUeWW6K2ya3RisuSLwauXmhb0rT0atXBpxex1pfvH93dBdV5fa3DRvXH4jVLQ/ikquLk6cJZqO2
pPqjuT+tKy4X2DZ2+8ar6VlWj4jDQ8XTllqxzlP78tsurKPCJNFy9IDrRlLRXlYx3nuoRflfjlsh
1Zy5LaN7O3XP4BvWxlfTko0acfJv5FKmvJXO298ZSu+LHCbuXgOvk+H0L+9tXrf3cX9HF/bkvOf2
Y5cZbhy1qY/eGreK6SVLZzaWSVlCEfVGMV2IcJ5yDvxmG0J5mriK69Jq9KD5J+e+b8nkxyvjH7/y
DSlh8T0iqSm25NZzqSdoxXOTyS4LsSLwmrkHvy2hoXLDWq1v76S8mL/43F/4pZ8IonK7mPH4hlhN
HV9NylUbyWdSrN+SvvSe/gldvci70zJcg/ek6Oh/Jwa1qm+vJZ/8g4+j953l90mttd3bx+IYYHRV
XSzlUbUaad51Zu0V1va3yV2+A3pmY7EhLS1LRKcMEnrbJV5Ly39xegv5nxWwa21vXH4hho/RFTSd
6jahSi/Lqzdort2t8ldsbSY7D+ppenotOngk02rSryXlv7q9BdXlPe9w1tru1x+IY6N0PU0led1C
lHz6s3aK7d74JXbLbpiY7ElU0vT0WnTwSabylXkvLf3V6C6vKe97ia213a4/ER2jtEVdKNyVowjn
OpJ2jHrfHgldvgLdJMdiTnpalolOngr62yVeStJ/cXoLn5z4omttd2uPxEZo7RVXS0nqbFnOcnaM
VxlJ7Pay2sTHuExLSdHQi1MH5VXZKu1n1U0/NX2n5T5E1tvfbx+IhsDo+tpeo4005S2yk3klvcm9
i5s1wxJsTbxtDo/lhrVcRvrNeTH/AHae1/bfYjPLe5jxz7xB4fDVtMVdWKlUqSd+LfFtv1tl4Zk2
LBr4fo75urXxK9LbTpvl9eXPzVzJy34x++iAnUraVq3etUqzfW2y8OfIsCwtDo7nXUa2J3Ur3hB/
ba85/ZWXFk5dNTHnkQONx1XSlTXqycpPJcuCS3LgkXhi3YnqWiqWhoqpjc5vOOHTtJ85v0Vy858i
b23rXP4CI0lpWrpWSc2lGOUYRVoxXCK3e1lkYuWxJ4LQsaMFiMY3TpPzYrz6n3VuX2nlwuTbUx9a
Guk9NS0glTilToR82nHYub+tLi2WQuWxDWDAUEGwo2UGACkiA2QGFBsA2kFCiIMAN2CjZQZYAVYA
wiDYUYAYFGAGwDdgg2kAbAMCjADADADaVwgVYgNhRgBgBhQbsAbsQGmgDQBjVwBFig0QGmrgCSg0
AaaIBJQaANNACABDQQIaAEACGrFQIaABtAA2ggQ0ADZQCYQCkgAUigEwATQQBkADYAJlAJgAZBAK
RQCAEMIEMAQwBDKAbANBBpq4UIAMCDADQBoINWChQQbCjAD/1foyel8l+VTCA0AYECAowoMANBBh
AaAMAMYUJKDQQYAYAYQGAGACQgwASVRgBgBhAaCDQBgBgBgBgBplUaANBBogMAMAMAMAMAMCDRQa
aANBRogMAMAMAMANBBhQYAIYBoAwAwAwAwAwAywBqwBoKMKDADADADADADADADCAwAwAwA1YiDAD
RQYAYAYAYAYAYAYAYAYAYAZYA1YA1YKMAMAMAMAMANFQYAYEGAGAGAGAGBRogMAMAMAMAMANWANW
AMKDQBgQYAYAYAYAYAYAYAYAYAJaIBNigwAwAwAwAwAwAwAwAwA00FCSgwAwAwAwAwA0EGAGAGAG
AGAGAGEBgBgBoKNWAMKDQBgBgBgBgBgBgBgBgBgBgBgBgBsAwAwAwoMAMAMAMAMAMAMAMAMAMAMA
MAMANhQpEBgBsqDADEFGwoUiIMCDYUbKowAUiINoA2RRhQKQQbIowA2UCyAwAUgBQBsAWQGygUgo
2RBtFULIgwA2FGFAsiDADADADADYUYAYAbTAFBBgBgBgBgBgBgBgBgBgBgBpsKEgGAGggwAwAwAw
AwA0wBABgBgBgBoqBLIo0AaCDABDANAGACZFQJCjADADQZGAGw0FIIFEUKiVAoihaAFoAIgoIgAi
ChaACRACRIoLEAKgoKgAqACoKCxIAkQoKgAqCgqACoAKiKCxACxACxCgqACIKCoAKiKCIAKgoIgA
qACoKCxCgsSAJEKCxACoKCoKCoAKgAiIoIAEQARAC0FBEAEQAsKMACBBgUbRALKDADABLRFGgDRU
GAGAGAGAGBAlq4AkKNACWECQgGFCGggQwAbKgEwAbQQCYANhANhAJgCGAIYQDaABsqAbQANgA2AI
YQIYAhgAwgG0UCGECGAIYAiQQIaCBAAhgCGAIZQIYAiSAENBAgAG0AIaAENBANoAGwBBQCYAhhAN
gAmADYANoIBtFAlgCAAbCAbKBDINENFQJaChIQYQGmrgCSg0AYAbAFIgNgCiqNpEAtABEAEQUEAF
oAIgAiADIDIsSKCxACxCgqACoigqACxACxCgsQAqIoKgCW0RgHpKtCktjefJLaStYzdF46ZY9UYw
w0MlZNpcFsX64IzjHbq30FAirm3AdSil0awX/HH/AIn8Pcc+Xq9iDm99bNm3mF26J6O1268tkco9
e99n62Gcq7dPH1ETprSHzjVcl5qyj1ce0sjGWWw0wmGli5xhHa2Ek2LxpfER0VQjQp7Wrdm99vxM
zy75XtmhSUacBbuj2A2157F5vvf65ma7YT1EZpPHfLqja81ZR6uPaWRjK7DSlB1WorNvJFZFyqSW
haFl579b49hjl39mCpN62b2m3ASWjMF8snn5q2/AlaxmxKaXxn9lHYtvwJI3nl6CBRpyFg0Vg7fS
y2LZ8TNdcMfUMsfjPlUsvNWz4ljOWWwzRWRY8JQWAg6k9tv0jF8u2M7RCYiu8RJyZpzt2BRi5uy2
sILHCMdGU7vOT9bM8u3sivVKjqtye1mnG+RqnTdVqK2sGtixScdF07LOT9b+Bnl19mCs1Juo23m2
acRujSdeSjHawSbFiqTjomnZZyfrfHqM8u3swVSpN1G282zbiMpUZYiSjFXbISbFq8jQ9Oyzk/W/
gjPLt7Iq9Wq6zbebZpyoFCDrNRirt5fr9PsByLTCMNCUtZ5zfrfDqRnl19kU7E4iWJk5yeb/AFa/
uRuONuw3VNzsuOzn1Lf1sILngsHDQ1PxtTOb7X91fr1GeXeTtFUx+Onjp3lk9ijHN24X3c/WjUcb
diOa9H+WPvf+vYVkXLQuifkq8dWsrZqK2Lm+L4bbezFrvjjrzRXtNaU+c56qu4rzYR382/cr5b0z
UmnPLLYg552jLPhThsvzeefe910VzFn0JoGWLtUrJRpLNQW9rj1c7vcZtdcMN8jXSbTKq3oxlq01
51vOlyS3LrtfcmtqQzy9BT84xytSg9+2Ul7X2WjxNuQk9BaLlpOdqScKa86q/O6o7k+rNb2yW6aw
x2LTpnTHzTFYXCK9RLO2aguL57231szJt1yy7fEHNasoqWtUbrVHuTer2va+qNlwkbeah5h9G1dJ
1I05uz3U4rNLe2tkFxb8rkxtqTY6XqYfojQ8nVjJ7285PntbS4JdSOfL0eMIOU4nSM9IVXKmnUqv
05LNL7Mc1FLi7tbbo6a081uxHThTpSvUbrVW/NTbV+ctsnyj/EVn+I6noXRS0LS+V41qLirxja0a
afBL0nsvt3Zs527enHHt80UfTHSfE9I5uNBOFON+TS2XlLZG+/NLddmpNOOWdy4FVl4jAcK1TtVN
exy9S+8jTn4n3i6dG+idbT01iMbdUY+bF5a3JJW1Y9Vr7uJm3Tthh3eaHvSrpRPHt4LR/mpWnOOS
styexRW+WS3bNskXPPfiDmzjh9HbbV6nBXVNdbyc+y0eckbefxPvExovo9jOls4uT1adspNWio/Y
irZdVlffclum5hcx0rSGPodBqEcLhI6+In5sbXk2/Slb1LfsVksscvRbOnNTkcexdOFOcquNm6ta
Tu6cXnf7c80vuxu93km48t+8ATxGnFqxUYUIZ2XkUoc23tfNtyfMvCecv34A3icPor9ylWq/3kl5
C+7B7euf8C2g3IMeAqYz9oxlRwhLNSlnOf3I7X15RWy42a35o09K+L+iwcHTUstbbVnfc5LYn9WN
luesNHd7gr5spaMzxbev/cwa1vxyzUOrOXJbRs7dc/gEPE4jTjVCjC1NZqlBWivtSb285Tb67Dg3
cvALqYbQ+22IrcF+6i+b2zfVaPOSLyeJ9/5AcaOJ6RSdSb8iOTnLyacFw4LlGKu9yY4NXIGWNoaI
ywy8ZV/vprJfcg9n3pXfBRJyu5OPxA6GjKukb4ivPUpt51ajbcnv1Vtm+rZvaG01vzQSemIYBOGD
i4XydWX7yXU1lBco58ZMaO7XARh9C6sVWxUvFU3msrzn92PD7TtHm9g2TH3jMTpm0XRw0fFUnk7O
85/fltf3VaPLeNFy9wLT0NDApVMbJwTzjSX7yXY/MXOWfCLC9uuQDGaXnjIqjSiqdG+VOF83ucnt
m+b7Ei6S5bDuOiKei1rY1tS2qhF+W/vvZBd8uS2k2utc/gGeM0pV0pq0oR1aafkUoLK/VtlLm7tl
0zcth+tF0dD+VjHrVN1CLz/5CS9H7qvL7pN7a7dc/gGGM0lW0w400rRTtClBWir8Ira+bu3xHCW7
EitG0NC54vy6u6hF7P8AeSWz7q8rjYm9tamPP4CNxukq2mZRi9iyhTgrRXKMV+be9sutM27EmtG0
dC+Vi/Lq7qEXs/3kl5v3V5XGw5a1MefwEZjtJ1tMSjF7FlCnBWjHlGK/1e9ssmmbdiUjoujoZa2M
8qpuw8Xn/wAhJeiuS8rqJvbWu3n8BG4/StXSrSlZRjlCnFWjHkl782+JdM3LYlIaIpaJSnjm9bbG
hF+W/vv0F/M+CJvbXbrn8BHaS0xU0naLtClHzKccox7N74t3b4iRnLLYkqGhYYCKq41uCavGkv3k
/wDgx5vPgmNrMdc/gGektNTx6VOKVOjHzacfNXN75Pm8+oSJcthzg9CKEFXxcnSovzV6c/uR4fae
S5jazH1oFpDTbxMPE0YqlQXoLbLnN7ZPryW5DRct+IFaO0HLFQ8dVkqVBbZy38oLbJ9WXFktJiD4
zTUYQdDCRdKi/Ofp1Pvvh9lZdYkLl6QNNGaGqaTvJWhSj59SWUY9u98Es2W1McdiSraXp6Mi6WBu
rq0q7ynLlH6kerN72TTfdrj8RD6P0bV0rPUpRu9rexJcW9iXNlt0zJsT7xtDo+tXDNVa++s15MeV
NP8AxPsRnlrfbx+IrlOnU0jUslKdSb5ttmuHPkWbxVDo3+81a2K+ptp039r60uWxbycuupj8RW8Z
jamkJupVk5Te1v8AWS5LIrnbsN0gg2EGwo2UGACkiA2QGFBsAUkFGyIMAN2Ko2AKsAYRBsKMAMCj
YBlgg3YA2AbAMCjADADYBlggUkQGwowAwoMANgG0iAUAYAYAJaAEgGACWgBJQaauQCWrFBoA00QC
bFBoATJACXmEAwBDRQIaCBDQANgA2EA2ADZQDYQCaABSQAKRQCkABkggEwAbKALABNBAJlAKSAEM
AGwgQUCGAIYAgIMANNXAEbADADADQBoqDZFGwDdgD//W+jJ6XyX5VMANMgMCBLCjRQYAYAaCDRAY
AYAaaChJUGAGAGEBgBgBoINAGMASVRgBgBogNBBgBgBgBgBgAkqjAg0AaIDADADADADADAg0UGmg
DQUaIDADADADADQQYUCWRRoAwINFBgBgBgBgBgBgBgBqwBlgDQUYUGAGAGAGAGAGAGAGEBgBgBqw
QYQGigwAwAwAwAwAwAwAwAwAwAwAywBqwBoKMAMAMAMANFQYAYEGAGAGAGAGBRogMAMAMAMAMsAa
sAaANFBgQYAYAYAYAYAYAYAYAaIDTQAkoMAMAMAMAMAMAMAMANBRqwBoqjADADADADADAgwAwAwA
wAwAwAwA0AYAYQGrAGig0AYAYAYAbAMAMAMKDADADADADADADADADADADADADADADADADADADADA
DYUKIDADZUGAGwowKFEQYEGwo2VRgApEQbANkUYUG0ECiKMAMACIoMIBSAFAGwBaIDZQbQUKIg2i
gUiA2AYFGwDaKBREGAGAGAGAGwowAwA2mAKCDADADADADADADADVwDVwo0AYAaCDADADADADADAB
DYBoAwAwA0EGACAowA0EGmAIAMAMABsqDAowA0EGBBoAUFG0ALIo2ioFkULiALQAtBQQAKgoWgBc
QoLEgCxACIKCoAKgoKgAsSALEKCxACxACoKCoAKiKCxACxACRCgqACoKCoAIgoKiAKgoIgAqACoK
CRACoigsQoLEALEKCoAKgoKgAiIoIgAiAFoAJEKCIAIgBYUYAECDAo2iAWUGAGAGACWiKNAGioMA
MAMAMANBBpoASFCWECABEggQwBDABsAGyoBMIBMAGwgGwAbCAbAEMIEMoBMgBsqAbAEMAQwgQwAb
AEMAGwgQEA2UCWAICAbAENBAlgCGUCGAIZAIKgGwoQwgQ0AIYANgA2ECGADYAORQDaABtBANoAHI
AHIAGyoEMAQwAcggQwBDAsDZRWiIEtFUaCDRAaauAJKDQApIAUQGyqFJACiAUgAiACIKFoAIgAiA
CICUaIVBYkASIAWIUFQAZEUFQAWIASIUGQAVEAVBR03oZglhKU8VPK6aT4RW19/sMZPT05ryKRj8
a9IVZVZek+5bl3GnDK7E/wBE9HfLa+u15NPPt3fHsJlXTp47oP0q0j8sreLi/Jp5du/4dhJDqZbo
gcLh5YqcYR2ydkaYk2Og6brx0Pho0Ke2St2b32+9mJ5ejK9s0KCjbzC+dHMGsLTliJ5XTtyitr7f
1tMV6MJryKzjsY8fUc3v2LgtxqOWV2F4DCPHVFBb9r4LeCTYtenMWsJBUIZXWfJfn+tpmO2d14FS
iacBbdBYNUk608ssurezNdsJ6iH0hjHjZuW7YlyKxldgFOm6rUVm3sKzBbqkloejZec/W+Jjl39m
Cq31ndm3AP8AAYR4udvRW0lbxmxK6VxeovFR7fgSN530ECiuQm9FYPX+klsWwlrpjj6gGkcZ8plZ
eavXzLIzllsR4QWDR+GWHj4yeWWXJGa64zXkRWLxLxUr7tyNOduw12hBYsLQWAg5z2/rIzy6ydog
sRiHiZazNOVuw3trOy2hBZMPRjoym5y85/qyM8u0naK5XrSxcnJ7fYacrdhEaN3ba+ATQs9ClHRd
PWl5z/VkZ5d5O0VrFYl4luUv1+u00427DWzllvf62fEAtGDw0dFwdSp51u7kjPLrJ2isY7FSxste
WS3X2Jclv6zUcrdho1q8nzV32Ld29hUFs0Xo+OCj46qrS255tfm+XVtM11xx15Fe0npGWPnZ31di
hHb2v/XqLI55ZbES/q8fQhv63n7+wrItWhNDtWq1UlHbGK2db48r3M2uuOIi9PaW+WS1LvUT81bZ
PnuXJZviuFkZzy2K/U+jVpeQvqR859f57NyNOYntB6GljXrSjqUVu9KfJvbbjsT3Iza3hjsO9P6Y
dvE0GoQWUp7Fl6MbZu2+3sEjWeXuFKprb4qN2ts5Wsu/Jdt3wsacYJDRWivnSrZXqNZzm76q98nw
vZcmhbprHHYuOmdO0tAQVGnnO2SVlbm9y5K3YkYk27ZZdvgc3rudZXqvxcHnqrbLnba39qT7To81
G8DQq46Xi8JDVvk5vb2y3dUbO3EVZN8DodGjR6G0NmvWnuXnTlwXJfrNmOXfxhBzTSVZ4qo6uLnr
Tf8AZxeaXBvNRXLN8VfM3Hny88hrq1cZCy1aVBvmk365TffbkgnI6d0c6M0dDw8fUi3UtdOSzXVF
Xs3wzfPOyxbt6cMO3yKV0o05HSU/pXeEX5NGDy65yV1flG9lldO7esZpxzy3/YFalGrj4JycaVBP
L0YX5LNzfPynxdjTnz8BdOh/R2GMkq0YtUov95NeVNr6i2RXF5y4SWdsZV26eGxJ9MelVHDxeHhN
vdNU3m/suWyK42vJ7LJZtji11M9eByy9fSsXGCjToRedvJpr7zecnwu5Se7gb4ebzRJ6C0XHH1VS
wsfGTWcq04+RBcYwe3lrbfqraS1rHHfH4jrGkdKYbobQ1HO9WSvn5U5PZrNey7SVrLZY5ybem5TC
DieJ0xX0tUlDDxkpVPOa8qpP70uHJasEtx008lyt4DP5Lh9GfvmqtT+7g/JX3prb1Q/iQTUg1bE6
eW6NGHVClD3X75S5svB5y/fgJeLw+i/3CVWp/ezXkr7kHt653+6mOTcnAStH1cb+0Yuo4Qlnrzu5
T+5HbLryivrIbNb80alpdYZeLwcXTTyc3nVlfmvNT+rG3BuQ0d2uP6QpaIho9a2Mk4vaqMf3j+9u
gvveV9ljZ265CKmkK2k7YfDw1KbeVKmm9Z8ZPbJ83ktySLrRvfiA/wAiw+iM8Q1Vq/3UH5K+/Nf4
YdskN7XUx5AnUxPSKShFXjFZQilGEFx4RXGT7WycJ5yB74bQ/DEVv+UUX7Zvuj95Dk8Y/f8AkAQo
4rpHNzk9ZRXlTk1GEF15KK4JdiHCecg4+V4fQ+VBKtW/vZryIv7EHt+9Psihy1uQN8PgK+m5SrTl
5N/LrVH5K7d74RV3yLwklyDr5zo6Iywa1qm+vNZ/gjsj1u8vujW13rj8Q1weiquk71qktSnfyqtR
u1+W+UuSuxvSSbDuWl6ei04YJNS2OvLz391bILqvL7W4mtr3a4/ENcFoepjoutUkqdG+dWexveor
bKXJX52G2ZjsO6mmIaOTp4JOF8pVpfvJdW6C5Rz4yY013a4/ENcBoWeMj46pJUqKedSexvhFbZPk
u2w2kx2HdTTMNHxdPBRcLq0q0v3kuq3mLlHPi2NL3a4DTR+hZ46Lqzap0U/Kqz2dS3ylyV+wqTHY
eVNMw0cnTwKcb5SrS/eS6vqLks+LJpe7XH4hlo7Q1TSSdRtQpR86rPKK7d75K7ZbdJMdiRnpenop
OGBTUtkq8l5b+6vQXV5T3vcTle7XH4iO0domrpVtxsoRznUk7Rjzcvdm3wLazMdiUelKOhVq4Pyq
mx4iSz/5Bxfm/efldRNbb328fiInA6OraZm1BOT2yk3klvcpPJdbG9MSbE2sZh9AZYe1auttZryI
v/jcXtf2pdiJy3uY8c+8QtGhX0zVtFSqVZO73t8237XkjXDElyE5fDdH/q4jErtpQf8Anl/KuZnl
vxj99/gIKtXraXq60nKpUk7cW+SXsSNcMechPrAUNAZ4m1Wvuop+TH/eNf4V2szy6amPP4CF0hpK
rpWetUd7ZRSyUVwilkl1Fk0527EzR0NT0ZFVcc2rq8aC8+X3vqR5vN7kTbfbrn8BHaT0xU0laLtC
lHzKccox7N74t5ssiXLYd4DQevBV8TLxVDc7eVPlCO/r2IlqzH1o1pDTfjoeIw8fFUPqrbLnN73y
2LgJEuXpOADRehqmk7yuoUo+fUllGPxfBLNlt0mOOxJYjTNPR8XRwKcU1adZ+fPq+rHks3vZNN92
uPxFYNOY3YiBQBsKMKDLXIBaViAwA2UGBQpIA2RBgBsqjYAoiDYUYAbCjADLFQbsAKIDADAowAwA
2AbsQCrAGAGFBgBgBsA3YgNgGwDADADLAGACWgDQBoAS0AaKDRAJaKDQBqxAIaKDQAhqwAhoIENA
CGADasVAhoAG0ADaCAbAByKATQQCkgALRQCkACkEAmACZQCkABkEApAAmUCAAbAEMIEMAQygGAYE
GAGmrgCGrAGAGAGgDYBiQAsIP//X+jJ6XyX5VMAMZAaCDQAkKMKDADQQYQGgDADABLKo0EGAGAGE
BgBgAkIMANMqjQBgBhAaCDQBgBgBgBgBgAkqjQQYQGgDADADADADADAg0UGmgDQUaIDADADADADQ
QJYUaAMAMAMAMCDCg0AYAYAYAYAYAYAYAasAZYA0FGFBgBgBgBgBgBgBgBhAYAasEGWAMANAGAGA
GAGAGAGAGAGAGAGAGAGrAGgowAwAwAwINFBgBgQYAYAYAYAYFGiAwAwAwAwA1YA0AaKDAgwAwAwA
wAwAwAwAwA01cAQ1YAwAwAwAwAwAwAwAwAwAwA1YKElUYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYE
GrBQmxUGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACkRRsAwINlBgBsNDA
gURBgBtBRsqjABREGwDZFGFBtBAoijADABcQDYBtACwDYAtEBgApFAogMAFoKNhBgBsKMAFJhBsA
wAwAwAwA2FGAGAG0wBQQYAYAYAYAYAJuFGgDADQQYAYAYAYAYAYAYAJbAEgGAGAGAGgg0wBIUaCD
ABLChIQYAaYQIKowAwA0GRphRpACgBSAFgG0QCwoVEAWgAiCggARBQRAC4gBIkUFiAFiFBUAFQUF
QAVEAWIUFiAEiAFQUFQAVEUFiUBYkAWIUFQAVBQRABUFBUQBEFBUAFQARBQVABUFBYkUFiAEiFBo
gBEFBUAFRFBEALiAEiAEiFBIgC0AECjEAEAMANogFlBgBgBgBgAloihJUGAGAGAGAGAGggS0AJAE
MASwgGAIYAhgA5FQCkACkEA5BAJgCGEA2ADYQIaABtAA2VANgA2gBDAEMIBtACGECGADZQIYQIYA
hhAhgCGAIAEMIEMAQygQwBEkAIYQIABsAQ0ADaAENBAN5gA3mUA2ADYQDYANgAmADAENFQIYAhhA
MAQygQwNEhBogNNFUJCDQBpq5AasUCiA2UGwoURAoKFIAJEAXEKCIAWgAiACoDIsQoLEgCoKCoAK
gAsSALEKCxACoKDIAIiKHuDw0sXUjTjtk0l2hZNjpfSnER0XhYYanlrJL8Mdve/ec49HUupoc2id
HnHVMPH/AGbwOs/3klf8Uti7Pczny9U+zBzW+tm9pt5hfOiOAUVLET2K6j737u8zk79Oeor2lse9
I1pT3bI9S/VyxyyuwrReCekKsYLZtb4JbRVxmxaukuOVGMcPDLJXtuS2L9cjMdc76Cno04C+aJw8
dFUHWntav2bl2mb5ejGds2KlXrvEzc5bWacbdh5o3BvG1FHdtb5Eq4zYsGnMYqSVGGWWfVuRI6Z3
0FYNOQtehsIqEXWnlllyXEzXbCa8iHxuLeMm5bty5FjnbsBpQdR2WbZUFqk1omlZec/W+Jjl29mC
syk5O72mnAO8FhXipW3b2K3jNiX0liVRj4qGWWfJcCRvO68CANOIldG4Px71peavWzNdcZsb0ljP
HPUj5q282JDLLYiysCa0bhLfSS2bviSumM9Qzx+M+VSy81bPiWMZXYjysCf0dg1RXjJ7d3LmZrtj
NeRH4zEfKpX3LYv1+kVnK7DO/wCv1/oGRO4HCrDJ1amTt3L4ma64zXkQuPxjxcuS2L8viac7diPb
/X5/AMix6MwKw0fG1MsrrkuPWSuuM15ETpHHPGS4RWxPN93x7CyMZXYjHk96ffJ/D29ZWRY9DaN8
X9LNWW5b+tv3bORm11xxEXpfSTxstRN6i2RjtfX8M+osjGWWxCSy8l5X9GO19b/16kVgWDQ2iHX8
uolGmtkfrfe5cnv3IlrpjiEdINKeN+ijLVgtttsuzcuu1+YkM8hWc4K6+ji97zk+rf3WXFmnISmh
NF/L53inGmts35z5R3LszXElreGOxM6a006H7Phkm0vKluiuGeXW3l27MyN5ZekFEqOLl5TdWb3K
9uq+19SsuDZtwEjgdFVNLVFCcrJbYx9Fc90fXK+1byW6amOxc8fiaXRugqdLVi3svn222t+rjZGZ
5dreyDmqrSryboxbltlUla/Xn5MevNr6x0efYFSw8atRRjevVk9merfm9r57Fvu0Ek+Y6ZB0+itD
xlZ61R5WSS/DBZJLjx2vcc+Xp9ieRzrHaUxGm5ynFKENjleyS4OT/wAKtfg2b1p57lchDqdLDO1N
eNn9Zryb/Zjv/F/CVngdF0BoL5EvluOflpXipeguL58Fu69mLfc74Y680VbTmnsR0klKNK8MPHJt
vVT5yfPdH1NmpNOeWVy+AqzqUcD5i8bP60l5C6ovOXXKy+yac/EFt0D0Rr6cqKvjNZU1ufnS4JL0
Y92Wxb1m5adcencvNEn0o6STrXwOAWxWnKOSSW5PYkt7yS2Ek97WefpBzR08Po7zmq1T6qbVNdb2
y6o2X2mbefxPvEno7QuM6Wyj6NJbG1qwit+rFZd2/a95N6amNzHSdIY/D9AMMqFBKVeWxb2/rS5c
Fv2Le1iTuei2dOag5Ji8K5TdbH1Gpyd3BZ1H1rZBfezS2RaOjy2e8NvldbSH7PhaepB7YQzclxnL
a112ittkE3vxAjxGH0X+8ar1fqRf0a+9NZy6oZfbBqT7wnVxOn83aNKG92hSpr2LqV5Pmxwecv34
GPFYfRWVBKtVX9pNeQvuQe3rn/CgbkAo4CtpP9pxNTUpy/tKjbcuUFtl2ZLe0ODW/NG5aXho9auD
i4PY6srOo+rdBfd8r7TGju1wMp6G8SvG4ybpReajtqz6o7k/rSsuFy7O33jKul5Sj4jCw8VTlk1H
Oc/vS2v7qtHkNFy9wMtEU9GeVjJNS3UY28Y/vPZBdd5fZJs7dc/gA19JVtJ2w9GGpTb8mlTTzfF7
XN83flYaTe/AcfN1DRGeKevU/uYPZ9+ayX3Y3lxcRva6k5/ANq2MxGnZRowj5N/IpU1aK6kt/GTu
+LHBu5B38kw2hs67Vasv7KL8iL+3Nbfuw/i3F5XUnIa1MRiekVSMEnJrKFOCtGK5RWSXF9rY4Tdy
D3xGG0L+8tiKy9CL+ji/tSXnvlHL7T2E5Xxj9/5BlUrYnpFVUUnOWyMIqyiuCSyil2LiXhnzkH/i
sNoTz9XEV16Kf0UX9prz3yVo82TlrUx+/wDIR9SriekVVLyqk9kYpZJcEllFLsSHCechI+Jw2g/3
mriK69BP6KL+1Jee+UfJ4t7By14x+8R1bEYnpBVSetUm8oxiskuEYrJLqyLwzu5CS+S4bQede1eu
v7KL8iL+3Jec/sxy4y3E5a1MefIjMVjcRpypFSvKWyEIrJLhGKyS6i8MW9wllo6hoTPFfSVt1CLy
X+8kv8Mc+LRN7b1MefwEXj9J1tLySlsWUKcVaMeUYr/V8xrTNuxKx0RS0QlPGt6+1UIvyn99+guX
nckN7a7dc/gIzSWmamkrRdoUo+bTirRj2b3xbu3xEjNy2JDD6Djg4qrjZOnF5xpr95PqT81fal2J
ja9uuQDSGm5YuPiqcVSoLZTjs65PbJ832JCRLlsFwOg3OCr4iXiaG6TV5T5QjtfXsXEbWY+tG8Zp
xKDoYWPiqL253nP78v8AKvJXMaLl6QN9GaFqaRTm2qdGPnVZZRXJcXwSzFqY47ElV0xT0ZF0sCnG
6tKtL95Lq+pHks+LJrbXdrj8REaP0ZV0rPVpK9s5N5KK4ybyS6y70zJsTjxtDQGWGtVr76zXkxf/
ABuL2v7T7ETlrcx4594r8IVdJVLLWqVJvm22VnkWNYbD9Hc62rWxK2U73pwf22vOf2VlxZOW/GP3
0QOOx9XSc/GVZOUn6lwS2JckWRzt2Jyhoano2Kq45tXzjRXny+99SPN5vcibdJjrn8BHaT0zU0na
LtClHzKccox7N74t5ssjNy2IkrIVYiDdgo2UGAG0iAUQGFBsAywULSAMIgwoFBRuwBsiDYUbCjCo
N2AN2IDYBgBgUYAYAbANqIAqxAYUGAGAGAGwDdiA2AbAMAMANlUbsQG7BAmwUaCDTQAkA0AaaAEl
BogEtAGig0AJaIBLVygGAIaCBDRQDaCBDQANgA2EA2ACaKATQQCkACkUAmABkEApAAmACZQCkABk
EAgAbKBDCBDAEMoBsAQAaAMCDADTQAhqwBgBgBgAtBBsKP/Q+jJ6XyX5VMAMIDQQYAJYUaKDADQB
gQaIDADADTChJUGAGAGAGEBgBoA0EGACSqMAMANEBgQaAMAMAMAMAMYAkqjQQaIDADADADADADAD
Ag0UGmgDQUaIDADADADABDANAGAGAGAGAGAGAGAGBBooMAMAMAMAMAMAMAMAMsAasAasFGFBgBgB
gBgBgBgBgBgBhAasEGAGAGgDADADADADADADADADADLAGrAGgowAwAwAwA1YqDADAgwAwAwAwAwK
NEBgBgBgBqwBoA0UGBBgBgBgBgBgBgBgBgAloASAYAYAYAYAYAYAYAYAYAYFGrACSqMAMAMAMAMA
MAMAMAMAMAMAMAMAMAMAMANWANWKg0AYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAY
FC0QGAGyoMAMANhobREGwgwA2go2VRsINkQbQUbIowoNoIFEUYAYALiAbANgCwDABaIDYBtFAsgM
AFoqjZEGAGAGwowAUgg2AYAYAYAYAYFGwDADaYAoIMAMANXChIBgBgBoIMAMAMAMAMAMAMAEthAk
KMAMAMAMANBAgKMANBBgAhhRoIMAEyKgSFGAGggwIEsKNBQsINhQtBBsighUCokULQAQKCABEFC4
gBIhQSJAFiAFiFBUAFQUFQAVEASIUFiAFiAFiFBUAFRFBUAFQAWIUEiAFiFBUAEQAVEUFQUEQAVA
BUFBUFBUAFiRQSIAWIUFiAFQUFQAVEULQASIASIASIUEiALQAQKMQAQAwAUiAUUGAGAGAGAGACWi
KElQYAYAYAYAaCDABDAEMASEA3kFCGECGADZUAmACkEA2EA2ADYQDYAhhAhgA2ADYQDZQDYANgCW
ggG0ADAEMIEMAQEAygSwgQADAENBAloAQwBDAEMAQUA2rACGggQ0ADaAEMAGwgGwAbVgAbRQDYAN
hAOSAByABtACGVAhgA2AIaCBDABsDUJKDQQaIDTRVCQg0QGAGFAoKFEQbCjZQLRALQDYiCpsRANl
oCCIAJEANEKCogCIKDIALEALEigsQAqACoKCoAKiKL/0F0f42pKu1lBWj1vb3L2mcq79KeohekOk
PnLESkn5K8mPUvi7ssmmM7uhz0Z0d84YiN15MPKl2bF3+q5KYTdEt0w0h4+qqK82G37z+C95MY31
LsVnC4eWKnGnHbJpI05SbHQ9P146Jw0cPT2yVuxbX2+9mJ5ejO9s0Ofo2846JoLDx0Xh5V57ZK/Z
uXb8DF8vRhO2bFLxFeWKm5y2ydzTjbsSug9H/Lqqv5sc5e5dvsJa1hjsSvSLH+NmqUdkdvX+Qkb6
l9BXI5lchesLTWhaDnLz3m+vcv1zMcvRPswVCdR1pOUs282bcKJDRmC+Wzt6KzZK1jNiX01jLfRR
2Lb7kSN530FfRpyFn0RhVQi608ssuS4ma7YTXkROLxTxc9bduXIsc8rsBhB1GktrCCzZaKpcZP1v
4Izy7ezBXJSc3d7WbcQ4wuHeJlqrtfIiybEzj8QsLFU4ZO3cjMdcrrwK8achIYDB/KXd+atvwJWs
ZsOtJ4y/0cdi2/ARrK+gh1FyK5CV0fgfGPWlsXrJa6Y4jekcZ416kdi9f5fq4hldiJv+v1+fWVzE
ro3Ba/lzWW7nz/1Ja6Y4hvpLH/KHqxfkr1sSJllsRMlxyX62Lf1lYE3ovR+u/GTWS2X39m5Etdcc
QDSmkHXlqRfkrhtb93t5CRMstiE2ZbOSzb63+uormJnROjHW8uVlBblv63w5eolrpjiE6a0kqz8V
F+TvUdrfDku98hIZ5bFdm/Fqz8lfVXnPrfx7jTkJfROipYt3a1Ka2/Wlyvt69i5Etbxx2HmnNJOm
vFU2oRWTl7opZ9bWW66JI1lkKjBZXgst85e7cvW+BtyD/RejvnGpleVvOm9nYt76+1Et0uOOxY9M
6ahouPiKSvO1rLd+fV6sjMm3XLLXgUSunb6WWqvqR29q3PnLyus24X7w4wOCraRepQjqQe2W9rfd
7XzSsuQqyb4F0rTh0aoqlRjrVZK6XHjKXBL8uLMcu3scDm+JqRcnOtLxtR7Unl2y39UcrbJHR579
4X8mq4xxhPyIt+TTSzfVH/NK1/rENbHR9H6Mo9HKTqW8u2bbV+q7sku5cTFu3omPaOb6X0rHGVHU
qfSy9GKuqcVw3OXPYr8UbkefLLYj69GdW0sTLUil5MbZ2+zBWSXN6qfMqX7x0boxoWOCj8onFU1a
61s5W4yb2dSsrbbvZi16MMdeRWelHSWnjpai+khF5RV1BvjJ7ZckrJfWZZHLPPYqlSlVxqU68lTp
ejdWVvsQW3rStxZtzvnkWnopoVaQlr04uFGLzqy8+T4R3QXFrNbNbhnKumGOxO9KelFDAQeGpSba
ykoZNctbZHna8t2W0zjG885PA5ZrV9KxcKaVOjHal5MFzlJ7Xw1m3w4HTh5/ND/Q2i4YyqqWHiq1
TfUkn4uC4qO2XLWsns1WS1ccd8efyHXMbjaPROhaVReMa2yzlJ8dVbluirRWy62nPl6reyDiWL09
OvUcqCl4ybzqvOrK/C2UFwUc0stZo66eS5b4/pDOWjIYHysXJqW3xUXeo/vPZDtvL7I2mtchHyuv
pT9nw0NSD/s4b7b5y2vrk7LckOE3vxAnxGG0X+9ar1fqRf0a+9NZy6oZfbHJqT7wh/KukL3KnDqh
Spr1RXtfNjg85fvwN+Pw2if3aVer9eS+jX3YvOXXKy+yOTxPvAY4PEabbr1p2hsdWo7RXJceUYp2
4JF4NXLyCfOVHReWEjrT/vppX/BHNR63eXNDRvXH4hFHRVTGL5RiJ+Lpyd/GTu5S+6vOm+ezi0Nm
t+aCy0zDAJwwcXT3OrLOo+p7ILlHPjJk0d2uP6QihoVqKrYqXiabzV1ec/uw2v7ztHmNkx943W03
4iLpYSPiYPJyvepNfaluX2Y2XG40d3uCqOg1h4qpi5eJg81G16k19mO5falZcLjazHXITidNvUdH
DR8TSeTSd5z+/La+pWjyLouXuBaOg1hYqpjJOlF5xglepJco+ivtSsuCZNnbrn+kDxem3ODo4eKo
0XtjF3lL78tsurKPBDTNy9wNR0GsLFVMZJ0oNXjBK9Sa5R9FfalZcExtZjrn+kCxmm3ODo0IqjRe
2MX5Uvvy2y6sorchpbl7gXD6DVGKq4uXiabzjG16k/ux3L7UrLrGyY+8IxenG4Ojh4+Jovak7yn9
+W19WUVwLIXL3DeE0E9RVsTLxNF7G1ec/uR2vrdoriNkx94XidNqnB0cJHxNJ5Sd71J/flw+yrR6
yaS5e4DwGg5YiHjqslRof3kt/KEdsn1ZcWhaTHYc1tNxwUXSwUXTi1aVR/vJ9q81fZj2tjS92uAz
0doWppFOpdQpR86rPKK5c3yV2LUmOxIS0vS0SnDBJ62x15Ly39xegufnc0Nba7tcfiIvAaMraYm9
RXtnOcnaMVxlJ5L2sb0zJsS/y7D6Byw1qtdba0l5MX/xuL/xS7EhrbW5jx+Ih6FGvpqraKlVqyd3
vb5t+95IvDHnITurhuj/AJ2riMQt22lB8/rvl5vWZ5b8Y/ff4CCxWLraXqa03KpUlkt/Ukl6kjXD
FuxOx0XR0L5WM8urtVCLz/5CSXm/dXldRne2+2Y8/gIvSWlqulGtdpQjlCEVaEVwS9+18SyM3LYk
MLoOOHgq2Mk6VN5xgv3k/urcvtPLrG2pjrzQDSOm5YqHiaUVSoLZTjv5ze2T68uCEiXLfgJ0ZoSe
Pi6kmqdCPnVZbOpb5PkvULSY7D+vpqGBi6OCThF5Sqv95Pt9GPJdrJpblrgRGj9G1dKT1KUdZ7W9
yXFvYlzZeGJNif8AldDo9lh7VsRvrNXhB/8AG09r+0+xE5dNzHjkVetWliJOc25Sbu23dsrG9gdi
oFEQbCjZQYAKSIDZAYUGyg2kRQoiDADZVGwDdgDZEGwo2FGFQKsQGwDAowAwAwA2Ab1QBSVgDADA
DADADYBuxAbANgGAGFBsA2RRuwQbAMANWANBQkINWAEhRoINNACSg0QGmgoSVBoAQwBEkAIaCBDA
BsAG0VAhoAG0EA2ACZQCYQCYAKQAGRQCkgAMggFIoBMAEwAMggEygRIAQwAbCBDKAbAEgCbAGgDA
gwA0wBGwAwAUkECgowA//9H6MnpfJflUwAwA0yAwINACQowoMANBBhAaAMAMAEtFUaCDADADCAwA
wASEGAGmVRoAwAwA0QGBBoAwAwAwAwA0yqNAGgg0QGAGAGAGAGAGAGBBooNNAGgo0QGAGAGACZAC
SgwgMAMAMAMAMAMAMAMAMAMCDRQYAYAYAYAYAYAYAYAYAasAZYA0FGFBgBgBgBgBgBgBgBgBqxEG
AGAGAGgDADADADADADADADADLAGrAGgowAwAwAwqDQBgQYAYAYAYAYAYFGiAwAwA1YA0AaKDAgwA
wAwAwAwAwAwA01cAS1YA0AYAYAYAYAYAYAYAYAYAYFCWgDRVGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGWAE2CDRQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYFCyAwA2VBgBgUbChSIgwIM
ANoKNlUbREGwg2go2RRhQbQQKIowAwAVEAUAYAERAYUCogCiA2UCyAwAUiqFEQYAYAYAbCjYAoIM
AMAMAMAMAMANhRgBtMA3cA0AaAMANBBgBgBgBgBgBgBgBgAlsIEhRgBgBgBgBoINMASFGAGgg0wB
ABgBgAMoMAMANBkaAEhoYALDI2GgtBBsihaKgUiKCIAWgAiCgiCgiAFoALEigsQAkQoLEAKgoKgA
qIAqCgsQAsQAsQoKgAiCgyIAqACRCgsQAsQAsQoJEAKiKCoKCIAKgAqCgiCgqACoigsQAsQoLEAL
EKCIAKiKCIAJEAJEAJEKFoAIgBYUbQQECjABSIBRQYAYAYAYAYAYAIaIo0VBgBgBgBgBoIEsAQwB
DAEyCBDABgA2ADZUAmEAmADYQDYANhAhgCAgGwAbABsqAbAENACAAbCBDAEMIEMAGygQwgQwgQwB
EgBDAEACGECGAIZQIYAiQAhhANgCGADaAEMAHIIByABsoBsAGwgG0ACYAhgAwgQygQwBDCAbABso
RqxEaJKo0EGiA00UCQDQDbYDZSRFTZQQ22VU22kQCwBaCgiACIAWgAiACRACxCgqIAqADRCgsQAs
SKCoAKgAqCgiACoijrk/+Rc0dbZUkv5pfBew5816vZg5ajo8o6loCktC4KWIms5LW7NkV2+853y9
WH2Zsc6qVXXk5Szcm2+tm3mF56H6Pu5V5bFlHr3v3drM2u/TnqIHTGP+ca0p+jsj1L9X7Sxzyuwv
Q2A+ca0Yeis5dS/VhauM2LJ0px+caEdizl7l7+4kdOpfQVGKuacR0KlFaBwt357/AMT2Ls9zMcvR
7MFHcnN3ebe004Cw9H8B8pnry82Prf6zJXTCbCtN475VU1V5scut72IZ3YiIR1nZbSsC6RS0NQ+2
/W/gjHLv7MFTlJzd3m2bcBJaMwfyuefmrN/AlaxmxJaXxl/oo7Ft+BJG876CCRpyFk0XhVRj42eW
WXJcTNdsJryIrGYp4uV925FYt2ARi5ZLaysiywjHRdO785+tmOXb2YK7ObqNt7WacguhReIkooLJ
sT+IqLAwUIbf1mZdb4ECopbTTkHeFw7xMrbltIsmxIY/EqivFwyfuJG8rrwICX6/Ww05B5gcJ8ql
n5q2vjyJWscdh7pLF6i8VHJb/gl+luEayvoIFqz5977t3tK5h/gMC8TK7yitu9vlf22JWsZsOdKY
5fuodTUfZy/SEjWWXoK+8suPox2vrf8Ar1IrmJDR+jnjHn5MFtS38m/1bkTbWOOw90xpCNGPiYO2
5229XLn7BI1ll6CsS+jWfkLhtk/12I05B7o3R8sZJaq1Ib5Pzuz8u9k21jjsTWlcf8ih4mhZWyct
0e3i+/tJI3ldeIKXlN+SnUnxd7dfF9bsuKNOId4PAPSVRRk9ZrbbzYrr2dkdvFDelk2LXpDHUtBU
/FQtGVskld9fX1+u1jMm3a3tFD151Lyh5EXe85PN8fK2vqiuw284HhaKrTVOjHXm/Skslztw5yv1
XBJvgXytXp9GKN5PXqy47ZP3RXq6zHLvvsgoWNxFbSHl1pKEJZ22X6o7Zcm8lsujfDhbbyGdBuct
TDQbl9Z5y7N0evavrFSfcL9o3RtPo1SlicS71Xte219y4t737jFu3fHHs80UnS2LraYl4ytLxdL0
Ivhyjtb55LmjU8OOV7uRF0qzUtTCwet9d5z61uj2Zr6xWZfcLr0e6KLDv5Vimnbykm7pfak9j48N
9zFydsOnrzRFdI9L1NPeTTfi8LF+fLJSa9b5RSb3tcLJpnPLu+AqHymnhXahHXn9eSv/AAwzXa7v
kjbjvXAsuheiFbTNTxuKk1G/lJu83yfDnfNcMzNy0649Pu5E90i066K+Q4BeVFWlKOSguF9ifFvZ
xvszJ7288vSDmDp4fAee/HVPqxbUF1y2y6o2X2mdHn8QPcFozGdKpKMVamtjtq048bJZX42u3v4k
3pZjcx0nF4vDeD7CqnTSlWkrq+2T+tLhFbl2LezHtPRbOnByfEYWrjZPEY2pqa+eavOS+zDLLg3q
x4M6PNZvzQ2+c3T+jwcHTvlredVlf7W6/CKXO40nd7v6Ql6Mp6Pzxcmpf3UGnP8AE81DtvL7I2du
ufwA3jK+lP2fDw1YP+zpp523ye2XXJ2XJDhN2+INfJcPovOs1Wqf3cH5C+9NbeqH8SHJqTkIdTFd
IWoQXkQzUI2jTguL2Jc5Sd3vbHB5yG/2XRPDEVe1Uov1Of8ALH7yHJ4n3/kAqliukcnOTvGCzlK0
acFw3RiuCW3cmXg85AqxGG0R+6Sr1f7ya+ji/swfndc8vsjldzH7wKnhMTp+Uq05eSvOq1HaMeV/
ZGN3wROE1cg4+X4fRGWGj4yr/fTWS+5B5fild8kOTcnH4hvh9H4jTTlXqStC/l1qj8m/W82+Su+Q
3okuXkOvnKhojLCR16n9/NZr7kM1Hrd5fdGl3rj8Q1wujK+l3KtOVoX8utUfk363nJ8ld8i70kmw
8+c6OiMsItap/fzWf4I5qPW7y6icr3a4/ENMJoyvphyqydoX8urUdop8282+Su3wG9MzG5B785UN
D5YRa9T+/mtn3IPKPXK8uoctbmPH4hjhNHV9NylUvdLOdWbtFc5Se/lm3uQ3pJLkJD5fh9C5YZeN
q/301kvuQf8Aild8EhrbW5jx+IjsNg8Rp+pKSvOW2c5PJLjKTyS6y8MyXISfj8NoP91avXX9pJfR
xf2Yvzn9qWXCJOV3MfvEbCniekFbLWq1ZbXty5vYkuxIvDPnISurhdBbdXE11u/soPn9d90esnLf
jH7/AMhE18TiNO1Vra1So8opL1RS2LkshwzbchL/ACDD6DzxLVWsv7GL8mL/AOOTX+GOfFonLWpj
z+AidIaUraWktd5LKEIq0Y8oxWz2vmakZuWxKw0LT0WlPHNxe2NCP7x/e+ouvyuCJvbXbrn8Aw0j
pqpj4qnFKnRj5tKGUet75Pm7vqLJpm5bDrB6BtBV8VLxNF7Mrzn9yO/7ztFcSbWY+tG8ZpzyHQw0
fE0XtSd5z+/Lf1K0VwGi5ekDbRuhamkU53UKMfOqSyiuXN8ErsWpMdiTnpilopOngU03lKvJeW/u
r0F1eVxZNba7tcfiIfA6PraVnqUouUtre5cW28kubLwxJsTvj8N0f/d6tfEL02r04P7KfnPm8uCZ
OW9zH76K/VrVdJ1NaTlUqTfW2/1sRpjkWGOjKGg1rYzy6u6hF7P95JbPurPqM726dsx5/ARGktLV
dKyTqNKMcowirRiuEVu9pZGMstiRwWg1GCr4uXiqL8368/uR/wAzyXMm2pj60D0hpx14eIoR8TQ+
otsuc5bZP1LgXRcvScCBKwNpEAoINhRsoMAFJEBsgNlBgBtIKFEQYAbsVRsA2kAbIg2FGwDdig2k
QGwowAwAwA2Ab1QBQBgBgBgBgBsA3YgNgGwDADCg2AYFG7EAoIMAMANkUYAasVAkKE2CDQAkKMCB
LQBoKElQaaIoSVAloAQwAYAhhAhooBsIBsAGwAbCAbQAKRQCYQBaAAsoBSABNBAFlAOQAFgApBAF
lAhgCAAYANhAhlAkINACWgo0EGAGACWgg0kFCgDYBgB//9L6MnpfJflUwAwAwgNBBgAlhRooMANB
BhAaAMAMAMYUIKgwAwAwAwgMANAGggwASVRgBgBhAaANBBgBgBgBgBgBpooNBRoINEBgBgBgBgBg
BgBoIMKDTQBoijQBgBgBqRQJKDADCA0AYAYQGAGAGAGAGAGAGAGAGBBgBooMAMAMAMAMAMAMAMAM
sAasAZYA0FGFBgBgBgBgBgBgBgBgQasAYQGAGAGgDADADADADADADADLAGrAGgowAwAwA1YqDADA
gwAwAwAwAwAwijQBgBqwBoqjQQYEGAGAGAGAGAGAGgBLQUaAMCDADADADADADADADADABLQUaKow
AwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAS0VBoAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAw
A2goUQGAGyoMAMCjYUKIgwIMAFIqjAoUiIMCDYUbIowoFBBsijADABUQBQBgAtEBsoFIAUQGygWi
AwA2gBYBgBgBgBgBsKNpgCggwAwAwAwAwAwA2FGAGAGAGAGggwAwAwAwAwAwAwAwAS2AJAMAMAMA
MANBBhQIIowA0EGACWFCQgwA0wBBQYAaCDAgSwo0FGACkECgBSAFEULRUCkRQsAIgAiCgkQAiCha
ACIigqACxCgsQAqCgqACogCoKCoALEAJEKCoAKgoKgAqIAqCgsQAsQAkQoLEALEigiCgqACoAIgo
KgoKiAKgoKgAsQoLEAJEKCxACoigiACRACRAFxCgiACIAWFCkECwowAUiAUUGAGAGAGAGAGAGrAC
WiA0UGAGAGAGgg0wBDAEMAS1cIEAA2AIYQCkUApBAOQAJhAhgA2EA2AIYQIYANgA2EA2AIZQDasA
IYQIYAMIENACGAICAbKBLCBAANgCGAJYQIYAhgCGgAbKBAANhAhgCGADYANhAgAGUA2ADYQCYANg
A2AIYQIZQDYAhgA2ECGAICLtgDZJVTbQQ20QGmigSAKSCjZECiqNpACiAUgBaCgiACIAIgBaACRA
CoKCogCxACxCgsQAyIoIgAyCgiACogLF0ZwHzjiYRfmx8qXUvi7LtJXTCbosPTjH+OqxorZBXfW/
y9pnFvq30Fa0TgXpGtCkvSefUs36jVc8Zui79M8aqcYYeOS85rkskv1yM4u/UvoKLSpurJRjm20k
ubNOEHS9L1FoTBxoxflSWr/wn+uJieXoy+zNDnSNvOOj6Dox0ThpV57ZK/ZuXb7zF8vRhO2bFGrV
niZuctsm2zThbsWHo3gPlVXXfmwz7d3xJa6dObCukGP+V1dRebDLt3/AQzuxEUabrSUY5tuyKwLz
i6i0Nh1Tj5zyXXvf65GeXe/ZgpaNOAs2gMDrvxsti2dfHsM12wgaaUxvyypl5qyXxLGcrsMYQdRp
LNvYViC3ya0RRsvOfrf5GOXf2YKtfWze024CR0dhPlU8/NW34EreM2H+lsXf6OOxbfgSNZ30EIiu
YsOjMKqa8bLs6uJK64T1EbjMU8VK+5bCxjK7AI03IILFQpR0dDWfnP8AVjPLtJ2iFq1XVes/1+v0
jTlsapwdVqK2v9frYCCcqTWjqdltft4meXW3tFelLWze/wDXWzTgCUMM8RLVX+nYGpNiaxNdYGGp
C+tbt6zLpboVxevlm+1mnIGwuGeJlqrJb7cOb/17AsmxMY3FRwMVSpp61ti3fmZdLdeBWZPdx9GP
vf8Ar2GnIOMJg5YuWp5q3pcOb93qCybE1j8XDRlPxUHZ23Ztc+vrMx0t0KpnFXXkJ735z6t/dZcW
bcQTBYSWLlamuucls7NntfMiybFlx2LWi4KlSWtUfb1yf69RJ5dbe0UqvPXd6knOXBPLv9y7zUcA
ahg6mNkqbtBP0V7WvfJ34XG1k2LhU8X0fo2hbWe+T2vi/gs+C2meXb2YKBOr46bcU6tST2tZdkfj
lbcjTgE+IeImlNupN5KEXfsb2JdV7ciprYv9GNLo7R1p6sW+G98Ftb63fsWSxy9E+xBQcXpGekKr
lTi5TfpNXsuSzUVzd3vub04XLYjqkIQlepJ1Kjfmxd8+ct/4b9aDI6HonBLRFJ18RaFldRWSiva5
c3d7jF8vRjO3zRTtL9IJaWqJUYNtebdazXVHYnzzfBo1Jpxyz7hBVaMaTcsRNym9sYu7/FLNLs1n
yRpj4i69HNEPFR8dWSp0FnGmslK3pTbza4XfctuLXbDHfwDDpJ0vhifoqMdaKebfmt9W9cL5cnkW
Ys59TfAqNfDTqtVMVPUVsk85tfZhuXC+rHgacte8T3RzRstKztQi6VGPn1Ns5clLdffq2stt8ry3
TphjvgWfT/STD6Ep/JqN9ZK1oO2quDlnZ8bXfU8zMm3TPOY+By7Xr6WTjBKFJZtLyYLnJva+cm3w
OnDzeaHOi9HQxFVUqEfH1Xtk01Sjzttklxdlu1WS1ZN8efyHXa1an0Ww95zi5tedLK75RXordGK9
7OfL129kHFsfp9TqSqU05VZPOtNJy/BHOMFw2tbmjrp47l/WGT0ZL97jJumpZ5+VUl1R29smlzY2
nb7/AOkDelXT+jwkHTTyus6kr8Zbr8I2XG40d3u/pGnoqGA8rFycX/dRs6j+9uh23l9kbO3XIFPS
NXHfs+GhqQl/Z0025fefnS7cluSCb34gz5voaLzxMtep/c02svvzzS6o3f3QupOQKeLxGm2qFKNo
bY0qatFc3xfGUm3zHCbuXgL+S4bRP75qvV/u4PyF96a29UP4hyupACdfFdIpKlBXUfNpwVoRXG2x
c5PPiy8Ju5A/icLoj941iKq9CL+ii/tSWc+qNl9pk5PE+8N5VcV0jmoRTlqryYRSUILklaMVxeXN
jhPOQdeKwuh/PaxFZeim/FRfN5OfUrR5sctak+/8g1lVxXSOoopObS8mMVaMVyStGK55LiXhPOQe
eJwuhvPaxFb6sX9FF85LOfVG0ftMnK+Mfv8AyDSpXxXSKooJOctkYRVoxXKKyiu7mOGd3IPvk2G0
NnWar1l/Zxf0cX9qa87qjl9octak+8McRjMRp6cYWcnshTgrRXKMVkv1ccJbchIfIMPobPEvxtX+
5g8l9+a/wxu+aHLWpOfwEfjdJ19MOMPRWUKUFaK+7Fb+ebfEsmmbdiRWiKWifKxsvL3UIPyvxyzU
FyzlyRN7XWufwDHH6ZqY+KppKnRT8mlDKPW98nzd2NM3LYfUtBxwUVUxsnTi1eNNZ1ZdnornLsTG
2pjrkN8bpyVaHiaMVRofUjtlznLbJ9eXBIaLkFYLQTqQVbESVGg9kpLypcoR2y68kuI2TH3guI06
sPF0sHF0qbylO96k/vS3L7MbLrGi5a4DPR2haukU55QpR86pN2iu3e+Suy70kx2JJ6Wo6HWrgk3P
Y8RJeV+CPoLnnLmia3y13a4/EROC0fW0xUagnOTzk28lxcpPYubLbpiTYm/G4XQPmauIrr0mvooP
7K9N835PJmeW/GP33+Ag61etpireTlUqyduLfJL3I1wxu0Tq0dQ0Hni34ytuoReS/wB5JbPuxz4t
Gd7b1MefwETpHS1XSjWu0ox82EVaEVwUf0+ZZGblsSWF0FGhBVsZJ0qbzjFfvJ/djuX2nl1jbUx9
aA4/Trrw8TRiqND6kdsuc5bZP1LgNJcvSAWjNCVNJJzyhSj51SWUV8XwSzFqY47ElU0xS0UnTwKa
bVpV5Ly5fdXoLq8rmTTfdrj8RB4PBVdJVFClFznLcva/e2Vzk2LFbDdHvq4jErtpQf8Anf8AKudi
cunjH77/AAFexuNqaRm6lWTlJ73+slyWRWLdhoVApIgNhAoqjADLEAtKxAYUGwDABSQUbIgwoN2C
jYAqwBhEGwo2UG7ACiAwKMANgGWKBWqQGwDADADADYBgBuxAbsAbAMKDADYBgUbsQCggwAwA2FGw
DLAGNAGgDTQQJCjVgBNgg0FGggS0AaCjRUCWiKEsqAbAESQAhoIEMAGygG0EA2ADYQDYAFooBMIB
SAAsoBSAAyCATAAsoBSABMIAgCCgQwAbABsIEMoEAGBBgAhoKNBBgBoAwINhRgAqwB//0/oyel8l
+VTADADADRAYEGgBJVGAGMA0EGEBoAwAwA00AJKDADADCAwAwA0EGgDGgBJVGAGAGEBoA0EGAGAG
AGAGAGmig0FGgg0QGAGAGAGAGAGAGggwoNNAGiKNAGAGMATYqDQUYUGAGAGAGEBgBoAwgMAMAMAM
AMAMAMAMAMAMCDRQYAYAYAYAYAYAYAYAYAasAZYA0FGFBgBgBgBgBgBgBgBoIMAMIDADQBgBgBgB
gBgBgBgBlgDVgDQUYAYAYVBoAwIMAMAMAMAMANEUYAaYBoqjQQYEGAGAGAGAGAGAGmFCQoywQaAM
CDADADADADADADADADTQUJKowAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwA1YINWKDQBgBgBgBg
BgBgBgBgBgBgBgBgBgBgBgBgApEUbAMANlQYAYgoUiA2EGAGACitDABREGBBsjQ2AYaAoiDZFGAG
AC4gGwDADYApMAUgBZAbKBSIDYBgAQAwAwAwAwAwA2FCkwDYQYAYAYAYAYAYAbCjADQQYAYAYAYA
YAYAYAYAYAJbAEgGAGAGAGAGAGioNMgEhRgBoIMAEMKNBBgAiRUGgowA0EGmAJCjADAgUgDYAtAC
iKFIqBSIoIAEQARBQuIARBQQKCIgCoALEKCxACxACIKCogCoKCoALEALEKCxACoKCogCoAKgoLEA
JEALEKCxACRIoLEKCIALEKCoAIgoKiAMgoIgAqCgsQAsQoLEALEigkQBcQAkQAkQoIgAiAFgCkAL
CjABSIBRQYAYAYAYAYAYAYAYAIasAaAMAMAMANMIBgCWAJCAbyChEggQwAbKgEwATCAbCAbABsIE
MAQwgGwAbABsAGyoEMAQyAQyoBsAGwBLCAbAEMqBDQAhhAhgCJACGAIAEMIEtAA2UCGgAbQAhhAh
gA2AIYANgA2EA5AA5IoBtAA2EA5AApIAQ0ECAAbKBDCBEgAbAElAkiDABLKo0EGiA1YA2AbRVGwB
aIDABSCgkQAiAFoAIgAiACIAKgoKiALEKCxACoAKiKCoAKgoLEALEgOpdCMKsJQqYmeSd8/sxzb7
/YYyenpTU2KBjMU8bUlUltk2+824W7F96EYJQU8RL7qfrb9nrMZO/SnqKjpPGvSNadTi8upZL1Go
5ZXYsfQ/AfKKzqvZTWX3ns9/qM2unTmw16R4/wCXYh282Hkrs2vv9xYznd0NtEYH5xrRhu2y6lt+
AqYzYtPSvHW1aEdizl7l7+4kdepfQU6EXJ2W004jotRrQOEsvPf+J7X2e5GOXo9mChrM084t/RvA
7a8tiyj737u8za74T1ETpLG/Lqjl6Kyj1FjnldgWEw7xU1CO1lSTYtmla6wFJUYbWrdm/v8AiZjt
ldTQqaNOIs+hMHqp1pbFs97M11wnqI3SGL+WTb3LJdRYxldhvSg6jSW1lQWmpJaKpaq85+3iY5dr
9mCst3zNOAf6PwnyqWfmrb8BXTGbEnpKvf6OOSW34EjWd9BEpKP6/XwK5iY0fh/7SWzd8TNdcYGW
MxXyiWXmrYWM5XYZ3/X69xWRPYWisFBzltf6t1mXWTQhq9V4iTb28Fn/AKGnK3YRCLk7Lby294QT
0IrR1O9vKft+Bnl29kV+rUddtvNvbbJdr/XWacb5CKcHWeqs3wWztf66wciwSlHRdNJK8nuW9/Az
y7eyKzVqOo3rO7e6O/rf+ppxG6dCVaSgvJvuW3t/PuCybFiqSp6Gp2W19rb4/qxnl19kVOU3Ubmt
7znL3fldo04hFKl8olqwTnN73s6/zfcVJ5FrrVo6EpJedN7Ob9yXAxy7b7RT8VVnWbdaWrfPVW3u
/wCFmbjjfPIRh6VTENRox1U3bWe19v8AwdwJ54FuoUIdH6V7a9SXDbJ8FyX5meXaTtFIxtXx83Ov
LWk/Ri9nK+xdlzUcLd8gap1K6SVqcJbFn5XtlL1rqALvo7RdPQcHUacptdvUl7fbYzbt2xx7RSdK
4xYypr1paz9GEXklwctnXa9+KNRxyu+QxkqmIjnalS7k/a5PvtyKnIvGgtA0sDFV5puW1ayzXPVW
x8Fm+p5GLXbDDXkVvpDpJY+f0smqcfNpxzk+cnsT72tljUjnnlsQEZ1cUnGlFU6fpNZL8Unt6r24
I0xyLX0c6MUq301Ty4rZui+pPNrm7J7LMza64YDfSfSrxa8VGSp0N8ntnyjHa488k+NtskM8tijR
xapNRwsHrPZNq831LZHsz+0bcN+4TWhuictKzbrTtZ+UlnLqb2J8s3xSJctOmPT3yLXprSvzXD5H
gY+Wlm1spri28k+beW1mZNumWWvEHLpxoYJ3m/H1OCbUE+ctsuyy+0zo83ifeDYXA4vpNJRgvITs
vRpx6ksuu15PmS+FkuY6TOWG6AYay8utLvm/dFfq7Zj2no8dODleKpV9MyeJxU1CMtkp71whHa11
ZcWjpw813l5oa/OdPAZYWNpf3s7Of4Vsh2Xl9oaTeuAj5ql+9xc/FqWeflVJc1Hb2ysubGzt94RP
S/yfyMJHxaeWttqS/FuvwjbncaO73BPzPHCLWxknT3qms6j7NkeuVnwTG07dc/0gVXS05rxOFh4q
EsrRznP70tr6laP2RouXuG/mino7ysZLVf8Acws6j+9uh23l9kbXt1yA1tLVMWvEYeHi6csvFwu3
L7z86b68uCQ0ly34gJ800tGZ4yXlf3MGnP8AE81D1y+yNr265/AN8RparjkqFGPi6TeVKmn5T3az
86b678khpm5b8BwtE0tF54yXlf3MGnP8TzUPXL7KG17dc/gG+K0vVxy8RSiqdJvKlTTze7WfnTfX
fkkNHdsOloanozysbJxluows6j+89kO28vsl2vbrn8A3xemp4mPiaUVSov8As4b/ALz2zfX2JE0z
cthzDQkcAlPGydO+apRzqy7NkFzlnwTG17dc/wBIDi9OSqQdGhFUaL2xjtl9+W2XVs4JDRcvkC0N
BeJiquLl4mm81G16k19mHD7UrLrG17feNYjTvi4ulhY+JpvJtO9Sf3p7fwq0eTGi5e4IwWgpVoKt
WkqNHdOW2X3I7ZPqy4tF2kxDmem4YBOngoumnk6ss6su3ZBco58WyaXu1x/SGmj9DVdJJ1MoUl51
WbtFdu98ldi1JjsSD0pQ0Plg1rVN9eaz/BHZHrd5dRNba3MePxEXhMDX03UeqnOW2c5PJc5SeS62
XhmS5CW8dhdB/u7YiuvTa+ii/sp+e+btHkxy14x+/wDIQ9SriNOVs9arVlkt76kty5LJF4Y85Ca+
QYfQeeJarVv7mL8mL+3Nbfux7Wib23qY8/gIrSGlKulWtd+THKMIq0YrhGKyXtZeGblsSlLQcMBF
VMdJ001eNJfvJdnornLsTJtrt1z/AEhrpDTk8VDxNKKpUFspx385PbJ832JCRLlsZo/QU8XDx1SS
pUFtqS38orbJ8l3oWkx2HVbTkMBF0sDFwTVpVX+8l2+iuUe1jS92uBF6N0XV0rJxpRvbOUnlGK4y
byS6xbpmTYnflOG0BlRtXrr+0a+ji/sRfnP7Ty3pE5a3MePNFeq1quk6mtJyqVJvm23+txpjkWGO
i6Gg/Kxnl1d1CL2f7yS837qz6jO9unbMefwEVpLS9XSrSm0oR8yEVaEVyXv28y60zllsPcBoLxkF
XxEvE0N0mvKnyhHa+vYuJNkx9aFY3TqUHQwsfFUXtz8uf35f5VkuZdLcvSCvFYGwDaRECgDZVGAG
0iAUQGygwAwKFJAGyIMKBQUYAKIgwKNgGyg2kAKIDAo2AYlcoFWIDYBgBgBgBsAwgN2AFWAMKDAD
ADYUYAbsQG7BBsA3YAwKNgGAG7BBsgN2ChDRQaANNBAkKNAGmggSFGggS0AaCjRUCWgBDQAMAGEC
GgAcigRIIBsAGwgE0ACkigCwgFIADIoBSAAyABSCATKAMgAUggCAIZQIYAOQAOQQIZQICjQQYEGA
CGrBRoIMAMAMAFJACgD/1Po0eh8l+VTRQYAYAYyA0EGACWFGigwA0EGAGiAwAwAwAQ8igwAwAwAw
gMANAGggwAxoASVRgBgBhAaCDQBgBgBgBgBgBpoqjQBoINEBgBgBgBgBgBgBoqDADTQBoijQBgBo
qDADADVgDLAGgowoMAMAMAMIDADQBgBhAYAYAYAYAYAYAYAYEGigwAwAwAwAwAwAwAwAwA1YAywB
oKMKDADADADADADADADVggwAwAwgMANAGAGAGAGAGAGAGmgo0AYAYAaKgwIMAMAMAMAMANEUYAaY
BoqjQQYEGAGAGAGAGAGAGmFCSgwijQQYAYEGAGAGAGAGAGAGAGrBQkqjADADADADADADADADADAD
ADADADADADADADADADVggSUGAGAGAGAGAGAGAGAGAGAGAGAGAGAGBQsgMAMCDZQYAbCjaIDYQYAb
CjZVGACiMjABRGhhQbQQbANkUYAYAEQBgBgBgApACiAVcoNpgC4gCiAwAIgDADADADADADADYUKT
ANhBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgAhsA0AYAYAYAYAYAaKgwgEBRgBoIMANMAQAYAYADK
DADAg0ECWFGgowA0ECkAKAFIAWAbQAsiggARAC4hQSIARBQsAKiKCoAKgoJEALEAKgoKgAqIoKgA
sQAsQoLEAKgoIgAyIAqCgsQAkQAsQoJEALEigsQoIgAsQoKgAiCgqIAqCgqACoKCxACxCgsQAsSK
CIAXEAJEAIgoIgBaACACkALCjABSIBRQbIo0VBgBgBgBgBgBgBp5gCADADADADAgGwBLAEACJBAl
gA2ADYQCZQDYQCYQDYAiQAhhANgCGEA2ADaABtBAhlAMgENFAhhANoAQwgGygSyIEAA2UCWECAAb
AENACWECAoQwgGwBDKAYAgIEMAG0ADaAENBAN5gA2UAmADYQDaABsAGAIYQIaKBDCAYAhgCGig0A
JIgwAS0VRoINEBsA2VQpEQbCjZQLRFC0AEQARAC0ALQARABkRQWIAWIUFQAVBQVEARABUFBYgB6c
XNpLNvJEUdY6QyWhcBGhHbJKPvk+33mJ5r05/ZmhzCEXJpLazbzDqul5LQWAjRXnSWr35yft7znP
L1ZfZg5kjo8w6lS/5F/AX2Tkr/ils7l7Dny9Pswc2Rt5x0XozhlgKEsRPK6b/Cvi/cYr0YTU2KVi
cQ8XUlUltk7m3C3YsXRjAfKavjH5sPbu+PcZtdOnNhPSDHfLKzivNhkuve/1wEM7sRuEw7xU1CO1
uxWJNi6aZrrR9FUIbWrdm/v+JmO+d1NCmxNOAuWhMMsJTdaeV1l1fmZrvhNeRXsViXi5ub3+pFcr
dguBwrxk1Fdr4IEmxYNMYpUIqjDLLPkuBI653XgVs04iy6IwqpRdWWXDq3szXbCeojMViHjJuW7d
1Fc7dhNOg6jS3sEgsc3HRtOy2v28TPLt7MEC5X/X69xpxDnB4b5TLktpK1jNh9pLE6v0ce34EjeV
9BDbf1+kjTmJfR+E1nry2LYSt4wBxuK+UOy81di7WImV2GG3mu5fmVgTmCw6w8fGTe7LckZrrjNe
RE4qv8qlfalsWxL9dhWLdhr5+Xnclkv13dZWRYMLR+Qwcp7eC9i5mXaTQr+KxLxEm5v8K+P+vUac
rdgOq7282+5Zyf652QQWTD0aeiaevLJvbf2f6GeXaTtFZr13i5OSWs+L2JdWzvNOVuw1labs71JP
JJbPj2K3WVkWyjGOh6WvUtfgvYviY5dp9mCrYnF1Ma3UygnvfDgnt7I9qNOVuwwglfVpxc5cWvZH
436kVkXDB4eOiKbrV3edu77K/XqM8u8nb5oq2OxdXSL1qj8XTexcurbL2X4Go422iOhJX1aMHKX1
mrvsWxdt+tFT4C46L0YtGJ4nEvy7Xu3ey97/ANDFu3bHHXmitaUx9XS71m/F0d13ZP3yfVexqTTl
lbl8BDqpCk0qUdeb2OSv3RzXffqRWBb9C6Clf5Ti3ms0pPZbe+rctxm12xw9aIrTOmqumJOFC6ox
2yvZPm29i4Lf7LJpnLLu4FYficJ/x2XaoL2OX8q6zTl4gsmhNC1dNyVSvdUY+bG1k+SSyS4tbfZm
3Tpjj3ch10i6UOm/k2Ftl5LklflqxX65Ekazz9IKXVwfi254qbUntivKm+vdH8WfJm3HXvElofC1
dMz8VQXiaS8+Szlbg5bW3wVlyJfDWM7uBctLadw/RWmsPRjeaXmp7Ocnxe3j1ZGZNu2WUw8QcxnV
xGmrpZU07v0YLnJva+cm5M3w83nILwWDpyqKlRj8orPZtVNc9zlbi9VcmKSfMddpxh0aw+vVnFzt
nJvVjfhFJZRXCKvvs2c+Xr9mDj+k9OxrVXVS8bVf9pNeTHlCGaSW5yvxsmdNPJlkI14Gtj/p8RPU
g/TqN3f3Vtl2ZLiis635oG9J09H5YWPlf3s0nP8ACs1D1y+0NHdrgIWip1PpsVPxcZZ607ucvux2
vrdo8xs7fWhM9LxwS1cJHxf/ABx51H1PZH8Of2mNHdrgIhodwXjcVPxUXmk86kvux29srLmxtO33
hFTTSwqcMJHxSeTne9SXXL0VyjbncaW5a4CaehHRSqYuXiYPNJq9SX3Ybe2VlzZNpMfeE1dN/Jk6
eEj4mLyc73qS65blyjZcbl0XLXATS0E6cVVxUvEweaTV6kvuw29srR5jZMfeMqacWFTp4OPiYvJz
verLrluXKNlxuNHdrgJw2gpOKrYmSo0nmnJXlL7kNr68o8xsmPvBZ6bjgU4YKDpJ5Oo86su3ZBco
25tl0vdrj+kBwehJ4mPjq0lSov8AtJ7/ALq2yfVlxaG0mOw6emaejPJwUXGW+tOzqP7q2Q7Ly+0T
R3a4/ENMFoitpS9WTUad/Kq1HaN+vbJ8ld8hsmOw++cqGiMsJHXqf39RbPuQzUeTleXUNba3Jx+I
j8LgcRp2cpK83tnUk8lzlJ5LtLwzJchJ+Owuhf3aWIrL05L6KL+zF5yfOVl9lk5Xcx+/8hG/tPSG
t6VWrLty9iS7Ehwz5yEp8nwuhP3rWIrL+zi/o4v7Ul5z5Ry+0OW9TH7xF43SNfTM4qTbtlCEVaK5
Risl2Zsa0zbchKLQ9LRK1sbJ621UINa7++9kF3y5Im9tduufwDHSGm6mOj4qKVKitlKGUet75Pm7
9hqRm5bDnCaAagq2Kl4mk81dXnP7kdr63aPMbWY+8LxGnVRg6OEj4mm8pSvepP70uH2Y2XWTRcvc
GmjdC1dJJyVoUo+dUm7Qj273yV3yFqTHYk3pShobycGtapvrzWf/ACDi/N63eXUTW2u6Y8fiIShh
62mKurBSqVJO73t82/a2a4YktE74rC6B8/VxFdegn9FB/afpvkvJ4tmeW/GP33+Ag8fpGtpaetVk
5PYluS4RSyS5I1Jpi3YmaWg4aPiqmOk4J5xox/eS616C5vPgibbmGuQ10hpyeMj4qnFUqC2U47Ou
T2yfN+oaTLLYzRug6mPi6smqdFedVnlHqW+T5L1C0mOw/qaap6Mi6eBTi3lKvL95L7v1F1Z8WTTX
drj8RB4PBVdJ1FClFzm9y9r97ZWJNixauF6P7dXEYhbttKD5/XfLzesnLfjH77/AQGO0hV0nN1Ks
nKXPcuCWxLkjWtOduwzANgG0iIFWKDYUYAbSIBRAbKDCgyxFC7AGEQbKDYUbsAbIg2FGygwAUkQG
wDAo2UG0ggURRgBgBgBsA3YA3YA2AYAYAYAbCjZAbsEG7AGAGWANhRsoMIDdgDYQbIowAwAwAS0U
CQDLEAhooNAGmggSFGgDTQQJCjTRUA2AIaAByQAhhANgA2VANgA2ADYQBkUApAAmggDIADIoAsAF
IIBSKAUgAMgALCBDKBDABsAGwgQUCGrAGgo0GRgBoAQ1YAwAwAxK4AQAwA//1fo0z0PkvyqaKDAD
ADCA0EGAGmFCSgwA0EGAGEBoAwAwA00AJKDADADCAwAwA0EGgDADGgBJVGAGAGiAwINAGAGAGAGA
GAGmiqEhBhAaAMAMAMAMAMAMCDRQYAaaANEUaAMAMsEGgDCgwAwAywBqwBlgDQUYUGAGAGAGAGEB
gBoAwAwgMAMAMAMAMAMCDADRQYAYAYAYAYAYAYAYAYAasAZYA0FGFBgBgBgBgBgBgBoIMAMCDCKM
ANAGAGAGAGACQowAwAwA0VBgQYAYAYAYAYAaIowASAYUGggwAwAwAwAwAwAwASwo0UGEUYAYEGgD
AgwAwAwAwAwAwA1YKElUYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYECbFBoAwAwAwAwAwA
wAwAwAwAwAwAwA2goUQGAGyoMAMANhoKIgwIMANoKNlUbREGwg2FGyKMKDaCBQBhFGAGwBYBgBgB
gAtEBsoMAMANp2ACqRAKuALQBsAwAwAwAwAwAwA2FCkwDYQYAYAYAYAYAYAYAYAYAYAYAYAYAabs
AJbuAaAMAMAMAMAMANBBhQJbuRRoAwA0EGACWFCQgwA0wBBQYAaCDTAEhRgBoIMAFIAUAKQApACk
ALIAgULQASIUEiAEQULACoigqACxCgsQAsQAiCgqIAqCgqACxACxCgsQAkQoKgAyIAiCg0QAkQAs
QoJEALEigsQoIgAsQoKgAqCgiACoigqACoKCxACxCgsQAsSKCRAFxACRACIKCIAWAEAFxAFBRgAt
EBsoNkUYAaKgwAwAwAwAwAwA01cAQAYAYAYAIYQJAEMAQwgQAIYAOQQDkUApBAOQANhANgCGEA2g
BDCAbABsAGwgQygQ0AIaABsIEMAG0AIYQICBDRQIaAEMIEMAQ0AIYAgAQwgQwBDABsoENACGggQ0
ADYANgA2ADYQIYAJlANhANgA2rAA2gBDQQIYANlANhAhgCAg00FGigSRBgAloqjQQbChSIg2FGyg
UkRQoAWgAiACIAWgBaACxACxIoJEAMgoKgAqACIigsQAsQoJEAtXRHA/LcXC+yHlvs2euxnJ06c3
RJ9Nsb8oxCprZTjbteb9xMW+rd0NeieB+W4qLfmw8p9mz12FrPTm6H/THHfKcQqa2U1bteb9y7Bi
11LuiP6P4H5wxEIvzV5UupfHJCs4TdE/0xx3jakaK2QV31v8vaTFvqX0FZwGFeNqxprbJ27N7NOc
mxeulOKWFpQw8MrpXX2Vs9fsMR26l14FFirm3EdHl/UGDt6b/wAT+HuMcvR7MFBRt5xdejWDVKMq
88tqXUtr/XMxXfCeor+Oxbx1SU3sezktxpyt2D6Mwfy2oo7tr6iVcZsT+n8XqpUY7Mm/cvf3Ejpn
fQVpGnIXHR9FaMoupPzmr/BGOXfH7MFYq1XXk5S2tmnG3Ye4DBvFzS9Ha3yFXGbE5pTEKK8Utm/3
IkdM76CFT/X6/NFcxO6OoKjF1ZZZZdRmuuM15EXicQ8RO/d1frqNMW7AoQdRqKzf67AyLBNrR9Oy
85+3iZ5dvZggPOz289i+LNOQdYXDvEu3o79y/MiybEhj8R4peLjZLf1cCRvKiG25+t7OxfrqNOYk
MBhVXetLNLZfZ2L9dRK1jNjePxXj3qxV0tr3XEhldiKflv6z4LJL9dhWBM6PwjXlztbcls6yV0xg
YaQxfj3Zu0VsS2vr/PZwEZyuxHq8dnkLjvfv7rIrIntHYKGHj42WT3N7lx5eszXXGa8iHx+MWMnk
nK3mrd8X6isW7DCr9t7PRj+rL1vkVkWXRuGWCg6s0o5dy5vbfl6jNdcZryILHaQekJ+RG9tl87c7
bO137DUjnctiKq6qd6knOXBPLtfw7ysi2aKwnyWHjqtoq11HYkuL3t8L3aM11xmvIgdIaWlpKdqU
clsvnbnbYut7OKLJpi5dwhqihB3qSc5cE/bL4X60VgW3QuBaj46raEFnGKyX3nx5Xvx4GbXXCeoh
9L6e+cJKFKN0nldXu+Kj7L36kyyM5Z7EFWpWetXm3L6qd5dr2L1tcDTn8RZ+j+jnifpHFQpblvl9
57WuWSfAza64TYD0h6RU630UPLitu6LfO2bXJWW+7EiZ5iq1KdXFxUqklCnuvkvwxW3rS62acuRO
dHtFRxs9aEfIi86k1m3wjHYut6zXFMlrphjsT3SXTEMLHxKnq3Xlauc7cFw5tvqTMyN55a8DnMMV
Oo/F4WDjf6uc31y29drI6PPv3B/ojo8sdU1Jy1ms5KDuor7UtnZG7fFbSWtY4bF80ji46CpeIwkF
4y1+UV9abeXVd5mJ5d7e3xByqtOjh5OVR+Pqt3ebUL83lKXZZc2dHl8T7xlHC4vpFJRgvITsl5sI
9W6/VdvmOFkuQ6Rh8Nh+guHdSb1qst++T+quCW99vBGPad5J04OZYx4jpDN4is1CnulJ2glwjvfV
FN72b4ee7y8hk8ZQ0f8AuI+Mn/eVFkvuwzXbK/UipuTgCWCraS+nrz1YP+0qN58orbLqinbkE1vz
Ql6Ro6Oyw0bz/vaiTf4Y5qPW9Z80NG9cAUdG1cd9PiJ6kJf2lRu8vurzpPqy4tDZrfmjb0pS0dlh
IeV/fTScvwxzjD1y+0iaO7XH4gFLRdXHLx9efi6cnd1Kjd5fdXnTfVfm0Xadu/NC3pWlo3LCR8r+
+mk5/hjmoeuX2kNbXu1x+IbUNFVtIp16stSm3nVqN5vltlN8lfsJtJjvyDfOlHReWEjef99UScvw
RzUet60uaLpd64/ENcPoyvpe9acrQv5Vao7Rv1vOT5K75F3pJLfIcfL8PojLDR8ZU/vqiyX3IO6X
XK75InK7k4/ENMPgsTp+cqjblbz6s5WivvSeXZt4IvCSXIPVXwuh/wB0liKq9OS+ji/swecuuVl9
knK7k+8M4wxXSSq35VWds29kVzeyMV2JF4Z85B/qYTQ3nWxNZbldUovm8nPstHmyct+Mfv8AyEfX
xeJ0/UjF3nLZCEVklwjFZJdQ1pm25CS+bsPofPFS8ZV/uabyX35rJdUbvmhvbWpjz+AYY/TFXSSV
PKNNPyaUFaK7N75u75l0xcth/T0HDAJTx0nTTzVKOdWXZsgucu5k212a5AMZp2VSDo0IqjRe2Mds
vvy2y9nIaLl7hmC0DOtBVq0lRofXltl9yO2T6suaGyYhzU05DR6cMDF075OrLOrLqeyC5Rz5sa2v
drgRuj9E1tLNuC8lZzqSdox5yk8ve+Bd6ZmOxLrFYbQf7hKvWX9rJeRF/Yg9r+1LsROWtzHjyIdu
vpqr6VWrN823+XqReGPOQmvkOG0JniWq1Zf2MH5MX9ua/wAMe1meW9THn8BE6S0vV0o1rtKEfNhF
WhFcorLt28yyaZuWxI4fQKw8VVxkvE03nGFr1J/djuX2pWXWNtTHXIHjNPOUHRw0VRovak/Kl9+W
19WS5DSXL0gbaM0LV0neStGnHzqknaEet8eSu+RbdJjjsSz0pQ0L5ODWtU315rP/AJBxfm9bvLqJ
y33THj8RAU6VXSVS0VKpUm+bbZXPkWL5FhtA54i1auv7GL8iL+3JbX9mPazPLpqY8/gIXSOlaulZ
J1HksoxWUYrhFLJF0zbsSWC0BaCr4qXiaL2XV5z+5Hf1vJE2sx9aN43TvkOhhY+Jovak/LnznLf1
LJFkS5ekFdKwNhRsAUkRBsoNhRgApIgNgGwDCg2kRQoiDCg2AbCjdgDZEG7BRsoN2AN2IDYUbAMK
gUkRRsAwAwA2AbSAN2ANgGAGAGwDAo2QG7BBsAwA3YAwqjYBhAbsEGwDZFGAGAGyg3YASQGACWig
0AaIBDVig0AaaAEgGgDTQQJChDRUCGgAYAhhANoAG0UA2ggG0ACkEAmgAMigFIACwgFIoAyABSQQ
BkUAmABkABYQIZQIABgAygGwg0ECWrBRoA0EGAGmrgCADABaQBsAwA//1vo2z0PkvyqJKDADADAD
TIDAgwASwo0UGAGggwA0QGAGAGACWig0AYAYAYQGAGgDQQYAYAaaKo0AYAYAaIDAg0AYAYAYAYAY
AaaKoSEGEBoAwAwAwAwAwAwINFBgBgAmxFGgDADADADAgwA0UGAGAGAGWANWAMsAasAYFGFBgBgB
gBgBhAYAaAMIDADADADADADADAg0UGAGAGAGAGAGAGAGAGWANWANBRhQYAYAYAYAYAaCDAgwAwij
QBgBgBgBjQAkKMAMAMANFQYEGAGAGAGAGAGiKMAEhRhUGggwAwAwAwAwAwAwASVRoAwAwijADADQ
QYAYEGAGAGAGAGgoSVRgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgQasAJKDADADADADADA
DADADADADABSIDYUYAbKgwAwKFIgNhBgBgBtFUbChSIgwINhRsijCgUEG0QGBRgBtBAsKMAMANgC
yAwoMAMANoAWQGAClKwAtTAF7QDADADADADADADAoUmAKCDADADADADADADADADADADVwDTkAJAM
AMAMAMAMAMANBBhQJbIo0AYAaCDADABAUaCDABEig0AYAaDISwo0FGBBoIMANoKFhBtBQsAUiKFl
QLQUERAEiFC4gBEFBAAiIoMgAiCgsQAsQAsQoKgAqIoKgAqACxCgkQAsQoKgAyIAiCg0QAkQAsQo
JEALEKCxIoJEALEKCxACIKCoAKiKCoAKgoLEALEKCRACxIoKgBcQAkQAiCgiAFgBABcQBQUYALQB
sA2RRgBgBoqDADADADADADABLQQJCjADABLCBDAEsASEAwBDAESABSKgFJBANoAGwgGwBDCBDABh
AhgA2ADYANoqBDRAIAEMoBtBAhoAQwgG0UCWiIEMAGygSwgQADasAJYAhhAhgA2UCGAIYAMAQEA2
ADYAhgA5IIByAByRQCYANhAOQAhgAwBDCAcigQwgQwAYBoINNBRooEkQYAJsVRtEQKANlUbSIBQB
tBQRABEAEQAtAC0AEiAFRFBUAFQAVBQVABYkUFiAEiFBYgHVOguGWGo1MRLJN2vyirv2+o55PT0p
ryOe4rEPGVJVHtlJvvZuOFux0vohRWj8LPET9K7/AAx/O5zr0dOamxzqtWeJnKctsm2+028+9jo3
RHDLB0J4ieV75/Zjt9d+4xXo6c1Nii4nEPF1JVJbZNs24W7F16HYLzq8ti8le1v9czNd+nPUV3Sm
N+cK0qm5uy6lsLHLK7ok+jWB+V1tZ+bDN9e749hK1hN0OekuO+U1dRebDLt3/ARepd0Q+Dwzxc4w
jtkysSbFz09iFgqUaEMrr+VfH4mY753XgU1GnAXnRlJaLw7qz2tX+C/XEzfLvjO2Cp1KrrycpbW7
s04iV0Pgvlc7vzY5v3Ilbwm6JDTOIdeWon5MdvN/kSNZ3YioQS5/r9cysC1QS0ZS1n5z9vAzy7ez
BXJTc3d7Xn+v0jTiHmAw3ymVtyzf6/1FXGbD7SmK/s47Ft+BI3nREJd367WVzE9gKCoR8ZLhlyXU
SuuM15Ebia/j5azy4X+HxDFuwKMHJpb3xzfd8e8qCdk46Op7fKfrZnl19kQMnd3e/e9vd+us05A2
GoPEyyXXJ/D/AFIsmxK43EeIjqQ22z4JEjeV0ILzvtPgtn67jTkHmDwbxL8p+Sty2frvI3Mdg+lM
T/Zp2W+23qt8bCLlRCxuleK1V9Z+78syuYk9GYGNZ68rtLe976vj3Etbxx2B6Vx8az1U7xW5b3zf
wuJDLLYiZqVs7Qjw3vs2vtyKwJnRGBjL6Rx8lbG9r58EvXzJXTDENNL6ShiHqq8orcsk3ze19St1
iRnLLYh6sZNfSNQj9W2f8PvfeaYE9oTARl9K42itjlm3z4JdWfOxm10wgZ6b0rDEPUTcorcsk3zf
uXXcsiZZbEHOM6sfKap09y2J9S2vrz6yuYn9BaKhW+kcbxWxy2t8lsS73zRm10wxCOkGk4Vvo9by
FtUdsnzexLvd9xZDPIViE6ldNUoqEN7WX8Un7NnI058ia0HoGni3rSvOK37It8FvfPYusza3hhsP
+kOPbj4mm1Tp7JSeV/sxSza42y3XQkazvoKR8ohh8qMdaX1pK77I5pdus+o04bEto/o7W0tU1q0m
l6V3eXVy7c+TJbpvHDfIsGmtK/N0VhMJH6S1vJz1V8fZtJJt0yy14g59PDU8NnWlrS+pBpv8Us0u
zWfUbefWuQ4wcK+mpeIoRUIPzlHJJcZPa+19SJws3l4gveMxtDobQVOmtao9i3t/Wly/0XExrbvb
MIOcV6+K0+3KT8hO79GEebey/XdvmdOHn3cgOjRpUpKFOPyiq3ZbVC/Vk5duquTQJPmOsYHCrQNH
xuImnUtm3aMY/ZitiXUrt7tiOfL1SdvI5dpnTsMVVdS3jp+i5K1OK4RhtfXLb9U6SPNllsQ7w+I0
x9LUlaCy8ZN2iuS/4MU3yLwxq5BDxWH0d+5j42f95NeSvuw39cr/AHUDcgCsJiNMN1qsrQ2OpUdo
rkuP3YpvkOE1cvI08Zh9G/uI+Nqf3lReSvuw2dsr/dQ5XcnADHB4jTbdapLyfSq1HaK5Xe3lGN3y
HCauQX8rw2jP3MfHVP7yovJX3Yb+ud/uohuTgNoYXE6fk6sm2l51SbtGPK7yXJLPgi8Jq5AjxGF0
V+6Sr1frzVqa+7DbLrll9knK7k+8NY0sV0jqOTvNpZybtGK5t2jFcslwLwnnIHbwmiNlsTV7VSi/
VKf8sesnK+J9/wCQZyqYrpJUUfKqSSyilaMVyStGK7ka4Z85B18mwuh/3rWIq/3cH9Gn9qazl1Qy
+0TlrUn3hnidIYjTco07NrZClCNor7sV7dr3svDNtyD/AOaqGic8ZLWn/cU2nL8cs1HqV5ckTe2u
2Tn8Azx2mqmNj4qCVOjfKlDJdu+T5yuNJcth3T0CsGlUxs/ExeappXqy6o+iucrdTG17dc/0hGI0
84RdLCx8RSeTs7zl96e19StHkXRcvcEYHQM8RDx1RqjQ/vJ7+UVtk+rLi0S1JjsPHpmlotauCi1L
fWnZ1H91bILqvLmNbXu1x+IjcFo2vpmUnFN2znOTtFc5SeS9rG9JJchKePwuhP3SWIrL05L6OL+z
F5y65Zchy1uY/eIirWxGnKvlOVWrLJLa+pJbFyWSLwxu5CZWjcPobPFvxlX+4g8l9+a2fdjd80Te
29THn8BHaR0zV0klGVo04+bTgtWEepcebu+YkZuWw9w+gPFRVXFy8TTeaTV6k/ux/wAzsusbWY+8
ZidPeLg6OEj4mk8m07zn96X+VWXWNFy9wZaN0NV0pdxSjTj51ST1YR637ld8hakx2JX5ww+hMsKv
G1v76ayX3IP/ABSz5Ia21uY8fiIK1bStX0qlWb5uTZeGeRYFo7D6DzxT8bW/uIPJP/jk1/hjnzRN
7b1MefwEVpLTFXSllNpQj5tOKtCPUvft5iRi5bDzBaBc4KviZeJovZJrypcoR2vr2cxtZj60ExOn
lQg6ODj4mm8pSvepP70ty+zGy6xpbl7hFaO0ZV0rPUpRcntb2JLi3sS6xazjjsWBVcL0f/d6uIxC
9Nr6KD+yvTfN5b0ict7mP3/kK7jMbU0hN1KsnOT2t/rZy2GnO3YbBBgUbSIBRUGwo2AYAKSIBQBh
QYQCkgo2RBhQbCjYAqwBhEGyqNgG7ACiAwKNgGWuVAtKxFGAGAGwDdgDdgDYBgBgBsAwKNgGWIBQ
QYUG7AGwowAwA3YgNhBsijADCg2AZa4ApIgNgGmgBJQaIDTRQJANEAhqxQaANNACWrAGgDTQAhlQ
DYAhoAHJBAhgAmigQwgEwAbCAMgAUgALKAUggDIoAyABSAAsIBSKAMgALCBDABlAhgA2ADZUCQDA
gRsCjQBgQYAJaAMSAFAGAG7BR//X+jjPQ+S/KokA0UGAGAGEBoIMANMKElBgBoAwIMIDQBgBgBjA
EFBgBgBhAYAYAaCDQBgBgBpoqjQBgBhAaANBBgBgBgBgBgBgBpoqhIQaIDADADADADADADADQQYU
GEAgKMAMAMAMAMAMAMAMCDQBhQYAYAYAYAZYA1YA1YAwKMKDADADADADCAwAwA0AYQGAGAGAGAGB
BooMAMAMAMAMAMAMAMANMA0VRgBgBgBgBgBoIMCDADCKNAGAGAGAGmgDQUYAYAYAaKgwIMAMAMAM
AMANEUaYBoqjAg0EGAGAGAGAGAGAGgo0UGgDADAowgMAMANBBgBgQYAYAYAaCjRQaCjADADADADA
DADADADADADADADADADADADADADAg0AJKDADADADADADADADADADEALIowAwA2VBgBiChSIDYQYA
YAKKowKFEQYEG0FGyKMKBQQbIowAwAUggUFGAGAG0ALIDCgwAwAVEAUQGAGygwAxABLkArWANgGA
GAGAGAGACkwoUEGAGAGAGAGAGAGAGr2ANNgCQDADADADADADADADQQYUGmyASFGAGAGggwASwoSE
GAGAAygwA0EGBAgNDADQQYEGAGwoWEGwoWAbRFBCoFoKCIgFxCgiACIKCABERQZABEAFiFBYgBYh
QVABERQVABkAFiFBIgBYhQVABkQBEFBogBIgBYhQSIAWIUFiRQSIAWIUEiAFQAVBQVEUFQAVBQWI
AWIUEiAGiRQSIAuIASIARBQRAC0AEAFoAUFGAC0AbANkUYAYAYAaKgwAwAwAwAwAwAS0ECQowA0w
gQwBIAgARIIEMAQwATKgGwATCAbCAbAENBAhgA2AIYQDYANgCGECGUCGADYAhhAMAQwgQwBAAhoq
BDQAhhAhoAQwBAAgAQwgQwBDABsoEMAGwgRIAGwAbAEMIBMAGygGwAbCAbABsAQ0AIYQDZQDCBDA
EMoEkBoINWANFUJIgwAwA2VRtK4AsgMAFoKFoAIgBaACIAWgAkQAqCgqIAqACoKCRACxIoLEAKgo
KgDrmlP6l0XGlslKKj2yzl7znPNerL7OI5fSpurJRWbbsjbzDqfSaa0VgoYeO2Vo9kc2++3ec49O
fiaHNqFJ1pKMc22kutm3nHTekdRaLwkMPH0rR7Ftfa7d5iPTn4mhzmEXJ2W1m3mHTNJNaEwSpLzp
LV7XnJ+31GJ5enL7MHO0becdIwEVoPBuo/Oktbtfmr9czF8vTPswUJycs3tZt5xdejGDVOMq8sty
6ltf65mK79Oeor2Pxbx1SU9z2dW405W7DvQ+C+W1Un5qzfw7SVcZsTHSDF+NkqUdkc31kjpnfQQl
Ohfb3I056FystEUMvOftfwMcu/swVfWv+v1+t5pxEzofC+NlrvZH2/l2kreM2B6Txfyidl5sdnx/
0ETK7DFRvlx3fl8SsCzK2jaVvSft/Izy7+zBX27vn3v4L2mnEPsBhvHy5Lbvff8AAjcmw70jirvU
i9m223qEXKiJXk8urN9/66isCawFBUIupJW69tjNdMZoR+JruvK78lbr7e79dZWLdgEIubyW3e/c
v9SoJ6MfkFO+2T38/gZ5deBX5z8a825Pgthpx5BaNB4hqN7cl7/02Fk2JfFVI4GGpFpP9Z9Zl1t0
K6s/NV/tP9WXbc04h1hMIsZPNuVtr3fH2Eak2JHSWJjQj4qLtxtttw/1JG8rrwK7Bt5wWqvrP4/D
M05B9o7R8cVK7vJLa9i6lvfqJWscdh5pjGRgvFKVlvtm+rlzuI1lRXYSlL91HVS2ye3+J5LssVyg
kNF6Khi5a0ryS2vYm+HF89naLW8cdh7pvF2Xik1CO973ySW7uW65I1nRVoVM9WjG8uLV32LYvW1x
NOPwEno3Qrx8tarK6Tzs73fBy2d1+wm28cNiQ01jpSi6FGyispy2RX2b+3fuJGsr6QU6TpYfZ9JL
ndR7tr9XUzbjwJTAaJraYknUvGmuxW4RXv2Et03MbkJnTemFo1LD4ZeVsyz1eS5/raZk23llrxBS
6uGs9bETafDzpvr4drvyZtx17w80ZSnpGfi8PHxcfSntklzl7o2uSrj54Fu0hpSh0bpqjC7nbYtu
e9vi+3qsZk27XKY+Bz14mtpG8KUbReclH2zk831ydjfDz7tCsFo2FWoqa+mqP0Yu0FzlLa193+IW
kxHTZyWgaFoRi5W3WjG/Fvcut3fFs58vV7MHKcZi6eu6lR+Pqt57VTXscv5V1nV5bfmG8KOJ060k
rxTstkYRvuWxX5LN8xwnnIdF0bomh0Poyr1pKVS23/LHr4+xGLdvRjjMPNHPdI4jE9J6jqy8mlHJ
OTtCC63tfG2b4bEbnhwtuYjnVw+j/MXjqn1pK0F1R2y65WX2Qx4n3gLo4nTb8ZJ+THJzk9WEeXBd
S7EXg85DTq4bRvmLx9T60lamuqO2XXKy+yDxPvAPFYnT8nOTbUdspNRhBdeUYrkuxDhPOQ254XRn
mr5RU4u6prqWUpduquTHK+J94b2xXSGW+equUYQXqjFdyHCecgTVwuitv7RV4K6pJ83lKfZqrmyH
iff+QaTrYrpDNQSc7ebCKtGK5JWUVxfey8J5yBnhcLorOtLx9Rf2cH5C+9Pf1Q/iIupOfIZ4nSOI
0y40oryb+RSpxtFdUVtfN3fMutJbcg6eiqOi88ZO8/7mm05fjlmo9WcuSJte3XP4BnjNN1MVHxNN
KlR/u4ZJ/ee2T+83ySLpLlsHp6AWDSqY2fiYvNQterLqj6K5yt1MbXt1z/SNV9POjF0sJHxFN5Np
3qSX2p7eyNlyGkuXu8AWC0DUxEPHVWqNH+8nv+7HbJ9WXNDZMQ7emKWi/JwULS315pOf4Vsh2Xlz
Gttd2uPxDDBaMr6alKSu0s51JO0VzlJ5e9lt0xJchJ+Owmhv3aWJrL05L6KL+zHbLrlZfZZOWvE+
/wDIRlSridPVVfWq1Hkks+xJZJdVkhwnnISvzfhtDZ4qXjaq/sabyX35rLsjd80Te2tTHn8BHaQ0
1V0ilB2hSj5tOC1YLs3vm7vmakZuWw9w+gPERVXGS8TTeaja9Sf3Y7l9qVl1ja9vvG6+nvExdLCR
8TTeTad6k/vT29isusmi5e7wGmjtC1dJpyjaNOPnVJPVhHrfHkrvkLUmOxJ/OOH0LlhV42r/AH01
kvuQezrld8kTW2tzHj8RB/T6Xq+lVqzfNt/r1GuGPNE7834bQmeKfja39zB5J/bmv8Mc+aJy3qY8
/gIvSWmKulLKbShHzacVaEepL2u75lk0zcth7g+j7cFWxMlQovY2vKl9yO19eS5k21Mff4BcRp5Y
aLpYKPiabylK96k/vS3L7MbLrGi5+4RejtF1tKy1aUb2zb2KK4tvJLrG9MTHYm/G4XQPmWxNdek1
9FF/ZXpvm8t9mTlvxj9/5Cv4zG1dJ1NerJzm979iW7kkXhi3YnqWgoaPiqmOk4J5xpR/eS616C5v
PkTbpMNchtj9OzxUPE0oqjQWynHfzk9snzfcWRnLLfgQRWBsAwKNpEAoqBQUYAZYgFpAGwDCgwgF
JWCjYQbAMCjdgBREGwo2UGACkiA2AYFGyg2lcIFEUYAYAbsAKSANgGAGAGwDAo2QG7BBsA2UGAGw
owAwgN2AN2CDZFGAGygwAwA2kAKIDADADADVrgCWig0QGmrgCSg0AJasAJKDGrkAhqwBoAQ1YAQ0
VAhoAGwAbCAbABtWKgG0ACYQCaAAyKAUkABkABkVAJgAZAAZBAGRQCkABYQDZQIYAhgA5AA5FQJC
jQZGbQBAUaCDADADADADaQAsA//Q+jp3fJflUQyg0UGAGAGAGiIMAMAEsKNFBgBoIMANEBgBgBgA
loA0UGAGAGEBgBgBoINAGAGAGmiqNAGAGEBoA0EGAGAGAGAGAGACWiqNBBogMAMAMAMAMAMAMANB
BhQIIowAwAwAwAwAwAwAwAwAwAwAywQaAMKDADADADADLAGrAGWANBRhQYAYAYAYAYAYQGAGAGgD
CAwAwAwINFBgBgBgBgBgBgBphRooMAMAMAMAMANBBgQYAYRRoAwAwAwA0wDQUYAYAYAaKgwIMAMA
MAMAMANEUJYBhVGggwIMAMAMAMAMAMANMKElBgBgBgBgUYQGAGAGBBoAwAwIMAMChJQaCjADADAD
ADADADADADADADADADADADADADADADAg0ECSqMAMAMAMAMAMAMAMAFIgNhRgBgQbKDADYUKIDAgw
A2AbK0NoiDYQYAbIo2FG0VBsA2RRgBgAtBBsKMAMAFIAUAYAYAYAERAYAYAbKDADaAFEBgBgBu4A
q5QbuQGAGAGAG0woUncINgGAGAGAGXsAJcgBIBgBgBgBgBgBgBgBgBoIMKDTZAJCjADADQQYAYAI
CjQQYAabAEFBgBoIEsA0FGBBoIMAMAMQULQBsAWAKIoWioCIihaACRCgiACIKCABERQVABUAFiFB
YgBYhQSIAVEUFQAVABUFBYgBYhQWIAVEAVBQVABUAEiFBYhQWIAWJFBIgBYhQWIARBQVABURQVAB
UFBYgBYhQSIAWJFBIgBIgBIgBEFBEALQAQAIgDYUYAEAMANkUYAYAYAYAaKgwAwAwAwAwAwIENAG
gowAQwgSAIYAlhAMAQwATCAbKATCAbAEMIEMIBsAQwAbCAbAEMAGwBDKgQwBDIAbKgQwAbQQJAEN
FAhoiAbAENFAlhAgAGwBLQAhoAGwgQygQwBDQANgA2EA2AIYANoAG0EA2ACaKAbCAbAESQANgCGE
A2AIaKAcggSwBDRQaIDQBphBoqhJEG0FGygWiAwA2iqFogFoAIgBaACIAWgAiACoigiACoKCxACx
ACoigqACoKJrQWD+X4mnT3OSb6lm/UiVrCbouXT3F61SnRXopyfbkvY+8xi7dWiG6I4P5Xiot7IX
k+zZ67GsmOnN0PumWM+UYnUWymku15v3LsJGurd0a6H4L5ViFJ7Ka1u3Yvj2Cp05uhXSrG/KsS4r
ZBavbv8AXl2CHUu6M6LYL5XiE35sPKfXu9efYKdObod9Ksb8pr6i2U1bte34dhIvUu6I/QuC+X1o
w3bZdS/Vi1MZuix9LMbrSjRWyOb63s9XtMx06l9BV8PReIlGEdsmkjTjJsXrTdZaOw8aEN6t2Lb3
/EzHozupoU2FJy5GnCQXrR9FaIw7nLzmrv3IzfL0YztgrM6jqO72vP8AX6aK4ia0JhfHT13sjs6y
V0wmwLSuL+U1LLZHJe98REyuwwo03Vaitr/Wz4lZgtOLmsBSVOO1q3xfIy63xBWoxv8Al72zTiJ7
ROG/tHay2f6/pErrhA1xmJ+VSbWcVkty7WIzldhtCLqPVWfJZLtf66ysiwTa0fTtFeU+HHiZ5dr9
mCBb1suO6Pvf+ppxD3A4Z1pblFbUvZf9dRK3jNhzpHE56idktvH9dxI1lRFRVs0rc3+vizTmJjAY
ZQXjZPPi+HEzXTGeojsXXWIld3fBL9ezvKxbsAs9jyv6K2/rrKyJ6lTjo+F3k3xfqM8u0naK9Op4
6TdnOT7u79dRpx5G40niJKLd3uit3uXZcLrYnqso6Np2jZN8ePHizPLrfsirqSk/JTnJ738PjfqN
OINQwjxk1GUrvgs7Lr2Lsv1BZNidxlRYCmoU7Lm93Pm+rMy63wKi5Qg8lry4vZ3bX29xpwD3D6Pq
aQlabslu4LqWS7bdQ21MdiZ0hifkUFQoLyrbvRXFvj/qSOmV14gp84wpu83ry4J5dsvh3mnAPMHh
auk2oxWpS32Vl+b67k4aktE5pTScdDQVGilrW7lxfN/mSTbpll2+IKjWpTq2lXlqrcnt7Ir8lzNR
xv3g+jqPyuooUI241JZtLity5b+YXGb4Fs0hpGloWn4tSeu11y63ff19ztYzJt2t7RQViqlduNCL
Td7tZyfG8tvXayNvPvfALgtErEVFBvXm9sYvJc5SzXdfvFqzHYveInHQdLxdCCc2sksl96Texdb5
XMcu9+zwOa4iVOEnOrJ1qjd2k7RvzltfUrLgzbzfxCacMRpr6OnHyb+bFasF18+buxwTeQvlGjR6
HYdzn5VSXfJ8FyX58EY5d5JhBz7E1sT0gk5zfkJ7W9WEe/L3vmb4cLbkGy8RhHaK8fU3bVC/JedL
tsuTKnifeOmaH0c9HQ+U4uS10sk7KNNcEskm99urjfna9OOOvNFI0/0gpY2prW8bq+andU487ZOT
5uy5NG5HHPPYrrhidNu7zjHe7RhBeqMepF4c/OQS3htHbPp6nF3VNdmUpduquTB4n3gD+U6elvko
rlGEF6oxXcXhPOQxxwujdv7RU4K6prreUpdmqubB4n3htOridPyUIpyS2QirQiupWSXFvtY4TzkF
vDYbRn72Xjqn1IO0F96e/qj/ABDldSfeGtbHYjTLVGC8n0aVONo/wra+bu+Y4TdyBfm2hozPFT1p
/wBzTab/ABTzjHqWs+omzUnP4BpitMVMXHxNJKnSf9nBbfvPbJ9bfJIukuWwZaDjglrYyfit6prO
q/w7I9crdTJte3XP9IFW086UXTwsVQpvJtO85L7U9vYrR5F0XL3eAPDaBnOCq15KhReyU9svuR2y
9nMbSY+/wCvTVPRvk4KGq/76dnUf3d0Oy7+0NL3a4/EMcFoqvphyqein5dWbtFdcnv5Zt8C70zMb
kJD5VhND/uY+Pq/3k15Cf2YPb1z/AIScteMfvEdfFdIq3p1aj7bL2JLsSHCechKLB4XQ2deSr1f7
qD8hP7c1t6o/xDe11Jz5Efj9L1tKWhKygvNpwVoLqit/N3b4jWmblsSFPQMcElPGz8Unmqazqy/D
6K5yt1Mbb7dc/wBIFitPtQdHDRVCk8mou85ffntfUrR5DSXL3eADR+gquPj4x2p0Vtqzdo9S3yfJ
XZdpMdiRWk6Gh8sHHXqf39RZr7kM1Hrd5dROWu6Tj8RE0aFfTVW0VKrUlm9762/e8i8MauQmfkuF
0J++axFZf2cH9HF/amvO6o5brmeW9TH7xE6R0vW0o0pu0Y+bCKtCPVFZL28yyaZuWxI4fQHiIqrj
JeJpvNRtepP7sdy5ysusbWY+8axOn/FxdLCR8RSeTad6k/vT29isusaW5e7wGOjdD1tKN+LXkx86
cnaMVxlJ5L2lt0zMdiZ+V4XQeVBKvWX9pJeRF/Yi9r+1LLekZ5a3MePIgMRiauk6mtNyqVJPfm3y
XuSNcMW7E9DQtLRSU8dJqW1UI+e/vPZBdefIzvbfbrn8Ax0jp2pjY+KglSoLZThkuuT2yfN+osiX
LYRo3QdXSSc1aFKPnVJu0V273yV2LTHHYlHpWhoXycEtapvrzWf4Ivzet3l1E1trumPH4isVakq8
nKbcpPNtu7Zpz2EhBsKNgG0ggUAbCjADaRAKsAbAMKDErkAsgMKDZQbIo3YA2RBuxVGwDABRAbAN
hRhUG0gBRFGAGwDaQAoAwAwA2AYFGwDaQQbANgGAGwowAwA3YgNhBuxFGFBsAwAwA3YAUQGAGAGA
G7FUY0QGggwAQ0UGiA01cASUGgBLQAkoMtcgENWAEtACGVANgCGgAckEA2gAUioByAByCAUgAMig
DIADIIAyABMoAyAAyCAUigDIACwAbKgQwAbAByAByKgSFGBBoINNXChLANBBgBgBm0AIAYAf/9H6
Ond8p+VTRUCQDRQYAYAYyA0EGAGmFCSgwA0AYEGEBoAwAwAwAQUGAGAGAGEBgBgBoINAGAGAGmiq
NAGAGEBoINAGAGAGAGAGAGACWig0AaIDADADADADADADADAgQFGgDADADADADADADADADADADADA
DADADLBBoAwoMAMAMAMAMsAasAasAYFGFBgBgBgBgBgBgBhAaAMIDADRUGAGAGAGAGAGACSqMAMA
MAMAMAMANBBgQYAYRRoAwAwAwASFGAGAGAGAGioMCDADADADADAo0QCSqMANBBgQYAYAYAYAYAYA
JaKo0AYAYAYAYAYRRgBgBgBgBoIMCDADQUaKDQUYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAY
EGggSVRgBgBgBgBgBgBgAsgMCjADZUGAGACkRRsIMAMANhRsqhSIgwIMAFEaGFBtBBsA2RRgBtAC
wgwKMAMAFogNlBgBgBtACyAwA2UGAGACyAwAwAwAwoNgCkgDZAYAYAYAYALTANgGXsAJcgBIBgBg
BgBgBgBgBgBgBgBoIMKDTZAJCjADADQQYAYAJbChIQYAYAIbuUGgDADQZCA0MANBBgQYAaQUbAFo
A2ALQAoAWgAkSKFoAIgoIgAiCgiACIigqACIAKgoLEALEKCxACoigqACoAKgoKgAsQoLEAKiAKgo
KgAiACxCgsQAsQoJEigsQAsQoLEAIgoKgAqIoKgAqCgsQAsQoJEALEigsQBcQAkQAiCgiAFoAIAE
QBsKMRAEKDADZFGAGAGAGAGAGioMAMAMAMAMANBAloA0FCWECABLAEhAMKESCAcggFIoBsiAbKAb
CAbAEsIEMAEwgQADYANgCGECABDKBDQQDYAgIENACGAICBDRQIaAEMIENACGgBDAEACGAIaCBDAB
soBtACGEA2gAbQAhgAmEA5AA5AA2UAmggQAIABtACGggG0UCHmECADQAloASAaCDTQBoqjABSIDY
BsqhSRAKAFoAIgBaAFoAIFBEAERAFiAFiFBYgBURQVABUAFiFHQegGE8ZWnVeyEbLrl+SZjJ36UE
H0ixfyzF1ZblLVXVHL3XLGM7ui6dB8OsPRqV5ZJu1+UVd+31GcnbpTU2KBicQ8XUlUe2Um+8089u
x0noxTWjMHPES9K8uyOSXffvMV6cPE2OdTm6rcntbbfabeYdJ6OU1ozCSry2yvLsWxd/tMXy9OHi
bFAnUdaTlLa22+tm3nF/6LYZYSjPETyvf+GO31+wxXfpzU2KfiK0sbUlN7ZO5pyt2LX0Y0e9d1Ze
jkut/l7TNrr08fUM9J4pYuq5LYsl1L9XusixnK7oXovC/LKqXorN/rn+kKuM2JPT+L15KkvRzfX/
AKdW0kazogoRdR2Wbb/XL2lc4LfiprRVBRXnPLbv3szy7X7MFVUd+xd35s04iyaGwqpp1Zdm7Le/
zJXXCeojcZiPlM3J5LdfhyX6RWLdjKFB4iSiu98OS/SBJsTmka3yaCpxsrrfwMx0yuhBLylfbzeS
7F+uo05Cb0bQUV4yT6tyXF/qxmuuM9QwxNf5VJ7WtyWz9fq5qMZXYFGLm9Xjuj73/qGROVZR0fT1
Vk3+rmeXb2RBJb0rfal+vizTkHeCw6xMru8ktrf6/XAlaxmw50liovyE8ltS9n6uIuVEZnFboL1/
H3FYEro7CxivGNdTft5EreM9Qxx2JjXlxS2JbP1+riM5XYaNSeUnqrgtvdt7ysifwuGjgYObWds7
+zgv1mZdpNCu4qsqsnKb1nwWxcr/AA7zTlbsajTnWtHKKexbL9m19b7wcifhTjomnZLWm+9v4GeX
X2RV6/lycqsrvgs38F6+o04/EboRqYl6tGOquK98vcrdQJ54Fhq1YaCpWWc363xfIzy6+zBVqzq4
ryqj1YvPPJdiWb68+s05XyEYemqs1ClHWk/SlsXO2zvuVJ9wt+IxMNDU7SlebXW2+NuHBZLcY5d7
e0Ud4uVWX0UXrv0vOm+3d2W6zbhsZQ0d4+ajKWtN+jF3fbLYvW+Q2THYutTU0JS1aMbzexe+T4Ln
1GOXb2eBz+u4KTnVl4ybzai8u2Xuirc0dHAJpqvpT6OlG0fqxyj2vf2tscJN0XSMaXRShd+VUl3y
fDqX6zZjl39iCj4ividNtyk/ITzz1YL3e1m+HC25BtGFKi1GKdao3ZLNQv8A4pfy9oT+I6Vo/DfN
FLxleS1rbMoxj9mKyS5vfzMXy9MnbyOe6W0tTxNR1JfSy3J3VOK4JZOXW9W/A3I8+WWxFuOI0xm/
Mjvdowj7EupZsvDPnIX/AEL0do6Ej8pryTkle7VlHqTzv12fK5i3bvjh2+aKfpnSNfpRN+LTVGGy
7tFc5N5X9mxc9SacssrmIV/JsB/x+faqa9kpfyrrKx4n3gMpYnTj1UnJR2RVowivVGK5vvHB5yGn
Sw2jvPfj6n1YtqC65bZfhsvtA8T7w3qYnEaaapQTaXm04K0VzsvW3nxZeE3cgp4LD6Ozry8ZP+7p
vJfens7I360DUnIaYjSdbSFqNNasG8qVNWTfPfJ83djSd2/AK9EU8Bni56r/ALqFnPt3Q7bv7I2v
brkN6+m5OLpUIqjTeTUfOl96W19WS5DSXL3eBqloJ0YqpipKhB5pNXnL7sNva7LmNnb7xuem44Fa
uDh4vc6jzqvt2R6o262TR3a4/pDTCaGq49OtNqnSvnVqOyvy3yfKN2NpMdhz84YbROWGh4yov7ao
sl9yGaXJyu+SLy1uTgR9LDYrpDUclrVJ7ZSbyS4uTyS67IcMauQe6mD0P5zWJrLcrqlF83k59lo8
2OWvE+/8hHYvSOI03KMZXluhTirRXKMVl3Zjhm25CSWhqWi/Kxs7S/uYNOf4nsh23lyG9t9uufwD
bGaenXg6NGKo0fqQ3/fltk+vLki6ZuYXg9ATqwVatJUKL2Tntl9yO2XZlzJsmHrfAdS03T0YtXAw
1XvrTs6j+7uguq7+0NNd2uPxEVgtHV9NTeonN7ZSbyXOUnkutscMyXIS/wCyaF4YqsuvxMX6nP1R
6xy14x+/8hFYzSFfTE06knN7IxWxcoxWS6kXhi25CXhoOno5KeOm4b1RjZ1H17oL72fIm2+3XP4B
tjdPSqwdGhFUaL2wjtl9+W2XblyGkuXu8AOjtB1dIRdTKnSXnVZu0V273yV2LUmOxJfOeH0NlhI6
9X+/qLZ9yDyXXK76hrbW5jx+Igkq2lavpVKs3zlJsvDPIsHzZh9C54uXjKq/sIPZ9+ayXVG75ozv
bepjz+AjdI6bq6SSg7QpR82nBWguze+buyyMXLYNgNAzxUPHVZKjQ/vJ7+UVtk+rvFqzHYdz05T0
YnDAxcXsdaWdR9W6C6s+ZNL3a4/EQOHw1XSNTVgpTnJ7Fm3z+LKxJsWP5FhtBZ4hqvWX9lF+RF/b
ktr+zHtZOXTUx5EPpLS9bSrXjHaMfNhFWjFcFFZL28zUmmblsRoYGAGwo2AKSCDYBsKMANpEAoA2
UGAG0iKFEQbKDCg2RQpAGEQbsVRsA3YA2QGwDYUYVApIgNhRgBsA2kUCiAwA2AYFG7AG7BBsA2AY
AbCjADCA3YA3YIN2CjYBgBgBgBuwBuxAbAMAMANlBtIKFEQYAJaKoSRBgAhoqjREGmrgCSgwAQ0F
Ggg01cAQAIZQDYQDYANhANgA2ADZUAmACkEAZAAZFAKQQAkACkUAZAAZFQCYACQAJgA2VAhgA2AD
YANlQICjADQQYEGmgoQAYEGAC0rAGwDAD//S+jp6Hyn5VNEQaZQJKDADADADREGAGACWFGigwA0E
GAGiAwAwAwA00ECSqMAMAMIDADADQBgQaAMAMANWKo0AYAaIDAg0AYAYAYAYAYAYAJaKDRAaAMAM
AMAMAMAMAMAEMoMAMIDQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBlggwA0UGAGAGAGAGWANWANA
GFUYAYAYAYAYQGiAwAwA0VBgBgBgBgBgBpgGiqMAMAMAMAMAMANBBgQYAYRRoAwAwAxgCQowAwAw
AwA0VBgQYAYAYAYAYRQloA0VRgBoIMCDADADADADADABLKo0AYAYAYAYAYFGEBgBgBgBgBoIMCDQ
UaKDQUYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAaCDAgSVRgBgBgBgBgBtACiKMAMANlQYAYF
C0QGBBgBgBtFUbChREGBBsKNkUYUCgg2AYRRgApBAoAwKMANgCyAwoMAMAFogNgGAGygwA2kAKID
ADADADZQbSAFEBgBgBgBgBgBgApACQDADADADADADADADADADQQYUGAGmyASFGAGAGggwAwA02AJ
CjQQYAaeQAgoMANBBpgCQo0EGBBgBphRpACgBSAFAC0AbQARAC4kUEQARBQsKCoAWgAiIoMgAiAC
oKCxACxCgsQAqIoKgAqACoKCoALEKCRADIgCoKCoAIgAsQoLEAJEKCxIoLEALEKCRACxCgqACoig
qACoALEKCxCgkQAsSKCxAFxACRCgiACIAIgBYARAGwo2gBYBgBsijADADADADADAg0UGAGAGAGAG
AGggS0AJYAhgCWAIAEMIEMAGwATKgGyIBsoBsIEMAQwgQwAcgAbCAbAEMAQwBDRUCGADZAIZUA2A
IYQIAEMoEtEQDYAhlAlhAgAGwBLQANgCGECGADZQIkADYAhhANgA2ADYANhANgAmUA2EA2AIkAIk
EA2AIABsoBsINAGACWigSQGgg00FGJBAoKNgCkgo2EG0FBEAEQAtAC0AEQARBQSJAFiAFiFBUAFR
FBUAFQUFiAdb6JR+bcBUrvfrS7Iqy9aZzy816un4mxy6+s7vabeYdXx39T6LUNkpRUe2WcvVcxzX
pv2cRzOjTdWSitraS62becdN6UVFo7CQw8d9l2R2+uxzj05+Joc+w1B4mcYR2yaS7TbzybHQ+lVZ
YKhDDw2O38Mfzt3GI9HUupoUjD4WWJkoxWbaS7TbhJsdD03KOAw8aEd6S7FtMR6M/E0KbF7Euz9f
C/UacBecS/mjCqK85q3a9r3e4zy9F+zBSb/r9ZdyfWaecXbRVNaOoOrLbLPs3Lt95mu+PibFSqVH
Wk2823f9Je805ciw6CwfjJ+Mlsjkuv2LqM10wgBpLFfKqjtsWStm+vgvaImV2AYai8RNRTs3wzfX
fZ3FZk2LBpSusPBUotpvhtt+ZmOuV14FeXk8n3y/L1M05CyaPorB03VkrN8dtvzM11xmvIha1R1p
ObVr75e5f6mnO+QbCUPlUlk2t7f6/XAEmxKaRxCivFRV8s0tyMx0yvoIZvc32R+P+ppyE5gKKoRd
SS1fbYzXXGaEbXrvEy1kstzf6t7WVi3YDGPjZJK8pPu+PsKgna1WOAhbe+C9Znl1t0IJN7V5K4vb
3/A05BzgsNGvLiltb2fr9WJWsZsO9JYmKWonlvS9nL9ZCLlRExcrXitVcfz+BXOCT0bgov6R522c
Oslrpjj6hppKv4+VpO0VsW987fGwjOV2I+Mm/wB3Hteb79i/WZWRO4HCLBRdWq/Ktt4L4ma64zXm
iHxOJqY5uTerDdfJW9/Zc0527EenCDtFa8uezsW/t7ggtWHgtG0/GVX5Xs5JfAzy6z7PIrOJx8sV
UvCN5PY3m+xbF63zNacrlsNXh9aX0km5P0VnJ9b2L1vkVNC44fDw0VT1lHyrZpZvqv7Xkt5jl3k7
RS8ZVjVm51Za8n6Mdi5a3wv1m3C/eA0/HY7yKUbR4RyXa9/aweaLbhsPT6OUXOec3t5vgv1zM8us
nZBT8TiMRphuUnaHXaK93tZqeHK25BrGNKi0op1ZvZtUb9W1+rtKyOgYGh81UvGV5JStsyUY8ktn
Xx5mOXok7eRRdJ6UhiKjm/pZbr3UIrgltfW7dRqRwyy2I90q+lLSk7QWSb8mC5Ld2JX5F4Z80XnR
ehqOgIPEVZXkltatbqW27791lmYt27449vkU7SeKr9IpudtWlHJOTtFdb2X6s9yNzw5W3IRbnQwW
xeOnxd1Bdm2XbZcmVjxPvF40BoqdZLFYt5RV6cHZRivrWyS5d5i13wx9aInpJ0ko4t6sb1Ix2LNQ
vxe+XJZLrLIznnKKjKeI009VJtR9FJRhFeqK633muHHzkNOjh8B+8fjp/Vi7QXXLa/w5faB4n3hv
VxeI0u1SgvJ3U4K0e5bet3fMcG7Rt4Gho/PET15/3dNp/wAU80upaz6gak5DXEaVq4peKpJU6b/s
4Lb1vbJ9bZdJcthfzPHBeVi5+L/43HOo+tbI/iz5Mmzt1yAVtNuknDDRVGDybTvOX3p7exWXIuju
93gDo6Dm4qpXkqNN5qU/Ol92O2XXkuY2kx94X8709HZYOFpf3s7Of4V5sOy7+0TS92uPxDLDaMxG
l3Kq/Nv5VWbtFdcntfJXfIu2ZLQ5dfCaJ/dx+UVfrzVqa6obZdcrL7JOV3J94j5TxXSKql5VWe5L
cuSWUV3JDhPOQevA4XROeIl46p/dU35K+9U90b/eQ5XUnIYY/TVbSCVNWhST8mlBWj3b3zd2WRLl
sOafR9YRKpjZ+Ji81C16suqG7rlZdY2vbrn+kaq6f+TRdPBw8RB5OV71JLnPd1RsusaO7XHgNdH6
EraSTqZQpLzqs3qwXbvfJXfIu9JMdiS+XYXQ+WHj46qv7WovJX3IP2yv1InK7k4ETKeI07Vz16tW
XW3+S9SHCechL/NuG0PnipeNqr+xpvJffnsXNRu+aJvbWpjz+AYaQ05V0hFU8qdFbKcFqxXWt75u
7NSaZuWw6wfR+UoKtiJKhReyUvOl9yO2XXkuZLVmHv8AAcT07DR6cMDB09zqys6r6nsguUc+Y0vd
rj+kRGC0fX0vNxpxc5bW+HOTeS62XhiS0TXi8JoTzmsTWXor91F83tn1K0ebM8t+Mfv/ACEPpDSt
bSsk6srpZRisoxXCMVkjUmmbdiVw/R75PFVcZPxNN5qNr1Jfdj75WXWTbUx9/gZiNP8AiYulg4+J
pvJu96k/vS9ysusmi5+7wIzR2iq2lZatKLds29kYri28kustumZjsTWthNB7LYmut7/dRfJbZ9to
9ZOWvGP3/kIPH6RraUnr1pOT3cEuCWxLkis275Exh+j6w8VVxkvE03mo2vUn92O5c5WXWTbcx1yN
YrT7jB0cLHxFJ7bO85/elt7FZF0lz9wrpXMYAYAbCjaQAoINgGwowA2kQCgDZQYAbSIoUEGwDCg2
RQqwBgQKCjADdgBRAYFGygzaEC0rEBgUYAbAFJAGwDADYUbsAKsEGAGwDAo2AYAYQG7BBuwBuwUb
AMAMAMAN2AN2IDYBgBhQbAMsFCrEBsIMAMAMAEtFUJIgwASVQkINMihJUGACGgo0ECWgAbKBDCAb
ABsAGwgGwATKgGwAMgAMggDIoBSAASCAMigFIADIADIqAMgATABsIBsoEMAEwBBUCWgBIUYAaDIw
AS0FCQg2kALAMANhR//T+jp6HyX5VMIo0VkJCjRQYAYAaZAYEGAGACQo0UGMA0EGEBoAwAwAwASy
g0AYAYAYQGAGAGgDQQYAYAYAJKowAwA0QGBBoAwAwAwAwAwAwAS0UGiA0AYAYAYAYAYAYAaaKg1Y
A0FGAGAGAGEBoAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwAwINAGFBgBgBgAkqjADADADADADCA0Q
GAGAGioMAMAMAMAMAEhRhQYAYAYAYAYAYAaCDAgwA0RRgBgBgBjQAkKMAMAMAMANFQYEGAGAGAGA
GiKNMA0VRgBoIMCDADADADADADABJVGgDADADADADADCKMAMAMAMAMANBBoA0UGgowAwAwAwAwAw
AwAwAwAwAwAwAwAwAwAwAwAwINBBjChJQYAYAYAYAKIDYUYAYEGygwA2goURBgBgBgAoqjaIDYQY
AbQUbIo2ioNgG0QGBRgAtBBsKMAMAFIIFEUYUGAGwBZAYAbKDADABZAYAYAYAbKDABZAYAYAYAYA
YAYAbSuALAENWANAGAGAGAGAGAGAGAGggwoMIBNwo0AYAYAYAaCDADABIUJCDADABEgDRQYAaDIQ
w0MANBBgQYFCCKNoqBQQKQUKCBSChQAtABIkUEQAtBQQAIgoIgAkSKCoAKgAqCgqACxCgsQAqIAq
CgqACoKCoALEKCRADRIAiCgyACIAKgoLEAJEKCxIoLEAJEALEKCxACxCgiIoMgAqACxCgsQoJEAL
EigkQAkQAkQoIgAiACIAWAFAMCjaAFgGACkRRsqBJFGAGAGAGAGioMAMAMAMAMANBBpgCQBDAEgC
GAIaCBAANgA2EAmUA2EA2ggQwBAAhhANgA2ECGADAEMAQwgQ0ADZQIYQIYAgIBsASwBAQIZQIYAh
hAhgCGAIYAgAQwAbCBDAEMoBsAGwgG0AIYANoAFIIBsAG0UA2ggGwBDABgA2ECGADkVAhoASAaAM
AENFBogNBBsKNgG0gBQBsKFIAWgAgAtEARFULiAEiAEiQBUFBUAFQAVEAWIUFiAEiFHXdN/1XouF
LY5KEe3zn7Gc55r1ZeMRzzRGF+W16dPdKSv1b/Uarz4zdF36eYq7p0luTk/YveZxd+rRCdE8J8qx
UW9kE5Ps2etotc+nN0Pul2JeKxOos1CKXa837UuwYtdS7oP0S0c6lfxktkFfteS9/cS1enPIVp/E
rE4h79XyV2bfXvQhnd0O+jOG+UVnN7IK/a8ly47O4VenNhvp7F/Ka7S2R8ldm3jvvmrdYiZ3dBNA
YX5VWTeyPlP3evixTCbocdIcX8oq6i2Qy7XtzeXARc7sR+j8K8bUjFXs3m+S5vf1Cs4zYsnSDEaq
jSWza87LkvyRI650V2EXOyWaeXBfF+0rkLhiX82YdQVrvLgrva/1mZ5dr9mCqryllmuXkx/PtszT
kLRoij4iDqSas9lslZfreZrrhNCEr13iZNt3b9GPsb/1NOduw40fhnXnbJJZtLbbm/11Eq4zYkdL
YmzUE0ks3x5WX66xGs6IdK+aX4pfr4lcxZMPT+RU3J5yf6SMu08QQFWo6jbnK99y/Vvaacth7g8N
KtLZqxW3j8fYiVcZsPNIYhvyIJWW17ly4CNZX0EO2m825PlsKwJ3BU/k8HOeXLgviZrrjNCLq13i
ZOUV2vd7kVzt2AxgqkkruUn3d/66yoJ6rOOAp2Vk/wBZmeXW/Zgr8ZXfkq74vP1bO+5pxDrDYT5X
LypXtttn69ndcjUmw90hWcV4uGS3vYlyJG8qK+3Cn9p9y+L9RpyEvgMHKu1KplFbI7Ffq/VyV0xm
wHSOkXXlqU1ez4Xu+SEiZZbETOGd6ss+CzfwX6yKx8RYNEYVQXjHFRW6+btxb+FjNdcYInSmMjiZ
eU7pbIx9rfwv1ljGV2I1SqV01BasN9sl2t+9lZ5Fj0bo2OjoutUavbsS+JLdumOOvIgMdiaulZOX
m0lsu7R7eL72Xhzt7hGuVKhsXjJc8o9219tuorPAuOjMM8JDx+IdmlktiiuSWV337jNd8ZrzRWdK
6Xhip6yWvbzdbzV1R3vm+41I5ZZbEbKlVxtp1Hqw3OWUfwr3RRWdbFx0VomloqHj6jd0r3krWXJc
fX1bDFu3bHGY+RV9KV6umpa78iivNcnZfm+q5qeHLK9wiXWo4TzI+Ml9aS8nsjv/ABdxWfEFy0Jo
2TSxWKexXgpZKK422Lkt23qza7Y4+tENp7pFTxkrQjrqOzWyjfjq7W+uyXAsjGWexXHTr6W8pvyY
+k7RhH2JdS7jXDn5yFw6P9GKMkq1R66WaytF232ebXN2T4NGLXXDCciP6QaXqadk6GGTdKPnS2J8
23ko8L7dvAsmkzy7vEFWdLD4Hz346f1Yu0F1y2v8Nl9o05eIAVMVX0ralBeTupwVo9y29bu+Y4Td
o3LA0cB+/nrS/u6bT/inml2az6ga1yG1fStSuvFUkqcHlqQ39b86Xa+waO4b+aI4Ra2Kn4v7CzqP
s2R/E11MbO3XIFU018nWrhYqktjle9R9c93VGy6y6Tu1wAUdDTqx8bWkqVN+nPa/ux86XZlzGyYh
b0nR0blhYXn/AHtRJy/DHOMet6z5oaNycBlRwWI03KU85fWqTdorrk8kOEkuQca2E0Vs/aavF3VJ
PqylPt1VyZOV8T7/AMhH4jF4nTs1F603sjCKyXKMVkuxF4ZtuQevRdDReeLnrT/uabTf4p5xjzS1
n1E2vbJz+AZYzTtSvB0qaVGj9SGV/vPbJ9b7ENFy2F0Oj8tVVcTJUKT2OXnS+7Da+vJcxsmHv8Ak
tN09GrVwUNR7607Oo+rdDsz+0XR3a4/ERmD0ZiNNTlKCct85ydornKTyXa7l4ZkuQk/2PQ3DFVl1
qjF+qU/5Y9ZG/GP3/kIzG6Rr6ZmlNuT2RglkuUYrJdiLrTFtyErHQVPRq1sdPUe1UYWdR9e6H4s+
RNt9uuQDFdIJODpYaKoUntUfOl9+e19WS5CRLn7vABo7QVXSKdTKFJbak3qwXbvfJXZbdJMdiT+X
4XQ2WGj42qv7aovJX3IP2yu+SJy1uY8fiIWpVr6Yq3k5Vasutt8l8C8MechN/NFDRGeNlef9xTac
vxyzUepXl1Gd7b7ZOfwDLH6eqYyPioJUqK2U4ZLrk9snzdyyJctjNHaBq4+PjHanRW2pPKPUt8ny
VxbomOxI/OuH0Nlg461T+/qLP8ENket3fUTW17pOPxEA3V0lU9KpUk+cpN+00xyLAtEUND+VjZa0
91CDWt+OWyPUry6jO9t9sx5/AR+kdO1cfHxUUqdFbKUMo9b3yfN3LpLlsa0boOrpJOatCkvOqTdo
Lt3vkrsbJjsSnzlh9CZYReMq/wB/NbPuQezrldk1trumPH4it18RPFSc6knKT2tu7Zpzt2AhBgBs
KMANgCgg2AbCjABSRECgowoMAFJEUbCDZQYFG0iAURBsoNhRgAqxAbANhRhUG0rgCiAwKNgGWKBV
iA2AYAbChSQQbANgGBRsAwAwgN2CBVgDAo2AYAYAYAbsAKIDADADCg2AbsFG7EBsIMAMANhRsA0A
aCBLRVCSIMAElUaCBLQUJANBAloKEsIBgCGUA2ECJAApBAOQAKRUA5AApBACQAKQAGRQBkEAZFAG
QAGQAGRUAJAA2ADYQDZQDABgAyg0EGmgBIUaCDAgwARYAWAYAbQUKCD/1Po6el8l+VTDKjRUGmAJ
KDADADADREGAGAGmFCSgwA0EGAGEBoAwAwA0wgSVRgBgBgBhAYAYAaANBBgBgBjAElUYAYQGgDQQ
YAYAYAYAYAYAYAJaKDQBogMAMAMAMAMAMAMsEGAGig1YAywBqwUYAYAYAYAYQGgDADADADADADAD
ADADADADADADADRUGAGAGACWAYVRgBgBgBgBgBhAaIDADAg0UGAGAGAGAGMASVRgBgBgBgBgBgBg
BoIMCDADCKNAGAGAGmAaCjADADADADRUGBBgBgBgBgBpkUJCjCgwA0EGBBgBgBgBgBgBoA0VRoAw
AwAwAwAwAwAwijADADADADAgTYASVRgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgQaCDTKo0A
YAYAbQAogMCjADZUGAGACkRRsIMAMANgGytBSIgwIMANhRsKNoINgGyKMANgCwgwKMAMAFoiDZVG
AGACkAKIDADZQYAKQBsgMAMAMANlBtACiAwAwAwAwAwAwAIAYAaaAEAGAGAGAGAGAGAGAGioNPIg
EhRgBgBgBgBoIMAMAEsKNAGggwAwAGUGAGgg0wBIUYEGggwASwo0QGIoFhBtBQsIFIKFAC0AEiRQ
tABEFBAAiCgiACRCgsSAKgAqCgqACxCgsQAsQoKiAKgAqCgqACxCgkQA0SAIgoKgAqACoKCxCgkQ
AsSKCxACRCgsQAsQoLEAIiKDIAKgAsQoLEKCRACxIoLEAXEAJEKCIAIgAiAFgBQowAVEAUAbIDaC
hRUGACbEUaAMAMAMANFQYAYAYAYAYAaYQIChLCBAAlgCQgGFA2ggGwgHIAFIIEMIBsoEMASwgGwA
bABsIBsAQwBIQDZQIaABsIEACGgBDQQIAENFQJaIAbAEMoEsIEAA2AIYAhgCGEA2AIZQDYAhhAOQ
ANgA2ADYQDYAJgA2UA2ECAAbAEMIBsAQygGEGmgBIBoA0AJaKDRAYAKSuUCiA2FGwBSQAtABEALQ
UEAFkAtFAVEAVABUFBYgBYkUFiAEQBJ6Kw3yuvTp/WnFPqvmStYzdHQPCBic6VP70n7F7zGL0dWi
N6DYXx2Jc90IvveXsuXJjpTyG/SWUsbi6j2Ri1FN8svbcRM/NFr6HYNYWnUqve7X2WSzft9RmuvT
mhUcRiXiZym9sm33/rdfqNOVuxe9BRWjsJKs9rvLuyX6y2ma74eIKE56+b3u76/Z7WbecX/Rf9V4
N1Xtact+/KPu7zF8vRj9mCi3u+b9fYs+804C/aFpfN2GdWSd3na2fJW5+8zXfHxBT5S15XfnN7/K
fdsXUzTiLfoDDeKjKtJO7yTbu7Lb/pyM12wmvIruKr+PqOcrJt7831W2Lt7yuVuxM6EwfjamvJPy
d8nnfq3frMldMIB6WxHyipsSUck5bObS3+sRMrsNsJQeMmlZyXF5JLfZfrqKkmxPaXrqEVRir5Xa
WxJbL8u4zHTK+gr7e5v8Mfj/AKmnIWjDRjo2jrNWbzfHkjPLrPswV9Nzblbb6Uv1b2s05CR0bhli
J6zblq791/11dRK3jNhelMQqstW+S3Lj+usQzoYwUtyUb979/dkVkWCMPm+nlnJ+34GeXX2YICpL
Wd5yu+C+OzuuacQ+wVCVaWzVjv4vt2+4lbxmwfSGK134uKvbaIuVEXPPz5di/Vl+sisCbwNKNCOu
0l7bdZmuuM0IjE141pOT8rgtiXvfqNOduxqNOda0X5KexbPV733hNbEzNrR1PVjnJ7Ob4meXX2YK
/UV3epLPgs38F+sjTj8QXB03iZ6sFqrfLa+/4WFXHyJTSONhho+LV72ztw6zMdMrrwK/edVeSlGO
/cu1vaacg/0Zo6Fd3flJdivw4v1Etbxx2DaWxEq/0cbRgtsnknyXG3K4i5XYrrnTo7Frvi8l3b+3
uK5cCb0VgZYtqrV82PmrYu7ZYldMZvkN9LaaVZ6kEmk9rzTfVv7brkJEyzELOjUreVVlqrc5cOS2
92RpjnkWPQujaaXjXHJbHL222JcL3e/Iza64YiP01iZY92b8XRWy+2XNLa+W7mWM53Yr7xNPD/u4
3f1p590di7bmnPehZNCaKliJfKcQ27ZxUva77uHeZtdMMd+aGWmekaxL1KcU4p5SlnnxS2dV79SE
iZZ7EBLDVcZ9JVlqxfpTfsW19SRpz1sWvQGhKM141xcktkpZJ81Hhzd78EZtdcMYGWnsfU0v5FLy
aEXnOTtGT6964JXb222CTSZXu+Aq7qUMH5q8bLjLKC6ltfbZcjTl4gndB6LqafkqtdvxMdi2J8kl
klxt1dUt06YY93IkekPSWjCLoU052yaTtHLddZtcUrde1EkazznAoc69fSzVOKbW6EFaK7F7X3m+
HDdo28HRwP76evL+7ptfzT2Ls1uwGpOQ3raTqV14qklCDy1ILb1vbLtv1DSd2xnzSsIr4qfi/sLO
o+zZH8TXUxte3XIHPTHyZauGiqS+ttqPrlu6o2Gk7tcAFHQ9StHxtVqlTfpz3/dXnS7F2l2kxCpa
QoaOyw0Naf8Ae1Em/wAMM0ut6z6iaXcnAZQw2J07Nz8qbXnTk8kucnkkXhnVyB3HCaL2/tFRbldU
k+vKUuzVXWF8T7/yDDE4/EaYkoZtbIU4K0V92Ky941pm25B18z0tHZ4ydpf3ULOf4n5sO275E212
65/AN8Tp6eq6eHiqFJ7VDzpfen5z6slyEiXL3eALCaBqV4KrVao0frzyv91bZPqXahtJiHHzrQ0V
lhIa01/bVEm/wQzjHres+oa213ScfiIqlhsTp6q9VSq1Hm28+1t5Jc3ZF4Y1chJfJcJof99L5RV/
u4O1Nfentl1Ry+0OW9SfeIzSOmq2k0oSajTXm04LVguqK383d8yyaYuWw+o9HnQiqmLmqEHmk1ep
L7sNvbKyJtrs9/gLnp+OCThgoeKTydR51Zfi9HqjbrY0vdrj+kRuA0VX0vJ+Li5WzlJu0VzlJ5Lt
G9MzG0S6WD0NwxVZdaoxfqc/VHrHLXjH7/yEVj9KVtLSTqScrZRisorlGKyXYNaYuWxKUuj6wkVU
xs/Exeaha9WXVHd1yt2jbfZrn+kar9IPERdLBw8RB5OSd6kvvT29kbLrGk7/AHeBG6O0TW0tJqlG
9s5SeUYri5PJdpeEmOxNL5HoTZbFVl1qlF+2fqj1k5a8Y/f+QhtIaUraVlrVZOVsktiS4JLJLqGm
blsSuH6P+JiquLl4im80mr1Jfdht7XZDbUw9/gbrdIFhYulgoeJg8nO96kuuW5co2XWTR3a4/pEP
gdH1dJz1KUXOT4e1vYlzZdszHYsHyfCaD/etYmsvQi/o4v7UtsnyWW65OW/GP3iI0jpetpVrxkvJ
XmwStGK4KKyXtLJpi5bEYVkYAbAMCjYBuwBuwQbCjYBgAtIiDZVGAGEApIAUAYUGEUKsAbIg2UGw
owAUQGwDZVGBApIA2RRgBsoNpACiAwA2AbCjdggUAYFGwDADADdggVYgNhRgBgBgBgBuwBu1iA2A
YUGAGwDLBQqwBsiDADADdgo2AbsAbCDTQUJANBAloqjViA0ECSqNBAloKEgGggS0FA2ggQ0UA2gg
GwATCAbABsqATABSAAyCAMigDIADIADIqAMgAMgAEioBSAAgCGADZUA2ADYAIoMANBAloA0AZYA0
EGAGAGBQtIA2EH//1fo6el8l+VTCA0QGFQJCjRQYAYAaIgwAwAwASwo0UGAGggwgNAGAGAGAGggS
VRgBgBgBhAYAYAaCDQBgBgBjQAkqjADCA0AaCDADADADADADADADTRQJANEBgBgBgBgBgBgBgBgB
gQZYAwA0UGWANWAMsFGgDADADADADCA0AYAYAYAYAYAYAYAYAYEGigwAwAwASVRgBgBgBgBgBgBh
AaIDADAg0UGAGAGAGAGmFGigwAwAwAwAwAwAwA0EGBBgBhFGgDADABIUYAYAYAYAYAaKgwIMAMAM
AMAEtEUaKowAwAwINBBgBgBgBgBgBoKNFBoAwAwAwAwAwAwAwKMIDADADADADTQQIKowAwAwAwAw
AwAwAwAwAwAwAwAwAwAwAwAwAwINBBjChJQYAYAKIg2FGBRgBsqDADABZFGBBgBgBtFUbChREGBB
gAojQwoFBBgBsijABSCBRQYRRgBsAWiIMKowAwAWiA2AYUGwDABZAYAYAYAbKDABZAYAYAYAYAYA
YALSsAbAMAMAEMA0AYAYAYAYAYAYAaKgwgEBRgBgBgBoIMAMANNgCQo0EGAGACZACSgwA0ECWAaC
jQQYEGmFCSKNFQYgAgQbQULCDaChYAtABIkULQAQKCABEFBIgBIkUFiAFQAVBQVABYhQWIAVEUFQ
ARABkFBUAFiFBIgBYgBURQVABUAFQUFiFBIgBYkUFiAEiAFiFBYhQWIAREUFQAZBQVABIhQWIAWJ
FBYgC4gBIhQRABEAEQAsAKFGACkAKANkUbRUCgDADADVgDViKNAGAGAGioMAMAMAMAMCAYUaCBAU
JYQIAESAESCAUggGwAbQQDZQDYQJYAhhANgA5AA5BAhoAQwBDAENBANgCGEA2UCWAIYQDYAlhAgA
GygSwBDCBDChDQQIYAMAQwBDCAbAEMoBsIBsAGwBDABtAAmEA2ACYANlQIYAiSABsIEMAGwAbVio
NAGmgBIBoA0AJaKDEgBZAYAKSChQQbRFC0UBEALQUEQAsAIQBEAFQAWIUFiAFRFBIgBUAXDoVh/H
4yL+pGUvVb3mcnbpzyH/AEvXynFyu8oqMfVfs2kxXqeaLN0PoRwVCpVtZN5t8Iq/vZmuvTmoKHUr
OrJye1tu/Xt/Sb6jbhsdEq/1Zo5JZSlG3bLN7OV+HYY9Xe+MRz6lB1pKKzbdu/Z+m2bcB0HpJNYL
DQox32W7ZH1bbGI75+JoUvB4eWLnGKv5TSv+b38kacZNi7dJqqo04Uo7Nu2ysskm/dtyMx26gqmD
w7xMowjsk7ZZLveb6jTlJsW/pDU8TTjRisuuystib93IzHbP3Cq0KbrvVjnfK0clnxbzfb3mnEXH
S0lgqMaME81a0eC28feZjtl4mhUovUyulyjm+/4PsNOQuKS0Rhvqyfa9Z92z3GOXb2YKtGNs7Wv6
U9/Uv9TTiLRoeiqUHWk27ra8sl7jNdsZ6iCxFf5TNuTcm3lFbO/8n1mnO3YkNGYaVaedoxjm0tvU
9/Y+4laxgc6VxEqktVWUY73x5fq4i5URMEqjsrzk+74+wrmLLVmtHUktjfBbzPLtfswQEbrOKUV9
Z7e/4GnESmi8LGb8Y7u2x8yV0wgDj63jpZu0VsSz7eAjOV2G1KLn+7jbm/js7syswTlSa0dT4yfr
fEzy7eyISWtLzmop7vy2vt7zTkHej8PGtLZdLa38P9SVrGbBtJYhT8m+S2pbW/1/oIuVEZCTfmK3
P893qKwJjBYZYWLqTedtvIzXTGa8iMxFapi8/Nj3K3vNMW7DWEY3SiteT7F8fYGRZHJaPp5tJ+q/
UjPLt7MFWqVoptpa0nvl8PjfqNOOwangqmNklJ269tuS3epBZNiWx+KWjoKlT862XLn1szHTK68Q
VydFt61WVnwecu7d22NOVnvDzRlBYqdoRtFbZPN9S3L2riStYzYldM4yNOPi9bVv51s5W4W9t2iR
vOipLEqm7Uo2fF5y7Ny7Ffmbcd+4SWjtCzxc9et5qeabzfJ8Od8yWtY4b5DnTWmnTfiaOVsm17ES
RrPL0grU8I761aWrfjnJ9m3vsacte8TugsFHEy1owtCPpSzk3wW5c7Z8yWumE2HfSHFuqvFayp0/
Sk9suUUs2uex8SRc6Ka8XTw37qN39eeb7I7F23fM2471wJTRGh6mmKnja2tqLe9suS5f6Et03jj3
ciS090jjhr0KKi7ZNvYuSW/2brEkazz14gpzpV9KvXk24r0pO0V2vJdS7jXDj5ondBaDo4yed6ij
50s1C/Bb5PuS575a6YYyiX09pSSXyTCR8pK0nHZFcOC5vd17JI3nl6QUJ4ahgv3svGS+pB5ds/8A
g36zbhqQAraQq4teKprVg9lOC29e+T67jSb2NvRccJniZ6n2I+VPtWyPa78hs7dcgVTS/iE44eKp
L6yzm+uW7qjZDSd2uAGloidSPjKrVKm/Sntf3Vtl2K3MbJiNvH0dH/8AE8Naf95USf8ADDNLres+
oaNycBnDDYjTcnPOb9KcnkuuTySLwmrkDOGF0b5z+UVOCvGmut+dLs1VzZOV8T7wwxekK+lnGntX
o04K0V1RX+vMutM22hw9DU8BnjJ6j/uoWlUfXuj25/ZG17dcgNbTsqcXTw0VQg8nq5zl96e3sVly
Gkufu8Btg9B1cVHxsrU6X95N2XZvk+UUxsmOw5ePw2iv+JoeNqL+1qLJfdhs6nK75InK7k4EW/lO
n6vp1aj62/yXckOGfOQkXo/DaJzxM/G1F/ZU3kvv1NnWo3fNDe2tSchjj9O1cZHxUbUqO6nBWj27
5PnJsaZyy2FYXo/OcFVryVCi9kp7Zfcj50uzLmXazH3+A4emqOi8sFC0v76pZz/CvNh2XfMa2d2u
PxERh8LiNNVWoKVWpLNva+tt+1l4ZktEz8jwmhs68vH1V/ZU35C+9Pf1R/iJy3qY8+RH6Q03W0kl
BtQpLzacFqwXYtr5u75lk0zcth1g+j06kFWryVCi9k57Zfcjtl2ZcybWYe/wHL03S0X5OBhaW+tO
zqP7q2Q7LvmNL3a4/EQlGhW0tUtBSqVJdbb5v4svDEmxPfNuG0NnipeNqr+xpvJffns61G75k5b7
Zjz+AYaQ05V0hFU8oUlspwWrFdm983djSXLYXo/QNXHR8bK1KittSeUezfJ8lcbJjsP/AJ1w+hss
HHXqf39RZr7kNket3fUTW17pjx+Ir1SpV0jUvJyqVJPm237TTHIsMdB0tFrWx09WW1UYWdR/eeyC
68+Rne3Tt1z+AbY3T88RDxNGKo0PqQ3/AHpbZPry5F0lzECVzGAGwDAowA3YAVYINgGBRsA2kAKS
ANgGAGbSAWlYA2AYUGyKNpAGwg2FGwDaQBsgNgGygwAUkQGwo2AYUCkiA2AYAbANhQqwQbANhRgB
uwBuwQbANkUYAYAYAYAbsAKIDCgwAwA2AZYKFWANkQYAYAbsFGygwAVYgMCDYUYAJaAEgGggS0VR
qxAJaCDRVGggS0FGgBDCBDABsAGyoBsAGwgEwAbABMqAUgAMggDIoAyAAyAAyCAMigDIABIqALAB
MAGygGwgGwAbABsoMsAZqhBjRAJKDTIBBQYEGACkgoUEGAH/1vo6el8l+VTADDKjRWQlhRooMAMA
MYBoiDADADQAkKMKDQQYAYQGgDADADADQQJKowAwAwAwgMAMANBBoAwAwAxoASVRgBhAaCDQBgBg
BgBgBgBgBgBjVwBDRQaIDADADADADADADADADADADADADLBBoAwoMsAasAZYKNAGAGAGEBoAwAwA
wAwAwAwAwA0EGFBgBgAlgGFUYAYAYAYAYAYAaIDCAwAwqDQBgBgBgBgAkKMKDADADADADADADADQ
QYEGBRhAaAMAMYAkKMAMAMAMAMANFQYEGAGAGAGACWiKNFUYAYAYEGgDAgwAwAwAwA00FCSgwAwA
wAwAwAwAwAwAwijADADADADTVwBBQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYEGggSVRgBtAC
iAwKMAMCDZQYAbQUKIgwAwAwAUiqNogNhBgBsKNkUbRUGwDYBhFGAC0EGygwijABSCBRFGFBgBtA
CyAwA2UGAG0AKIDADADCg2AKSANkBgBgBgBgBgApIKFBBgBgBgBphAgKMAMAMAMAMAMANBBhQJZF
GgDADADQQYAYAICjAg0AYAYADbuAYUGBAkASFGAGgyMAEsKEgGBBgULQBsAIEGIKCBAtBQuJFBEA
ECggARBQSIASJFBYgBUAFQUFQAWIUFiAEiFBkQBEAGQUFQASIAWIUFiAFRFBUAFQAVBQVBQSIAWJ
FBYgBIgBYhQWIUFiAFRFBUAFQUFQARBQWIAWJFBYgC4gBIhQRABEAEQAsAKFGAC0AbANkUKRUGwD
ADADADABLViKNAGAGAGioMAMAMAMAEMIEsASwBIANgGmEA2ACYANhANhANlAhhAggEMqAbAENAA2
EAwBDAEMAQwgQwAbRQIaCBAAhhAhgCABDKgQyAQwBDKBLAEBANgCGADYAhhAhgA2UA2gBDCAbABs
AGwAcggFIAG0ADZUCGAIABMIEMAGwBDVyoEAGAGmgBIBoA0AbQBgBtBQtAGyA2VQtBAREULRQEiA
LQAtEAWIAWIUFiAFQAREUPaOFlVzSy4vJBZA/hhYU/Oet1ZL/XlkRrQ6N0HpXlUlZKyitnG7fPct
vezGTv0hUNJ4j5RXqT4zlZ8r5Z/m+o1HLK7F+k/m7Ra3OUF/O+rg+Bj1d+MRQsFQ+U1Yw2OUkuG3
bxl32Rtwk2Lx0yr5U6K33lbN7Mlku3aYxdurfQQfRvCePxMb28i8rX4bMlks7ZPM1WMJuh/0mxCr
4jUVvISVrazu83ls78yRrqXyDdF8L42s6jXmLe7u7y6lvy2inTnkNNOYlV8RJuy1fJXpPLgtm3j3
iJnd0SnRrCa9R1JJ+SrJyed3y3ZdfWStYQR2lq/yqtKdslknJ5WXBb/X1FjOV3RI9HcOsRU1221D
Zujd8F/p1ErWE2AaXxKxlZpOUkslFbMtrfby7SxMrugmh8M69VK6Sjm1HPvfuu+oUxm6H2nMS5TU
U1FR3vbd8N/b6yRrOiKwtD5VNKKcrvOUvh8WysSbFj0vXjRiqKTbe5cEZjrldeBXc45NqK4R2/rr
ZpyFpowWjaN1lJ55vezPLtPswVptSed5yfd8X6jTiJ3RWHk25ysktiXHn+eZK6YwNcXiXip3ilZZ
KT/PL3hm3Yb06arSSu5Sfd37f1tKkmxO4yccNT1ItRv7DMdMvEEFG2yEdZ8X8Pjc05CZ0fh2vpJv
Yss9nEldMZ6hlXxM8VJuKslkn+b2dgS3YbQpqUkvOk+xd+39bSsierSWCp2jZP8AWfH2mXW+BXta
Mdi1nxezu/XUachIYTCTxEk5+at35bibamOwTH41yl4uCvbtz6hIuWXoIqpC+dSWfDa/y7SufxE5
o7DRpR19W3De7frgZrrjNCHxlRV56031RWbt7F+sjUYy8hrCpKb1aUbPlm+/d2WDM+4WCCjoilrS
zk9vN8DPLrPsivTxVTEyeorN7bbe/wD0Rpz3sIw+BVWSi3eT3Rz73sXrBILFiai0ZTVOirzexLPr
bM8ul+zwKjKjGm71ZXfCOb7XsXrfI046DjAqeNnqUkoR3tbbc3t7FZchWp54Fhx+MpaLp+Ki2nbY
s319b4vrsTl0yvaKX8sccqMdW+9Zyfb8LGnDfuDzAaBnjJ+W9Xe1tl3bu3Pkxa1MNiZ01pRaLgqF
DKVt3or4v8zMm28su3xBUHgZy8utLUTzvLOT6ltfXkuZvblr3iT0ThY4ypq0Y5Lzqk0m11R2J8L3
e8laxm+BZ9NYueHp+LptRurOpJ2SXXtcuq7RmOuV0OeSq0MJ5i8bL60so9kdr7e428/iA2CwlfpD
UUW3qra/RiuS2dSQvgkuQuWk9L0ejlNUKUbytsTtbm3xff1ZGJNu+WUx8DnNfHVtI/RxWTeUILK/
Us2+bu+Z04ebdo29HU8HniJ2f93Czl2vZHtu+Q2vbrkBq6WlTWrQiqUXt1fOfXLb2Ky5DSd3uA6e
iJta9ZqlB75bX92O1+zmNnaNvSFLA/8AE8Ly/vKiTf4Y+au275jRvXAZ08LiNMyc85fWnJ5Lrk8k
OE1cgVxwujtv7RU4K8aa7cpS7NVc2DxPvDHFaQr6Vap5tejTgrRXVFf6l1pLbQd6Hhgc8XPUf93C
0qnbuj258ibXt1yA1tOOjFww0VRg8m07zl1z29isuQ0nd7vAa4TQtXGR8ZK1OlvqTdo9m+T5K7Lt
JjsOPlmF0X+4h46p/eVF5K+7D3yv1E5XcnAi6lTE6dqq+vVqPYtvclsXVZIvDPnISD0Xh9F54qet
Nf2NNpv8U84x5paz6iba7ZOfwDTGaeqVoOlSSo0fqQyv96W2Xa7chpLkEYPQFTEx8bUao0f7yeSf
3Vtk+pMu0mOw6+c8PonLCQ16i/tqqTtzhDNLk5az6ia213ScfiIWTxGm6vp1asuuT/09SLwx5yEv
81YfRGeMnr1F/Y0mm+qc81Hmld9Q3tvtk5/ANMd0gq4mHiqaVGj/AHcMk/vPbJ9bY0ly2E6O0DVx
8fGO1OittSb1Y9m9vkrsu9JMdiS+cMLofLCw8bVX9tUWS+5DZ1OV3yJy1uY8fiIOviK2lqmtNyqV
JZb23yS9yLwxbsTkdBU9GLWx09R7VRhZ1H17odufIztvt1z+ABiukE5wdHDxVCi9sYbZffltl6ly
LpLl7vAZ6N0PW0o34qPkrzpPKMeuTyQtSY2iY18HoTzUsVWW93VKL5LbPtsicteMfv8AyEJpDSlb
SktatJya2LclwSWSXUWTTFy2JTC9HZKCq4qSoUnscvPl92G19bsuZNtzD3+Aapp6OBTp4GHik8nV
edWXbsiuUe8uvevfrj+kVptyd3m3tZXIaAMANhRgBuwAqwQbAMANhRgBtIIFBRsAwAxK5ALsAbKD
ADZFCrAGBBsKNgG0gBRAYUGwDErgC0rEBgUbAMKBSRAbAMANhQpIoNkQbANhRgApIINgGyKMAMAM
AMsAKsAbAMAMAMANgG7BRuwBsiDADADdiqNgGAG7EBsINhRgUYAYAYECWgDQAkAS0UGrACWiA0UG
ggS0FCWADYQDYAhlAOQQCkADkEApBAORQBkABkABkEAZFAGQAGQQBkUAJAAZBAGRQCYANlANhANo
AS4gGrBBpgCWUCSAQygwIEMKNBBtBQoINgGw0P/X+jp6XyX5VMAMIo0EGgg0FGigwAwA0RBgBgBg
BphQkoMANBBgBogMAMAMAMANMIElUYAYAYQGAGAGAGgg0AYAYAaaKDQUYAaIDAg0AYAYAYAYAYAY
AYAYAJaKBJAYAYAYAYAYAYAYAYAYAYAYAYAYAYAYAaCDCg0wDQUYAYAaIDADADADADADADADADRU
GAGAGMASVRgBgBgBgBgBgBhAaAMIDADCoNAGAGAGAGmAaKowAwAwAwAwAwAwAwA0EGBBgBhFGgDA
DTANBRgBgBgBgBgBoqDAgwAwAwAwKEEBhVGAGAGAGggwIMAMAMAMAEtFUaAMAMAMAMAMAMAMAMAM
IowAwAwAwAy1wBDVgg0VRgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgQaCDTKo0AKIg2FGBRgBsqDAD
ABaIDADADADYBsqhRAYEGAG0FGyKFIqDADZAYFGwBQQbCjADABaCDYUYAYALQBsgMANlBgAsgMAM
AMANlBiQAsgMAMAMAMAMAFJFUKIgwAwAwAwAwAS0ECQowAwAwAwAwAwA0VBhAICjADADGEGgDABA
UaCDADADTYAgoMANBAlgGgo0EGBBphQkijRUGBBgAtBRsAWgDYAQIFoKFxIoIgBaACoKCIKFxACR
Cg0SAIgAyCgqACxCgsQAkSAKgoKgAyCgqACRACxCgsQAqIoKgAqACoKCxACRCgsSKCxACRCgsQAq
CgsQAqIoKgAqCgsQAsQoJEALEigsQAkQBcQoJEAIgAiACABAowAWgDYBsihSKg2AYAYAYAYAYAJs
AaIowA0VBgBgBgBgAlhAkASwBDAEsAQECGACYANhANhAhgA2EA2UCWECGADYANgA2ECZACGADYAi
RUCGADZECGUCGggSwAbAEtBAgAGygSwBDAEMIENAA2gBDQAgAG0ECGADkUA2ADYQDYANgA2EA2AC
YANlQIYAhgA5AA2ECGAIAEtXKgQAYAaaAEgGgDADYAtKwUYRAoqjaAFoKCIgFgBEALQAuIAWIAWI
UHhBzySu+CAJKlo9+m9Xltfciba0HsI06Pmq/N59273kaBJVHN57eH6V+9dvEDFK/v8A1f2y7ADp
/RP9kwVSrzlLd6K7FuZzr0dPxBzilB1pJLa2kn183n3I6POOldMZ+Jo06adlfjbKKt1vbuOcenqc
CC6J4TxmIUs7RTeyy4db27dxqufTnkF6TV3WxElnqxSjm7R4vnLbu2Ei9S+RM9EKKjCdW+WSWVll
m7b3uzeZK30xVMRXeMnOeclKTbt5MeV29vbbrNONuxd9CQ+QYSVSyu7ySjyySu/a77eBmu+PiCkq
VntSb3Qzk/xfBvqNOAvOES0Tg3Kzi2r8Xd5Lhns4GeXefZgpqj6VtvpT380t/wDMacReMIno7C69
9aTV88tuzqXd2GHeeIKc5XylK/2Y7O/Zfnn1m3EXDRcFo6g6ko6rebW+y2Xvv+Jmu2PiCsXdVuaj
e7u5S2X9nZmVxFl0Hh9tWUtbcuC42/0RK64T1ETjMRKvOTlLVT3Lbbnb2NorFoc6Iw6r1LqPkxzb
ef5fraSrjNg+mMVGrNQzeruWy/6/1EXOhnCnOo1HKF8rLb3be8rOhP4l/IqSp01d2t8WzLpfEFfl
Zu85XfBZ+vYuy5pyE9o2mqcXUaUVu6uszXXGeoisRXjWm5Pynu3L4v1GnO3YLRw88S1F+SuGzLq9
7CybEjj8R4lKlBXdtm3IzG8rrwIecW/Pl2bX3bEacxNaOoRhHXtbhfbYzXXGCLxVRVpa0n1JZ+vZ
7Sud8hFHWqu1NW5r3sE8iZr1Y6Ogora/1cnLpb2iDjKdVeStWO+2S7WzTjyHeBwMa0rt3S4bPzJa
3jjsF0lWlX8iHmra9ivwuIuV2Ia1Olt8p8sl8X6iuYntGUnGPjJ2ity2JLi/zM11xETpDFwrzu7y
tsWxfF+rrLGMrsMl4zFrVirR4LJdv55lZ5Fhw1COhqTnPOT2+5Izy6ydorlbFVtJN22b0sl2v4mu
HK20BpYWGsot68nsjHZ2y+F+sGhbpW0VTtCKc3sSW1+2y4szy7eyKVWpx1nKtO8nm4xzfa9i9fUb
cL94zD1Z4mSp0IqF+G23OW3usuQJ54FtqVaWgKShe0nyu2+NvjkY5dt9sFHqaS1G3TVm9s3nN9ux
diXWb04dwVhNDVtIT8rydbO8tr522vr2cxvSzG0WvG4qn0aoKnTzm9nXvk/1yMzy629kFFdGvpRu
pJtrfOTtFdry7F3G+HDzQ5wWDpVaip0146o97vGC5v0mu7tJVk+YvmMxXzRSVOlHXqteTFKy62ls
S/T2szy729o5tXo06cnPEz15t3cYNN35y2Lsv2G3n17w0raUm1qUkqcHujtfXLa/ZyLpnuCY6JdN
KVeSpR4POT6o7e12XMbO33jT0lDB5YaFn/eTtKXYtkey75jR3a4DWlgq+lG55telUm7Jdcn/AKje
kktBG8Lo/wD4/PtjTX+aX8q6wvifeGOIxtfSzUM5fVhFWS6orL3jhm20OHoqngc8VPVf93C0p9u6
Pbd8hte3XIBW03KknDDRVGDyernN9c9vYrLkNHd7vAa4XQ1XFx8Y7U6W+pN2j2b2+SuXaTHYPLF4
XRn7mPjqn95UXkr7sN/XLuJyu5BGVauI05USblVm9iWfclkl1WReGPOQffNVDRmeLqXn/dU2nL8U
vNj2XfIm2u2Tn8A1xenpzi6VGKo0ntjDa/vS86XblyEiXL3eAHBaCq4yPjJWp0d9Sb1Y9m+T5RTG
0mOw6+XYXROWHh46p/e1F5K+7T98r9Qa3JwIeviK+mql5OVWo8ks2+pJexZF4Y3chK/MtHRmeNqW
l/c07Sn+J+bDtu+RNt9uufwDbF9IZ6jpYeKoUntjDzpfen50vUuRdJ3+7wGejtCVtJpygkqa86pJ
6sI9cn7Fd8hakx2JRV8Fob92vlNVenNNUk+UdsuuVlyHLW5j9/5CIx2kq2lpKVWTk9iW5cklkupF
1pi20S9Lo98liqmNn4iDzULXqS6obuuVkTbfZrnwMqdIVg4ungoeJi8nO96suuW7qjYaO/XH9IiM
Fo+tpWerSjKc3m7e1vd1svDEmxP/ACPCaF/fy+UVV/ZwfkJ/anv6o95nlvUx58iM0jpytpJKEmo0
15tOC1YLsXtd3zLIzctgmjtA1cfHxjtTorbVm7R7N7fJXFqzHYkPnPDaGywkfGVF/bVFs+5DYuTl
dk1trcx4/EV7E4qpjZudWTlJ7W3dmnO3YAEGAGwDAo3YAVYIMANgGwowAwA2kAKANgGAG0iAUAbK
DADaRFCgg2AbCjABViA2AbKDADaQAoijYBhQbSAFEBgBsA2FG7BBsA2AbCjLACkggURRgBgBgBuw
BtIA2AYAYAYAbAN2CjdgDZEGAGFBuwBsKMAN2IDYQbCjADAo3YIFJAGmgDQUaCBLRQaIDVgBBQaA
EtEBooNNACGAIkggG0UA2ADaCAbABMIBsAFIqAMgAMgAMggDIoAyAAMIAyKAMgAEggDIoByABSCB
AAhlBphAgKEhAkoNEQIZVGggSyKElAtIA2EGBQqxAf/Q+jp6XyX5VMAMIDCA0VAlhRooMAMAMANE
QYAYAYAJYUaKDQQYAYQGgDADADADAg00AJKowAwAwgMAMANAGBBoAwAwA00VRoAwgNAGBBoAwAwA
wAwAwAwAwAwA00AJANAGAGAGAGAGAGAGAGAGAGAGAGAGAGMINFBpgGgowAwAwA0QGAGAGAGAGAGA
GAGBBooMAMAEsAwqjADADADADADADADRAYQGAGioMAMAMAMANMKNFBgBgBgBgBgBgBgBgBoIMCDA
DCKNAGAGmFGgDADADADADAg0VBgBgBgBgBphQkKMAMAMAMAMCDQBgQYAYAYAJaKo0AYAYAYAYAYA
YAYAYAYFGEBgBgBgBgAloIElUYAYAYAYAYAYAYAYAYAYAYAYAYAYAYEGggwA0iqNkQbDQwAwA2VB
gBiAFkBgBgBgBsKFIoNkQYAYAbI0NlAoIMANkUYAKQQKKDCKMANoAUiINlUYAbAFkBgBsoMANoAU
QGAGAGygwAUiA2AYAYAYAYAbSKoWRBgBgBgBgBgBgBoIEsKNAGAGAGAGAGAGggwoNMgEhRgBgBoI
MANMASFGggwATIASUGAGggQFGAGggwIEEaGioMCDADABSChQQLQUbAFgC4gBERQRAC0AEQUFiFC4
gBYhQWJAFQAVBQVABYhQWIASIAVEUFQAZBQWIAWIUEiAGQAVEUFQAVABIhQWIUFiAFiRQSIAWIUF
QARBQVABkRQRABUFBYgBYhQSIAaJFBIgBIgBIhQSIAtABEAEQAQKMACIAwA2RQpFQKIo0EGFBgBg
BgBgBoA1axFGgDRUGAGAGAGmECAo0EA2AaYAgIEMAEwAcggGwgQwAbKgQwBBECGUA2AIkADYQIAE
ACGAIYQDAEMoENBAgAQwgQ0AIAENFQIaAEMgEMoEMAQwgQADYAhgCGEA2gBDRQCYAgIBsAGwAbAB
MIBtAAmUCGECGAIYQDYANgA2AaKg01cAQAYAaaAEgGACkrAGwDYUKSAFIgFRCgiKBaACACyAWgB7
h8JPEeasuOxd+wLrYlKeAhS8+Ws+C2dr227O0jWg68eqatFKMXw+N8+tNvkF2Eyk27Pb+t1vZFdZ
AbTu+fr9Wfe11ACo55ezPtsvJ72wAsE6mzO3bbtyikAdUpp4TRW+7hxV/Klx2b9u45+r1cYiodHq
Cr4qmla6ld28p5Z5yeS2eiarlhyJ7pfW168YK7cY3tGN5Zvju2LNZkjfU5D/AKG4fVVSo0rtpX1t
Z8Xd7OGy3MZNdOCoYuqqlSdR2i5Sbz8qWb4bF22a4lcbRfIS+b9H3bs5R2yzd5bLrPc9mZn1d+IK
NCm8Rayc9ycvJj1JX9SfYacORe9P/s2HhRUXK9lZZZR3vle3DrMx3z8TQqOEo+PqRp6yjrNLVhnl
vu+HbLqNVxnkWvpLiPFRhTjJRW18cslZbeOeXWZjtnRXcBhvllSKUXK7zlL15cetstcpNixdI8RF
6lGzb26q7lx55EjrnfQQmGoSrTVO6hrO1o7ed9/Y32Fc5Niy6bqOlCNOCVt7drJLZty/0JHTMVhJ
VZJNupJ5K2S73n6kVyFt0jKOBoKmmo3yyvs32/PjtMx2y8QVikr/ALuN/tS/Vl23NOQtdBvR1Bzm
7yeffsRl2niCvXnLPKCe/e+3a+zI04iZ0PhY51M3bJN5dZK6YQMsdVdebcpWjuW193xsIzldhODp
qtNRgutvPL2fraVJ5EtpTERgvF3fNL4/6mY6Z0RFNykvIWquP5v3WNOYm8LSWApucs28/gjPLpJ2
wRM6lTEXk/JT37F8X6zTn5oJg8NGtK2crbXsXx9hK1jNh/pKbaUFaMd7fsX5EjWQh9aFPYtZ8Xs7
v11GnMTmCg6MPGVHblwXUZdZ4ERiMUqsnK13z2Ls+JpytGRw9TEtKTtfZf3L9IGrRK4mstG01GPn
PZ8TPLpb2iCnTnVzm7Ln7kacg80dhYV5ZK6W1v3L43JW8ZsONK1XU8hNRgtreV+S3vsEXKiBc6dH
YtZ8Xs7vj3FcxOaLw7qfTVXkvNWxLnbYiV0xnqI/SekYYiWScktieUevi/UJGcstiMbq41WXmrsi
vcVnzRZMBgY6Ig6tRrWt3LgubJy64zt8it4nHVtKSaje31Vw5/mXWnK25BrHCwpu05a0n6EM32vZ
3XKmhc6MIaGpazilJ7lm29yvtfs5GOXf2YKbjKcq83UxElBv0dsrcEt3bY24XzyG1PE2koYeFpN2
UnnLs3Ls7wm/cLxhqENCUnOpJOpLzpSe18ONvXvMcu8naKNi9IU5Tc7eNm/SnlFdUfi+w3I4XIMl
DEaZlZa02u5e5eovCecheaFKl0VoOc86j283wXJfnyMcu8+xBRMfpmvpSVm8pejFbfe+25vWnC5W
gL0YsPniJKH2FnN9m78TXUNp265A5aUWGyw8FD7b8qffsX4Uusuju1wG9LR1XHJ1HlG+dSbsu97X
yV2NpJsLdXDYDzF46f1pZQXVHa+23UDxPvDKtiK+l5KPlTfoxSyXVFZIcJu5A70dSwOeJn5X93Ts
5dsvNj63yG11rkN62mpRi4UIqjB7VHzn96W1+pchpLl7gDDaGqYiPjJ2p0vrzdk+rfLsTGyY7BXj
MNo39xDxs/7yovJX3Ye+V+oG5OBGVauI03UV9arN7Ft7kti6si8M+cg8ei6Gjc8VO8v7qm05fil5
sey7Jtrtk5DbE6enKLp0EqNJ7Yw2v70vOl7OQ0lz93gN8FoOrjI+MdqdLfUm9WPZvb5K7LtJjsO3
jMJor9xHx9T+8qK0F92G/rl3E5XcnHkQ+JxdfTFRa7lUm8ktvYktnUi8M23ISa0FT0d5WNqaj/uo
WlUfXuj+LPkTbXbrn+kCr9IZUounhYKhTeT1XecvvT29isuQ0lz93gRuj9EV9Kt+LjeK86byjHrk
8l7S26SY2iUawWhv+6qsutUk/VKfqT5k5a8Y/f8AkIfSOmK+lWvGS8lebBZRj1RWS9pqRm5bElhe
jk1FVcTJYek9jn50vuw2vryXMlqzD3+A4enKWjPJwNPVf99O0qj6t0Oy75k0vdrj8RA06dXSdS0V
KpUk+cpP3mmORYVofD6Izxk9af8AcU2nL8ctkeaV2TbfbMefwDTHdIKmJh4qklRo/wB3DK/3ntk+
vuGkuew20boatpW/i4+SvOm3aEeuTyXtFqTG0S/jMHoXzUsVWXpNNUovkts+2yJy34x+/wDIQukN
KVtKy1q0nK2xbElwSWSXUWRi5bDErIwAwA2FGACkgg2AbAMCjYBgBuwBtIIFBRgBgApIgFFBgBgU
KSIDYQbKDZFGACiINhRsoMAFJAGyKNgGFBtIAUQGAGwDZVCkiINgGBRsA2kECrAGyKMAMAN2AFJW
AMAMAMAMANgG7BRuwBsiDCg2AZYKNgGAG7EBsINhRgBsKMCDdgBVgDADADTQAkKNBAlooNEAloAS
UGgBLRAaKBLQAhgAwgGUA2EAmADYQCYAJlQCkABkEAJFAGQACQAGQQBkUAJAAZBAJooAyABMIEAC
WVAkihLKgSAJYAkoEsgElQaZFGkigUEGBQpACgg//9H6OnpfJflUwAwAwijQQaCDRVGgDADADREG
AGAGAGmFCSgwA0EGAGiAwAwAwAwA0EGmgDRVGAGAGEBgBgBoA0EGAGAGAGmiqNAGEBoAwINAGAGA
GAGAGAGAGAGAGmrgCQDQBgBgBgBgBgBgBgBgBgBgBgBgBgBoqDGAJCjADADADCA0AYAYAYAYAYAY
AYAaCDCgwAxgCSqMAMAMAMAMAMAMAMIDRAYAYAaKgwAwAwAwASFGFBgBgBgBgBgBgBgBgBoIMCDA
DCKNAGACQowAwAwAwAwA0VBgQYAYAYAYAJYUaCjADADADADADQQYEGAGAGACWiqNAGAGAGAGAGAG
AGAGAGAGEUYAYAYAYAaaCBNig0FGAGAGAGAGAGAGAGAGAGAGAGAGAGgyMAMANhRgUYAYEGygwAUi
A2AYAYAYAbRVC0QGBBgBsKNkUbRUGwDADZFGAC0EGygwijABSCBRFGFBgApBAoijADZQYALRAYAY
AYAbKDaAFEBgBgBgBgBtFApEBsAwAwAwAwAwAwAwAS0ECQowAwAwAwAwAwA0EGFAlkUaAMANBBgB
gAgKNBBgBpgCCgwASwgSFGggwINMKEkUaKyMAMAMAFRChQQKiFCggWgoXEAIiKFgBEAEQUEiFBIg
BIkUGiAEQAZBQVABYhQWIASIAWJFBUAGQUFQAWIUEiAGQAVEUFQAVABIhQWIAWIUEiRQWIAWIUFQ
AVBQRABkRQRABUFBYgBYhQWIAWJFBIgBIgBIhQSIARAC0AEQAQKNoAWAYAbIoWVBsijADQQYUGAG
AGAGAGACbEUaANFQYAYAYEA2FGmECWAIAEACZBAKQANhAhhAJgCGUCGRAgoEMIEMAGwAYQIAEMAS
wAbCAbKBDQAhhAhgCGECGAIYAlhAgAGygSwBDCBDCgbQQIYAhgA2ECGADZQDYANhANgA2ADYAOQQ
CkADYAhlQIABsAGwgGwBDQAgqDADTVwBABgBpoAxIA2AbQUKSAFEBsKFoAWigJEAXFXICWpaKnLO
doLnt7tvVeyfEm2u0P4UqOH2LXa2uXw2L8V1zQULqYmVTNvLdw+HYm1yC7A29l+z8rr2R7QgXez4
Ptv75ewAVFbuO7jyss79bADqnufdv/hjsfWRQ41FHJ7dylm+yCyT5SyCg0vJ87K2zX3dUFs7cgDp
vSO2GwNOD1V5kfKVlkr7F1bNnYc5y9OfiCH6H0nVr6z1moxbTaUY3dllFdufqLkx0+Qz6Q1flWJq
W1pRi0rX1YJpb3v9XWWM5+aLVouPyPR8pJK7UnaPPJW+OfaZvLtj4golCHlKCag5NJKPlSzy23y5
2a6jTzwXvpTV+T0oU04xV9+eSVtlnx4dxmO/U8Cv6Bw6xmIjK0pqObnLZlsy67b+wtc8Juh/0mrx
r11T8qWql5EeLz257rbu0RrO+Q46M4Zuo5NRiorYs3d8Xm+OTfYSr04GOl6zxNaUoxVk9VSlsy4X
y9rLGcruiW6N0PGSlVcnJpaqe7PhfP1IlbwgitJYh16knKajFuySzbS429jZWLdiX6N4eMnKoo2S
yTbzvv5f67SVvpwReksRDE1ZSbctySyVuv4LtLGMrsS2hMPOU9ZpQjFbFtu+O/vJW8IAaSxPyqq1
COs45cVltdvjdCJld0awOFeLqJTknbPVWat2ZLsBJsSWlq85S1IZKO1u2T63/qI1lRC06cZySu5y
b3bO95+rtK5iy45rC0lCLUb5dm/mZjtl4gricIbE5Pnku7b+thpxFlwKeGpudTLfa1rLqM11x8QQ
dSuqsm4x1pN7Xn3L/U0572H2EwssRJObyW73ciNSbBtIYpzl4uCvblfMRcr6CNdO7vOWfBZv4frY
VgT9OmsDT8leU9213MuvEEBOCvecs+CzfwNOQe4CHjp+SrRW17X3/CxK1j5DjSVeMvJbyW1Lbf2f
rYSNZURMarvamrPvff8ACxpy37hNYOh8ji6lTa/YZrrjNeREVsbKvK8VZvtfZw7DWnO5bCIYN1pJ
Sdm921/l2gk2JjFVVoymoQ857PiZ5dLe2CuyoSflVHq345vu299jTlr3h9o7Dxrz8mOS2yln2JbF
6yVrGbD7TFWU14tNRj6Unl2Le+diRvKitOdOh5q13xeS7vj3GnLgTWicNLFvxtV+THzVsV+Ntll7
SVvGb8hvpbSVOu7ZzS3LJX4t7X2W6xImWWxButVxnkQWX1Yqy7fizTG9iyaI0UsAnWrWuldclx6z
NrrjjrzRB6R05UxkrQ8mOxW29/Pgi6c8s9iO+b3DOrJQT45yfVHb32Rds6Fy0dgKOiabrSTTte8t
qXVsTfDbuuZt274yY+RUcbOtpubqNatNZJydopdb38bZmp4cbvIMvoMLsvVn2qH/AAn6is+J94v+
isNPCU/GVvOtlCKyiuCit/F7d3ExXoxmuRTNLVVi6mviZ2t5tKHlNLm/NT47XyNRxy88iIqaVdNa
tGKpR4rOT65be6y5F0x3e4Bp6LnVWvUapwfpTyv1La+xDZMRt4qhgv3UPGS+vNZdkP8AhX6im5A0
k8RpmfpVJexexLuQ4TzkDPB0MD+/nry/u6b9s9i7LhdSchtiNMTnF06aVKm/Rhlf7z2vtduQ0lyC
KOhpzj4yq1Spv0p5X+7Ha+xW5jaTEKeOoaP/AOJ4a8/7yok/4YbF23Y0u5OBGyeI01U9KrN9v+i9
SLwz5yDt6PoaOzxM9ef91Taf8U9i5pazJtdSchritOVJxdOilRpv0YZN/el50u125F0lyAMJoSri
4+MdqdL+8m9WPZvb5K42THYcvF4XRf7mHjqn95UVor7sN/XLuIbk48iHxWMr6XmtdyqTeSW3sSWz
qSLwzbchJ/McMAtbG1PF/wDGo2lUfWtkfxdxNtduuf6QKr0hdCLp4SCoQeTazqS657eyNkNHf7vA
isDoqvpWT8VFytnKTyiucpPJdpbWZjaJbxeC0P57+U1V6MW1ST5y2z7LLmZa8T7/AMhFaR01W0na
M3amvNpxWrCPVFZdru+ZqRm5WhxhOjtStBVazVCj9eeV/ux86T6lbmNrMPkHS0vh9EZYOGtP+/qJ
OX4I5xjybuxra90nH4iCqVauk6l5OVSpJ85SfvLwxyJ6OgaejVrY6pqPdRhaVR9e6HbnyM7b7dc/
gB4jpFKMXSwsVh6T2qPny+9Pa+pWXIui5+7wIzAaMraUlqUYOT322Lm3sS5sbYmOxOfJsHoX97L5
TVXoQdqaf2p7ZdUct1yct6mP3iL0lputpS0ZtRprzacVqwj1RXtd3zLrTNytEUkVAoIMANgGBRsA
UlYINgGBRsAwAywApIINhRsAwAwgFJACigwAwihSQBsINlBsijdgDZEGyqNgGACkiAUFG7AGWKDa
RAbAN2AN6oBuwBtIA3YA2kQG7AG7AGyg2RRuwQbsAbIowoNgCrBBuxFGWAMsAbUQBdgDLAGWAMsA
ZYAywUZYA3YAywBuwBuwBlgDLAG7AGwDADADADADTQAkKNACWioNEAloASUGgBDVgDAAbAByCAcg
AcioByABSCATABMIBSKAMgAEgAMioASAAyAAyKgDIABIqAUgAMggEAIAEsqBIUIYQJYBpgCWUCWQ
CGUGggwKNhBsKFIA2Af/0vo6el8l+VTADADCA0QGFQJYUaKDADADADREGAGAGACWFGig0EGAGEBo
AwAwAwAwA0EGmig0FGAGAGEBgBgBoINAGAGAGAGmiqNAGAGiAwA0EGAGAGAGAGAGAGAGAGWuAIas
AaAMAMAMAMAMAMAMAMAMAMAMAMAMCDRQJCjADADADADRAYAYAYAYAYAYAYAYAaKgwAwASwDCqMAM
AMAMAMAMAMAMIDRAYAYAaKgwAwAwA0wDRVGAGAGAGAGAGAGAGAGAGggwIMAMIo0AaYBoKMAMAMAM
AMANFQYEGAGAGAGgoSUGEUYAYAYAYAYAYEGggwAwAwASVRoAwAwAwAwAwAwAwAwAwAwijADADADA
DQQJaANFUYAYAYAYAYAYAYAYAYAYAYAYAaCDAgwA2FGBRgBsqDADEALIDADADADYBtFUKIDAgwA2
FGyKFIqDADaAMIo2gBQQbCjADYApBBsKMANgCkQGwDZQYAbQAogMAMANlBgApEBsAwAwAwAwoFoi
jYQYAYAYAYAYAYAYAYAaCDTQAkKMAMAMAMAMANBBhQaZAJCjADADQQYAJYUJCDADAAYBhQaYQICj
TCDAgSwoSAYEGAGAGAG4hQsIFRChQQLQULiALRFBAAiACIKCRCgkQAkQoNEgCIAKgoKgAsQoLEAL
EgCxCgqADIKCxACxCgkQAyACoigqACoAJEKCxACRCg0SKCRACxCgqACoKCoAKiKCoALEKCxACRCg
sQAsSKCoAIgBcQoIgAiAFoAKgoWAbiALAMANoihZUGyKMAMANFQYAYAYAYAYAYAaaAEkUaKgwAwA
Qwg0FCGECQBDAEsIBMAGwgGwBDKgGyAQwgQygQwgQwAbABsAQwgSwAYAhgCGECAAbKgSwBAAhhAh
gCABDQQIkAIYAhlAhoIEMAGwBAANoAQ0EA2gBDQANhANlANgA2ACYQDYANgA2UCGEA2AIkEA2ADA
NNACCgwINNACADADADYUKSANgGyKNooCEA7w+FninaEXLjbd1vcubCybEtS0XGlnVnn9WGb6r7O7
WJtrtD2GIjh7+Kio22tZvte1c09VBd6DZ1XPP17uq7suy8gg1fu3cOy+X8MQgXe2fr2dzd5PsSAD
xpuOb8lPe/Jv7ZSXUFB40lBX2J735Mf+FJesKHEVZZea/wAEX/mmvWQBKauvJ83Zl5EOpyecup2Y
UEpZ3ULtb1TWqrc5vPvuuYA5wkNacYRaTbStTV32yfubXIiwdB6b11SjSjrat3J+bd5W2cNvFGcX
fq0a6F4fV8bNxkm9VXk83t7t3HrJkdKCn4ufy2pKpaU05POb1YK72be7NdRuOV8i+abj8mwUKWq2
5akdWOV7K73PhwMR3y8QVzo9Qc8TBeTBK7cVnLJb3nbPam11FrlhPIkelFSU66VopRivKlszzdk8
n3NiNdTkPeidJTc6rk5tWjd7OLS9XDqJWumK7j8S69ScpTSUm/Jhm2t12rJ9rbXA1HK3Yt2hIxwO
FlVS1b3lm77MlfL3Ga7YeIKZeNSXpVZvrt8X/KacReYNaNwd5eS2ty2OWztS4vcZduIKdSV/3cNn
pSz9vkrtv1mnGC6TqfNuF8ttyatt3y4dS9hjl39mCrLXisrUo8djftk+zI04i14ePzXhrrOTz2bW
9mW0zy7T7MFampPKpJRX1Vt7lv67GnIWbRNGOGpOok81fPa0vYZrrjNCv1X4xuVSV3wWfr2L19Rp
yomdC0lNuaiklkntd+v4WJXTCBlpCtCvUcm7pZJLh1/C5YzldgmCpyxEkorVjva4de0Ux8iQ0riY
xtTzds2ll1EjWdEVHXqLJase5d+1+srAnYpaMpcZe1meXT2YIVudZfVi+xfn62ac+Q/0bhIyete9
u6/66iVvCBGOqyxMrLKCyvsT+IhldhlGMU7Lym+xfH2FYFhn+yU8rJ9yuZduIK69SG16z7l37X6j
TiH2Ag8VLhBblkny59pK1j5BdI4qE3q3bS2pcebEMqIpVZ1PJgrLhH3vaVjYmsFh1o+DqT2+7gZv
l1xnaIWvj54iV4qzfDb3/CxrTnctgdLAupJKTs3u2vu3dthsmInMVVjoilqw857PizPLpb2wVqWH
nV8qo9VPfLa+pbWactB7o/CwxE7RWsltlLZ2L436iVrGbElpavKUfFUlZelLYkuF9n5CN5X0FWca
WH2vxj4LKPftfZbrNOPiCY0Th56Qd5WjST81Kyb9/O9zNbxmwXTuMhU+jc7RW2Mc237EvXyEXOis
Sx/isqUVDntl/Fu7LGtOW/cJzQOiHN+PrbFnFPfzfu7yWumGPrQDTHSCGIerCKkovJy2X46u/lfu
EiZZ7FdtX0pLfO3cvcl3GuHPzkLboTQEcJ9PVlF2V1bYud9/LdvzM2u2OGvIr+m9Pz0hNwptqnsS
Xpc38CyOeeexFrRbprWrSVKPPOT6orPvsuZds9vvGnj6eE/cQz+vOzl2LzV63zGjeuA0hQr6Wk5e
VN75N5LrbyReGZLkCujh8D58vHT+rB2j2y2v8K7SL4n3hpitKVMSvFq0IfUgrLt3vtuXSXLYVHQ0
oJSryVGL2a3nPqis++y5jZ2+8Y9JUsD/AMTQ8r+8qWcuxebH1vmNHdrgR0aNfTE3ZSqT3vb3t7F1
5F4Z85B08HhtH/vp+Nn/AHdN5fins/hv1ka1JyGmL01UrR8XBKlS+pDJP7z2y7WxpLkB4bQlSvHx
k7UqX155J9S2y7ExtJiCvG4bRn7iHjZ/3lReSvuw98r9Q5XcnAiMTia+l5rWcqk3klt7Els6kXhm
25CS+ZKeAzxlTUf91C0qj690e3PkTbXbrkCq6fdBOGEgqEXk2s6j657eyNkNJc/d4EXgtF19Kt+L
i5WzlJ5Jc3J5LtLvTMxtEn4nB6I89/Kaq9GLaprrltl2WXMnLXiff+QjNI6braRShJqNNbKcFqwX
Yva7vmXTNy2C4Lo/VxMPG1GqNH+8qZJ/dW2T6kTazDYdPSeG0RlhYeMqL+2qpZc4Q2Lk5XY1te6T
j8aIHE4qtpSprVJSqTeWeb6l8Ea4Yt2Jyn0ejgUp46fiVtVNeVVl+H0euVuoztvs1z/SNVekXyWL
p4KCoReTle9SXXPd1Rsi6O/XHgQmEwVXSc9SnGU5vcs31v4svDEmxYvm3C6GzxU/G1F/Y03kuU57
FzUbvmZ3tvUx5/AMdIafq42Pio2pUd1OCtHt3yfN3LpLlsQZWBtIKFBBgBsKMAFJAGwg2AbCjADA
BVgg3YKNgGAGAGWuALSsAbAMsQG7BQpIAVYIM1QDdgo3YgN2AFWAFWAMCjABSVwBQBgBgBsAUkQG
wDCg2AbCjdiINgG7AGwowAVYIMIo2AYUG0gBSRAbAMAMAFpAGwDADADADYUYAYFG7BBuwBsIMANh
RgBgBgBgBsA2kAbsAJANACWAaCjQQJasUGgBLRAJKDTVwBDVgBLAByCATABsqAbABSCAUgAUggFI
oASAAyAASKAMggDIABIqAMgAMioAyAAyCAQAhgGioEBQlhAkKEhAkoNEQIZVGggwAwKFogNlBsKP
/9P6OnpfJflUwAwAwAwijQZGgoSUGAGAGAGggwgMAMAMAEBRhQaCDADCA0AYAYAYAYAaCDTRVGgD
ADADCAwAwA0EGgDADADADGgBJVGAGiAwAwINAGAGAGAGAGAGAGAGMAGAYAYAYAYAYAYAYAYAYAYA
YAYAYAaKg0wDQUYAYAYAYAaIDADADADADADADADAg0UGAGmAaKowAwAwAwAwAwAwAwAwgNAGEBgB
oqDADADADTANFUYAYAYAYAYAYAYAYAYAaCDAgwAwijQBpoA0FGAGAGAGAGAGioMCDADADADTChJV
GEBgBgBgBgBgBgBoIMCDADABJVGgDADADADADADADADADADADAowgMAMANBBpoASVRgBgBgBgBgB
gBgBgBgBgBgBgQaCDAo2FGAGAGyoMAFJEBsAwAwAwA2VQpEBsIMAMANhRtBQoIMANkUYAKQQKKDC
KMANoIFIgNlUYAbQQLIowA2UGAC0QGAGAGFBsA2gBRAYAYAYAYAKSKoURBgBgBgBgBgBgBgBgBgB
gBoIEtBRoAwAwAwAwAwA0EGFAlkUaAMANBBgBpgCQo0EGACJAGig0ECWAaCjQZCWFCQDAgwAwAwA
2goWEG4gCwBUQoWgAiIoIAEQARBQSIUEiAEiFBokARABUFBUAFiFBogBIgBURQVABkFBYgBYhQSI
AZABURQVABUAFiFBIhQWIAWJFBEAFiFBUAFQUFQAVEUFQAWIUFiAFiFBEAFiRQVABEAEQULQARAB
EAEQULAFRAFAGACkRQpBBsKMAMAMANFQYAYAYAYAYAYAaaAEtAGgDADTCBAUaYQDAEsASEAmADYA
NhAhhANgCGVAloAGRAhlANgCJACGECABDQAhgAwgQygQ0ECCAQygQ0ECGAIaAEsAQEA2AIZQJYAN
hAhoAGwBDAEMIBsAGwAbABsqAbABsAGwATCAbAEMAGyoBsAQwgGwAbANBBpoKEgGioNNACADABSQ
UKANkBsqiVw2iKtZazWpH60sl1pbX2JktamIkqeEoYV76sueUf4Vm1zv1xIupASpjZVVqrzVuSVl
2LJdd4v3l2GznrX9e9dryj36wZGXur7Uu7qu7RXYigLCDn5Sz+1/y3LY+pflAGp0r+Us+ayXbOWx
9SswocUltce1x99SWx9WTAC0s29XOW16i1pds3s645BQuNk7K2s/q/STfb5vbGz5EP37wSVqbvK0
Xxk/GT7ti7UnzCg0otZyWf1qrz5Wgs7dkkD9+QRLxyTs5pbHJ6lNckrr1NdQBK6G+mxFKGs35cXq
wVo5O+byvbqf3iVvHkWjpriPF1Ka19W0W8leWb3PKyyzzXUzOLp1aJLozBYTB1KlnHOUryzeSWez
Z39pK1h4go2CpLHVYxtOq9ZJt5RSb77dseo24TyLp0zrxSpwcpJO7cY79lr/AKfUYxdurQPohhnG
c56molFJX853e+/VuSTFOnBA6QnHF4ipKEJVHrPblFJZbt3NtdRqOeXmi44KXzfgXOdk2pPybWzy
VrZcMzLtPEFLo05ZakVBPZKW19V/8quacRd9OT+S4eFKzm5WVrvO2d3vedviZjtn4mhV8Lh54ica
cmoKTtqLb2pZ/wATK5SbFl6Q1peTShFS9J3V0ty5cduRI650QeBw3yyrGNSes77Fmklnt2JdVyuc
mxO6frVNaMYZJZuTss+Te/qzzJHTOiFwGFhiasYtubbu9yy5vN9y6yucm6J3T1WT1YKSjG1272vy
ss32EjpmIPC0oVZxhFOTb2vJc8ln611Fc5BY9MzUIKmmorf1LYkl/pkZjrmK7BxTShFye5v4L33N
OQteKmsHRUW7Nq17d9l/oZdr4grMJpO0I3fF5vu2e004iy4KLwtN1Kl7+xbkZdZ45EJKv42TcY3k
97zfYthpy2H+Awkqs9ebvq7r3d9xK3jBmPxjqT1YpO2Se3PkJDLINFQlVktd5vdtfdu7bFZ1sTOJ
msBTUIbXkvezPLrfswQs6cpZ1Hbr293+hpy0JXRuHilr22bG/wBfEzXTGBljHLEy1n5Md1/htKzf
IBTUW1GC1m972d3xKzBP15PDU7Jq+y+xdf5GXW+IK55FP7T7l8X6jTiH+j6csW7vKEdyyTZK3j5G
9J4uFR6t20ty4838BFyoifHyn5NNWvujtfbtK57E5gMMtHwdSpk7dy4dbM3y64zXkQmJ0k60nKKS
fHa+zh2d5rTnctgMMDUxUlrZa2+W19m1+wGtiwVqkdCUbRzk9nN8eozy6X7MFVl47SDu7ytveSXu
Rpy80O8Do2GInqt6736uUV1vf2d42uOOxLaXxqwUFQorymrWW5fF/mSN5XXiCqPAqjnWkofZ2y7t
3bY1ty17xMaGoLFT+jhqwjtm85Pkty7M1xJW8ZsP9OYmeITpU8oenNuy6r+22e7iSNZ3fgU9uhhe
NWXdD4v1GnHxBNaHwlTTD1qmVGLyilaLfCy9b7CXw3jO4PukWNhL6KU9WC2xjnKXLgl193FI1nRT
paT8RlQiqf2ts3+Ld2WNace7XAa0sBVxt57I75ydl3vb2XY2mtgjlh8FsvWnzvGC7POl6kF8T7wz
xOOq4+0G8vRhFWXZFf6lZt2C/NKw2eJmqf2V5U3+Hd+Jom17dchMtLRwmWGgofbflT79i7F2l0d2
uAwo4KtpSTcU5P0pN5Lrk8u8cMyWh06OF0f58vHz+rB2guuW1/ht1hfE+8McZperi46mUKf1ILVj
3b+t3Y0ly2N0dCTlFVKzVGm/Snk392O19itzGyYhb0hQ0d/xPDXn/eVEn/DDYuTd2NLuTgRFWpX0
vUzcqlR7NrfYi8MechIPQ9LR+eLqar/uoWlPtfmx7bvkTbXbrkAraflSi4YWKoQeTcc5vrnt7FZc
hpLn7vAjsDoqtpRvxcW0vOk8orrk8kXaTG0SLpYPRXnv5TUXoxbjTXXLbLssuZOWvE+/8hG6Q03W
0itSTUaa2U4LVguxe13fMaZuVoXg+j9XEx8bUao0f7yo7J/dW2XYmLSYB09IYXRGWGh42p/e1Vkv
u09nU5XfIcruY8fxEDi8bW0pPWqylObyV8+xL3IutMW7ExDo78kSnjZqhF5qFr1JdUN3XKxNt9mu
fH5jJ9IY4FOGBp+KWx1H5VV/i2R6o26xo79cf0iBo0KukamrBSqVJPddt/riaYk2LCtDYfROeNqX
mv7Gk05fil5seaV2Z3tvtk5/AAxnSKpVg6VGKoUfqQ3/AHpbZduXIukufu8CvFYGwBSQUbCDADYU
bAFJBBsAwA2FGAG7BBsA2RRsA3YIN2CjdgDCAWkUGyAwA2FCkgDYQYFGwDdgBVgDYBgUYAKSAFAG
AGAGwoUkRBsoNgGBRsgN2CDYBsKNgGACkgg2RRhQYAKSAFEBgBgBuxQKSsQGwDADADYUYAbAN2AN
hBgBgBsKMAMAMAMANgG7ACrAGAGACWgBIBgAhoA0AaCBDyCjAgQwDVwo03cqbA2AJsDYG4hAJoAE
0ACZUApAApAAJFAGQQBkABkUAJAAZBAGRUAJAAZBAKRQBkEAQBMgBIAhlQaYAgqjRECWUCQgSyKE
lQYFCkAKCDYUbsAf/9T6OnpfJflUwAwAwAwgNAGBAlhRooMAMAMANEQYAYAYAaYUJKDQQYAYAYQG
gDADADADADQQaaKo0AYAYQGAGAGAGgg0AYAYAYAYAJKowA0QGAGBBoAwAwAwAwAwAwAwAQAaAMAM
AMAMAMAMAMAMAMAMAMAMANBBplBoKMAMAMAMAMIDQBgBgBgBgBgBgBgBoIMKDABIUYUGAGAGAGAG
AGAGAGAGEBogMAMANFQYAYAYAJCjCgwAwAwAwAwAwAwAwAwA0EGBBgBoijABIUYAYAYAYAYAYAaK
gwIMAMAMChJQaIowAwAwAwAwAwAwAwINBBgBoKNFBoAwAwAwAwAwAwAwAwAwAwAwAwAwAwijQQaY
AkqjADADADADADADADADADADAg0EGwowKMANlQYAYgBZAYAYAYAYAKRVCiAwIMANhRsijaKg2AYA
bIo2AKCDZQYRRgApBAoKMAMAFoiDYUbKDADaAFEBgBgBsoMQAsgMAMAMAMANoqhZEGAGAGAGAGAG
AGAGAGAGAGAGACQgSFGAGAGAGAGAGAGioNMgEhRgBgBoIMAEBRoIMANSAEFBgAlhAkKNBBgAgijR
UGBBgBgAqKChQQKigBQAqIAtBQREUEACIAIgoJEKCRACRCg0SAIgoKgAyACxCgsQAkQAqIoKgAyC
gsQAsQoJEAMgAqIoKgAqACxCgkQAsQoLEigqACoKCoAKgoKgAkSKCxACxCgsQoLEAKgAqIoIgAiC
giACIAWgAiACRChYAtAGwDZFG0VApEUbAMAMAMAMANFQYAYAYAYAYAYAa2gCWrBBoKNBAhhRphAh
gCQBAANhANhAOQAhhANgCGVAkgBsoEMIEMAGwAYAlhAhgCGADYQIkUCGRAhlAlgCAgGwBLAEBAhh
QiSCBDAEMoENAA2ECGADAEMAG0ECGADkgAbKgHJAA2ACYAOQQDYANgA2VAhgA2AIaCAbQAgAwqBL
RFCSoMAEtAGJBQoANRoSxD1YRcpPcldkJNiap6E8VnXmofZVpS6nnqrtd+RNunb7w9p1aeDyowtL
60vKn7PJfNRS5hd6DWpiZVm2229r3vryeXPyl1BnYCnrc+Ns+12tFdtygXTi6uxXt+K3sikAGhS8
Y/rNbbLXa62/JS5q9iKDwipOyzly+ll3+Zbms0D9+8EdnJXs5bF/az7vN7NqB+/eCT8l3nZP7b15
dSisl1S7wAs47HNbNjqu3dBZ2/iQUEs6sb2co7nK1Onfkla/Y0+RD9+4Eg/G3jFua3xprVjbm2rv
tXaFC4zVHLWjB8Ka1pfxX9kuwAL4vxObjGnzqPWl/Dbuer2gBIx+UeUlKpbLXqPVj1be7yuwAsHR
qXjMXTi53zb1YK0Mk3nsz7H1ma6YciU6X1nHEry4wSgldK89reVs1t4xTJGupfIm8J9BoxuLveMs
52V9aT23dt/HvJ6tz2RWNARWIxVNSm5tNtKKtFWTfL1K3M1XLDzRK9Kq0vHpKcYJRWfpb3lbyl6k
+JI31L5Ep0XhHD4adSN3dt3lZXsuvLfvJWsPEFKqS8ZlUqXz8yGy/qiutXNOIvunL4PDQpwaj5qu
2skl7dmzMzHfPxBWNDUIYnEQTlKpK929iyz35v1FrljN0TPSWtKVRQ11CKjnnm2+Sz4bbIkbzoH0
YoU51HKKb1F5z4vktmV97LTpwNtM1FXrS15+SnZRWby9S778hGc/IlujVGD1qkY2SyTbu+L4Lhu7
SVvpwQuOqQr1ZTnK93ko55bs9ndcsYy8iw9HqcbSqaqitie/ndv3WRK6YCDxdWFapKcm5NvYslbd
m/cu0rnaJ3QMNfWnqqMdiy783n7iV0wEXjsRTrVHNty4JZK3Xt9nWVi3YktDwlWnrW1YLgrXfXtZ
K1gB6UxUKtTfLVytsV9/N+rrETKgWEp1MXJJLVg9tslbr3+spPIk9LYmMLU7X32WS5EjWdEXDxlZ
WirR5ZLv3lY5E62tGUktr97M8unswQsZzq5QVlvtl3v4s05ciU0bhFTvUbT4cOZLXTHHQZVsXPFS
ep6ttusM27CKGEVWSi3m9yz73s9oJBKY6v8AJ0qdPby4EjeV0IZ0bZ1Hb1vu+NjTnoTOAowpR8Za
3N7bGa6YzXkRmJ1sVLXl5Md1+HJbTTnfIRRhGUlGK1m97yXd+uoEE5ipOhT1Ybdl9iXPgjLrfArL
jTpbXrPgsl3/AA7zTjwJPRsJYl3sowW5b3z3vtJW8fIzSteNV6spWityzbfsXaIuVEL8qVL93FR5
vN9+7sK57Fg0dhvkkXWqvymtr3L4szXXGa80QmNx8K03K2u92tsXUt/b3GnO3YYXq6Qairy5LJL3
IM+aLSnDQFHPOT9b+CM8u3sQVOvpOdRvV8m+2219b2+7kbkcbkN4TQ1XFtJ+TfPPbbjbb7uZNrMd
iyaRxsdBUlSpefbL4v8AXsJPLple0UpqtpOXpTfqXuS7jXDj5ok9GaEhip6spazW1Q2Lrls7FfrF
rWOGxL6d0pHRkFh6OUrWy9FfF/mZk23nlrxBTaejJta9RqnDjLK/Utr7Eb249o28TQwf7qOvL609
nZHZ336gbkDKdStpWdvKnLclu6kski8J5yB3gKWEzrzz+pCzl2vzV63yJtda5Aaml5Ulq0IqlHis
5Prlt7rLkNJ3e4NcPoyrjVrpWhvnJ2j3v3XZdpMdgzlhcBsXj587xguzzpepEXxPvDDGaSq4+0ZP
yVshFWiuqKy95dM3LYPHQrpLXxElRi9zzm+qCz77IbXt9/gaelaWBywtO0v7ydpS7F5sfW+Y0d2u
BFKFbS1TLWqVH1tl4Z80P3o2ho/PE1Ly/uqbTf4peauy7Jtrtk5DbEaemounQiqNN7VDzn96XnP1
LkNJcvd4DHBaIraSu4R8lbZvKK65PL3l3pmY7D5xweitv7TUW5XjST6/Ol6kycteJ9/5CM0hpmtp
FKM3aC2QitWC6orLt2lkZyy2C4Xo/Vrx8bUao0vrzyT+6tsuxE2sw2HHzjhdFZYaHjan97VWS+7D
YuTld8gbk4EDi8bW0nPWqSlOb459iXuRWLdiXh0d+TJTxk1Qi81F51JdUNq65WJtvs1z4GS6QQwC
1cDT8VudWXlVX27I9Ue8aO7XH9Ir8adXSM7RUqlST5yk37SsciwLQdHRWeOqWl/c07Sn+J+bH1vk
Te2+3XP4AGJ6ST1XSw0Vh6T2qHnS+9Pzn6lyLpLn7vAryKwMANgCkgDYBgBsKNpXAFBBgBu5AauA
bSuALtYAwAwAUkRQrYVBgBsijABaRQbIDADdgoWlYAwINhRgUbSCBQBsAwKNgCkrAGwDADYBuwUK
SsEGAGwDYUYQCgg2AbCjADLACiINhRhQbANpACiAwAwA2kUC7EBgBgBsKNhRlggVYIMAMAMANhRg
BgBgBgBuwBuwAoAwAwAwAwAwAS0AJANMASAJAMaABhBjABgGggS0FCQgRIoBMAFIAEwgCygDIADI
oAyAAyAASKgDIIAyAASKgDIADIIAyKAMggEAJYAgASyoEsgEsoEsASwBLKDTIBBQbAFEBsoFAGyI
P//V+jx6Xyn5VNBBgBgBgBhAaCDQBoKNFBgBgBoIMIDADADABLCjRQaCDADADCA0AYAYAYAYAaCD
TRVGgDADCAwAwA0AYEGgDADADADADTRVGgDCA0AYEGgDADADADADADABDKDRAYAYAYAYAYAYAYAY
AYAYAYAYAYAaZUCQowAwAwAwAwA0QGAGAGAGAGAGAGAGAGggwoNMA0VRgBgBgBgBgBgBgBgBgBhA
aIDADAg0UGAGAGACSqMAMAMAMAMAMAMAMAMAMANBBgQYFGiAwASFGAGAGAGAGAGAGioMCDADADTC
hJQYFGEBgBgBgBgBgBgBgBoIMCDTQUaKDQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBoiDQUJKowAwAw
AwAwAwAwAwAwAwINBBsNDADADZUGACkRBsKMAMAMANgCkFGwgwAwA2FGyKFFQYAbAMIo2gBQQbAM
CjYAoiDZVGAGwBZAYAbKDABSIDYBgBhQbAFJEBsAwAwAwA2UCkiA2AYAYAYAYAYAYAYAYAYAYAYA
YAaCDTQAkKMAMAMAMAMANBBgAgKMAMANBBgAlhRoA0EGAAwDCg0wgQFGBBoINMKEkBoqDADAoWgD
YAtBBsAWgoJEAWiKCIAIFC0AEiFBIgBIhQaJAEQAZBQVABYhQWIAWIUFRAFQAVBQWIAWIUFQAVAB
URQaIARABYhQSIAWIUFiRQVABUFBUAFQUFQASJFBYgBYhQWIUFiAFRFBUAEQARABEFBEAEQAuIAS
IULAFoA2AbIoUioFEUYAYAYAYAYAYAaKgwAwAwAwAwAwA0ECWAaChDCDQUIYQJAEMAHIIBsAQwgG
wgQwBDCAbAEyABsqBDABsAQ0AIYQIAEMAQwgQwAYAhlQJABsAS0ECGAIYAlgCAgGAIZQIYAhkQDZ
QIYANgCGEA2ADYANgA2VANgA2ACYQDYANgCGVAOQAhgA2EA2AJaAEgGFQJaIoSVBgUSWD0TWxq1o
xtH6zyj3vb1K75E2sx2JWno7D4SzqSdWXCPkx79suyz6yN6kBZ6SklqU0oR+rBW77Xb/ABZ8xpdi
P13J5Zu27N27H6nLs2IMBMU6nkrPklrdurG0e+4ARUtd6t7vdFeW+yK8ldTdwoPqJNJ2vuT8uXZG
PkrqkFBZ+TbXsrbNd3a6qcco9UsgAs42Xl5JbPGPVXZTjmuvNAoXqucc03Data1On2Jed2NPkD9+
4Kp/SJqN5R3qmtSH4pNXf4l2ggVTlqPVi0n9Wkry6td59zkuQJ+9AmqsPtUaf3vLn3bE+tRfMHAN
qa/luLlf+0qysn1K+fVeXURf35C0/lPk3nVtnqwWrBc9mzjlHrByCeM8Tk5xpr6tPypdsr7OuT6g
oLCl4rNQjTX1qru+xNZrqi3zAFRtiZenXkutRXtdv4Qc/eLZ0SUvlSTlBWjLyIdW9rJ9rbM5OvT5
G+k6l8qm1CKSUVrz2bFsTyfYmxDPkWPSj8Xo6EWnUclTWV83k+F93J9Rn1dMuBF9EqU1XesowSi/
JVr7Vt2y/iZcmenyI/TU/lGKqOFPWkmk5POKsktmSX4m0WM5eaLTOXyTR30m+Oerb0nutlv3ZdZn
1deMRVtDUZVqtPUpqMNZeU820s3ZvK/3UmarljyJrpbXp+MhCSbaTdk7LN73nw2eskb6lDnovRnr
SlKChGySVrbevyns35Eq9OCA0jiKdevOSi5ycrK+Syy2LN966jTnlfIt2iNbBYaVSotV5u1rWS5L
/UzXbHxBTITi3aEHOT3yz/lXvbNOAu7l8hwn0js2ty2OXBKyy7DDvxBT6Uk3alDWfF+U+7Z33NuI
ueKl8iwyjNtNqze13e33mHa+IKpSnd2pQu+L8p92z1dppx+At1efyLD2m3rNWb2u72mXa+IKvCpn
anDPi/Kfw9XaachaqUngKGtUb1nm97u9hl2niCtxqpZQjd8Xm+7YacdixaNpSoRlVq3vz3JfrYZr
rjNeaIWrilUk5KN23tefctntNOdok9H4adWevUvZbL8ercStYzYHj8ZGpOyV9XLPZ3CQyyAIUamL
aTyT2XyXYvgVnVolcdXjhIKmle62cjMdMrrwIe9Susso9y+Bpz5EzgqCwUHOTvdeozXTGaEVPE1M
S3qrbw+O0rG9heFwPjZWk1zSz9ewbWY7D3SOMdK1OGT3+5CLldCJdCTzm9Xr2920rnoTeDoQwkHU
d9m18OozXXGa8iEqupjm5bueSXuNOd8jKGGhOSjfWb4ZJdu39bQSCYx9b5JBU6S8p7Ety4mY6ZXX
iCu/JlS/eStyWb+C7TTloSuiaMastaMbRW95tv2LsJXTGBGlqk8Y9WOVOO2TyTfv7BEy8iEbpUON
R88o/F+orHiC06LpSjDxk8rryYpWSXUt77zNdcYK9pKSxE9atKyWyEc2l7Fz9hqOeXnkMFjNRqNC
Oq3kntk+3d2WLpnfuFvweGWiaTnNpzecm3v3K5jl3k7RTsTiaTm5yvVm/wAMV736jbhaGqrVtJyV
KOxvKKyiuxe1jhN2i7a1Ho7RUXK0nvtdt8bfpGeXfxhBR6ulFBt0o2k3dzl5Unz4LsXab04XIMae
HraSk5JOT3ybyXW3khwmrQV0cPg/Pl42X1YZR7Zb+xdoNSBtX0rUqLUjanD6sMk+t7X2tjSXIJpa
JnNa82qcPrTyv1La+xDZMQp4nD4H91Dxkvrz2dkP+E31A3II7EYmtpOSUnKctyXsSWzsLwltodPR
McJniZqH2I+VN9mxdr7CbXt1yES0wsLlhoKn9t+VN9r2fhSLo7tcCNoYStpST1FKctrfvbezrY4Z
ktD14TDaP/fT8bP6lN+T2z/4KfWF1JyGmK03Uqx8XTtSp/Uhlfre2XaxpLkG2D0NWxy10lGmttST
1Yrte3qV2NpMdh06mD0Z5q+UVOMrxprs86XbZchyvifeIrSGlq2kbKpLyVsisorqiskWRm5bDnD6
AqTiqlZqhSfpT2v7sfOl7OZNr2e/wCfOeH0XlhaevP8AvaqTf4YbFybuxra90nH8RBYrFVdJT1qk
pTm+Ob6l8EWMb2Jen0e+SJTxk1Ri81DbUfVHd1ysTbXZrnx+Y1PT8cAnHBU1S3eMl5VV9uyPVHvG
jv1x/SICFOrpCdkpVKknzk2/aVjkTvzHR0XnjqmrL+5p2lP8T82Pbd8ibb7dc/gA4jpJOEXSwsVh
6b26vny+9Pa+yy5DRc/d4FY2mnMKSANgGwBSQBsAwAwAUkAKIDADADABSQAoAwAwAUkRQoqDYBhF
GwBSRQbIDADaQULAMCDYUYFCkgg2AbCjADaVwBaVgDADADYBtIKFBBsAwA2FGWIBQQbKDZFGAG0g
gURRhQYAbAFJWANkBgBsoNpBQoiDADADYUKSANhBgBgBsKMAMAMAMANgG7AG7AGwDADADADADZFG
BRoqDAgQ1YA0AaaAEAGggS0FCQg00AIANBAhoKESKgFIAEwAUigDIIAyAAyAAyKAMgAEioAyCAMg
AEioASABSCAEigCwgEwDQAgASyoEEUJZUGgBLAElAkgElApEBsqDYUKRAbKD/9b6Ps9D5T8qiSoM
AMAMAMIDQBgQaYUJKDADADADREGAGAGAGACWFGig0EGAGAGiAwAwAwAwAwINACSqMAMAMIDADADA
DQQaAMAMAMAMAEsqjCA0AYEGgDADADADADADABLKoSRBgBgBgBgBgBgBgBgBgBgBgBgBgBoIElUY
AYAYAYAYAYAaIDADADADADADADADADRUGACQowoMAMAMAMAMAMAMAMAMAMIDRAYAYAaKgwAwA0wD
RVGAGAGAGAGAGAGAGAGAGAGggwIMCjRAY0AJCjADADADADADADRUGBBgBgUJKDQBgBhFGAGAGAGA
GAGAGAGBBoINMKElBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBoINWIoSVRgBgBgBgBgBgBgBgBgQYA
YFGAGBBsoNoAUQGAGAGAGAGyqFkBgQYAYAbChSIDZQYAbIowAWgg2UGEUYAKQQbRAbKowAUggURR
soMANpXAFEBgBgBsoNpACiAwAwAwAwoFJBQoiDADADADADAo2wDQQYAYAYAYAYAYAYAaCBLCjQBg
BgBgBgBgBoqDTIBIUYAYAaCDTAEhRoIMAEMA0UGggSwDQUaCDAgSyNBJUGBBtBQsINoKFhBtBQsA
IgBcSKCIAWgoIFBEAEQAVEUFQAVABUFBIgBohQSIAVEUFQAVABYhQWIAWIUFQAVABUQBohQSIAWI
UFiAFiFBIkUFQAVBQVABUFBUAFiRQWIASIUGiFBEAFRFBUAEACIKCIAIgAiACRACRChQAQAwA2RQ
sqDZFGAGAGAGAGAGAGgDCoMAMAMAMAMAMAEsIEhRphAgKNMIBgCWADYQDYANhAhhAhgA2AJaKgQy
AGECGUA2gBLQAMIEMAQwBDCBAAhooEMIEMAQ0AJCAbAEMASEAwBDQAlgA2UCGAIkggGwBDABsIBs
AGwAbAEMqATABsAGwgEwBDABsIEMAGygGwgGwDQAloASALhB1WoxTbexLaATVLo9NLWryVKPPOX8
K97RNt9gexlh8BlTp68vrVM+6Oy3BpSaC+IGuJ0hPFvypOT4bdnJcPwPuCW7DNNzdlm3uWbfZHf9
5soFql6Ltf6u135QjknykwgLKChlKy5Se/lThsf3nZkUFqLVVp5LhN6q/wCTcM+3YFCtV6ud9V5+
VanB/hWcutZ8gfv3BdNOaerdx2PVtTp9snnL8VnzB+/cF0nnq03n9WjF353m/K/xIE/ehicaG+EH
9n6Sff5qfU4vkD9+8GlTcHrSiot+lWetLr1LXt1xkuYP35C1H5Sr2nVS3yepTXLbb1x6goUql/I1
m7/2dGNk+Tds+u0+sJ+/AKl8m+pR/mqe/Vf8AXj7gunT8b5cYOf/AByq7R9qV+TlLqIfvyFuoqto
ynKpwhTWrG/dt6ou/EAcJSw31KHrn75J/wAKC/wGUaaq3lThKo985u0e2zsu2TQASrUVrVal19Sm
lq+6K60pAoufQyi412/F6kdR2b855rju5pJGMnbp8iK6QOnPGVPJlUndLV2LJLhdv+UsZz5Fx6Ut
UcLCDl4tXina+aUXkl8WlzMx16nAZdCadO9VwUstVXds9u5bO9lyTpCtaSmq1Wbq1LrWk1CPlWz7
Irsu+RY5UXrT8ZYbDQp07ZOKztZJLi8uHuMx3z8QQvRqiquI15VNecYt72uG19e5W5lrGE8hOm6t
WpXm4WhFWWu7J5LO0nn2R7hDLexOaFS0fhJ1dbWvrSvnnbLfntRK3j4gqUfGyWVqUH+G/tlL1mnH
yLfpaUdG4WNNrWvqxte17Zt8d3LaZjtl4gr2FoVsVKMHanCTWXm3XVtl6+srnJaJ7pHio09Wm462
+17Lgr2z470SOmdEdo2hVxVSKktWF7281NLltfXn1lrGMtD/AE/i4a6g1rOKva9lnxtm+9EjWdDf
RtGripxutWms7JWTty3+sVMZsOtN4qDmoNOTjuvZXfHe/UIudDXBU6mMklbVp3zsrJr3+sJJsSWm
sTC6g7u2dlku39dojWdEZQVTEvVgtWLydlZdr2vtZWJ5E5pKrDDwVPPqXBczMdMrrwIOnVlN2pxt
1be/b7jTlv3Cw5aOo+VtfDbdmeXX2YIKNa3mRs+O1/rqNOWxM6PoOknUqbefAldcZ60RuIxcaknJ
K74v4bPaXTnbsEw+HnjJJyvq/rZ+RGpNh5pLFRj5Fr23bESNZURalPEZRWXBZLt/M058iaoQWjab
lLbv9yM8us+zBCzxUpPyVZvetvf8LGnK0OcHgJVZXnsWbvtJauOOw40ljlF6iSdtt+PUJGsshEat
TFZu7S3vJL3Fc+RO4TDx0bBzk8/1kZ5dZO0QOIx1TEvLK+5b/ezWnO5bG6GjZVZKMmot7tr7t3bY
bJiJjH4paMpqnT862XJcTM8umV7RWfF1Ma3LN8W3ku15GnLkSujNFQrPWk9ZR4ebfhfeS1vHEC03
pN1ZeKpvJbbb3w6hImeQh/kDhnUague3sjt77GtsaFo0VgaWHj45prK6lLbbjbYvWzNrrjNeRWsf
iKmmqnkJuK2LguL4Gp4c7e4NfktLD/vJa0vqwz75bO64TWhdMNGGh6LqTioO2xZvkrvNv1GeXafZ
gpWJp1tLSdadoxeyUnaKXBcey5rhxu8vIbOeHwnmp1ZcXlHu2vtt1FTxA0xGNq460W7rdFKy7Ehp
m3YItFeJzryVNcNs3+Fe+w2vb7wl6Rp4T/ieFn9edpS7FsXrfMaO7XAj1CtpSeWtUm+t/pF4Z80O
ngaOD/fz1pfUp2b7ZbF2XZNrqTkBq6ZlBalCKpRe3V859ctr9S5DR3e4MsNo2rj84ryVtm8orrby
95dszHYdOGF0f5zdefBXjBdu2XZZEa8T7wxxul6uLjqXUae6EVqx7lt63dl0zctjMPoWrXj4ydqd
P683Zdi2vsTGyYgrxWF0d+6h46f16itHshv/ABPsC7k+8RGO0hW0lJOpJy4LcuSSyXYXTFuw9p6A
lTip4mSoQezWzm+qCz77LmTbXZ7/AAMel6OjcsJT8r+9qWlL8MfNj63zGjuk4EHVq1dJTvJyqVJd
bbKxfIl46AjgVrYyoqX/ABteVUfZsj1ya6ibb7dc/wBIRPpAsGtXB01RWxzflVH+Ld1Rt1jSd+uP
6RA0qNXSFS0VKpOT3XbZWOROPQtHReeNqWl/c07Sn+J+bH1vkZ232yc/gA1+kc4RdPCxWHpvbq+f
L703m+yy5F0XP3eBWZGnMJAEpACgDYApIgNgGFBuwApKxAbAMAMAN2AFWANgGAGEUKSAFFQbCjCA
2lcAUkUGyAwAUkFCggwA2FGwo2kECgDAowA2lcAWAYAYAbAFJBRsINgGwowA2kRAoAwKNgGAG0gg
URRhQYAbtcAWlYgMAMANlBtIKFEQYAbCjABSQBsIMANhRgBgBgBsAywAqwBsAwAwAwAwAwKNgGEU
KSCDZQJaIBJQY1cIEAGgBLQAkA0ECGAaAENAGgBLCAbKAUgATABMoAyCAMgAMgAMigBIIAyKAMgA
EggBIqAMgAMggBIoAsIByAEgCGUGmECAoSwgSVRoiBBQaIgTYKFBBsqjaIBQBsqj/9f6QHd8p+VR
BpBgBgBgBhAaIDCoMAEhRooMAMANBBhAYAYAYAYAJCjRQaCDADCA0AYAYAYAYAaCDABJVGAGAGEB
gBgBgBoINAGAGAGACSqMIDQBoIMAMAMAMAMAMAMAElUaIg0AYAYAYAYAYAYAYAYAYAYAYAYAYAJZ
UGgowAwAwAwAwAwgNAGAGAGAGAGAGAGAGBBooNMA0VRgBgBgBgBgBgBgBgBgBgBhAaIDADADRUGA
GACWFGFBgBgBgBgBgBgBgBgBgBgBoIMCDADCKEsA0FGAGAGAGAGAGAGioMCDADTChJQYAYAYRRgB
gBgBgBgBgBgBgQaCBLRVGgDADADADADADADADADADADADADADADADQQYAIDQwAwAwAwAwAwAwAwA
wAwAwA2VBgAoiDYUYAYAYAbANoqhREGAGAGwo2RQoIMKDADZFG0AKCDZQYRRsAUEGwowA2AKREGw
o2UGACkiA2AYAbKDABSIDYBgBgBgApFUKIgwAwAwAwAwA2FGMINAGAGAGAGAGAGAGAGACWECQowA
wAwAwAwA0EGACAowAwA0EGACAo0EGACZACSgwASwgSFGBBoINNBQkijRUC0AbAFoA2EC0FCkAEQA
tEUEiFC4gBEFBAAiACpEUFQAWIUEiAFiFBUAFQAVBQVEAWIAWIUFiAFQUFQAVABURQWIASIAWIUF
iAFQUFRFBUAEQUGQARBQVABYkUFiFBYgBYhQRABURQVABQoIAEQAtABEAEiAEiFC0ALAMANoihZU
GyKMAMAMAMAMAMAMANBBhQYAYAYAYAYAJYQJCjTCBDCjTCBDChLCAbCAbABsIEMAQwgGAJYQIABs
AQyoEMAQQA2UCWECGADYAhoIEMAQAIZUCQAbAEtBAhgCGAIaAEPMIEACGUCGADYQDAEAA2AIYQDY
AOQANhAORQCaABsIBsAGwBDCAbKAbAEMIBsASAPMJo2rjv3cW1vexLrbyJVk2JmOhqODzrz1n9SG
XY5P2WV9zJtvtk5B3pNYdalCKpp5ZLyn1t3l3prmNL3a4ETOtKtLe5drfPJXafK8Vy2lY2BOm1k7
K+57X+GOd/vMqhbpqmrSy5Ter/yjhmnzbsAHlHUVpZR4T+jj/BHyn1ogNpPVyvqvqpQfvn6pBf37
hulmnqXaW3xa1IrrqSz/AIlbmAapWi9WDSl9WlFzl/E9nXFtcgBUrUXeWpB73J+Mm+OXmp9ai+YP
37wWVNytKSbyynWlZW4xind9Sc1yB+/IXH9pWqteqltUVqU1z2bOtR6wDaq+Iy14w+zSV5dTnfZ+
KXUF/fgE8T4j0I0udV60v4bdz1O0GgqK+Vu6U67XpSerBdeez8UeoJz94XKqoLVnUSW+FJepvJPr
vML+/APClKgrqEKS+tUzl2JrPrjHtIDI6uJlkqmInzul75NdsSnP3hxKbpq06kacd8Kau312dn+K
VyKN0Kd1rUqWX95Uat67Q7HrMEG61SEreNqSqNbIxyS5JtZdkWuYA8jGpRV0o0I8X53Wr3n/AApI
i/wFs6Eqm69RxlKctTOTVltXW31u3UZydelyGGl9epiakZVIwhKdtVbZZ71Hb+KxYzlyLV0wcnGn
GNPxkm5NZN2slnZde/Izi69QF6LOdOjOVRp2lsi1ZWSy8nJdSFXp8ClaOXymrFUqV7yV5S8pq7/h
XdfmacMfItfTCVN+LjNtW1nZLN7N72evqM4uvUBOiEYyVSUYaqySd22+N3s4bEhV6YquMdOpUlOp
Nybbdo579ms8l2axpyovOMjLC4KMaS1W1Fbdl83m7d+Rl3viCq6Owka9eCnPXk3eyz2Z5yfuv1lr
jjN0WHpDWqynGFJbFdyyyv8AaezZxRI6Z0Nuj+DUqzm5KUordd5vLb37L9YqYTyBaRxVTE15+KXm
5ayWeXN7OyxYlu6JTo/hXT16kpKT2XTvzeezhsuSt4QQ1XGSxVRulHNvba7/AC7LFc7dif0NQeHj
KrUd29975LbmZrrjNeRBTxfjptwj5UntflPs3ertNOWxYNE0ZUlKrVvfnuS2/rkZrrjPeISvi41J
uSjdt7ZZ+rZ33NOdomtE0pzbqVL5K0b+5EreMEfjMVCtNys5cL5Lu2+wrFoc6NjPFTTeUI52Ssr7
iVrHyCaTrwnKzu9Xcss+bEMqGlCcqzUILVT4e97SszyJjH1I0YKne3JZuxmOmXjwITx6h5kbc3m/
gactiewy+S03Ob8p5tv1Iy7TwISdWCbdtZve8l3GnPYe4CEsVK8vNju2K/UStY+QrSNeFSVm20ty
483/AKiGVEcq7eUFq34be/aVjYnklo+nZuze/mZ5dfZggJVoQ81XfGXw+NzTjsOsBSljZa03eMe6
/AlaxmwXSeKhUeq22luXHm/gI1lRDzxcllBKK5be/aVz2LBgaEdHU3UqZN7fgZvl1xnaIGvjISk5
Ja0nvls7F8bmnO0N6camkpqN2/Yl7EOE9oWXF4inoumqabTtlbb18uszy629oqcsc6eVJKC4rOXf
8LGtOOw60VoyWOnrzT1Fm29/L4i1rHHYkdM6Xpr6JLWttV7R6nbN9WRJGssvQVavjKmJ8nZHdGKs
u5Go5b2LFoLQzovx1ZWt5qftfu7zNrphj60MdK9IFXlanFWjslLPtS2d9+wsiZZ7FefjtJS9Kcu/
/RGuHPzQZ4Knhf308/qQzfa9i9Y2utcgc9KuktWjFUlxWcn1yefdYaS5e4M8PgauOu4ptb5PJLrb
yG01sH8Xh8F57dafCOUO2W19lusL4n3hridK1K61FaEPqQVl27323LpLlsIoaIqV1rytTp/Xm7Ls
3vsuNkxBXWw2A8yPjp/WnlDsjtfa+whuT7xGYzSFXHta8m0tkVkl1JZF0zbsOYaElFKdeSowf1vO
fVFZv1LmNr2+/wADb0jQwH/E9PWl/eVLN9kdi7bsaNycCGxGIq6RneTlOb2bW+pfBF4Z3sSPzGsK
tbFzVJfU86o/wrZ1ysTbXbrkJlpuGBywlNU/+OS8qo+3ZHsXaNHdrgQSjV0hOy1qlSXXJv3lY5Eu
9C0tH54ypqv+6haU+30Y9t3yJtrt1yBVOkDw6cMJBUIvJtZ1H1zefYrDRc9ceBB4fC1dIT1acZTm
+Cu+t/ErEmxN/NGH0Zni6l5/3VJpy/FLzY80rsztvtk5/ANsT0inqulh4qhSe1Q85/en5z9S5F0l
z93gVuRXMJANNFAkA0AbAFJEBsoMANpACyAwAwA3YoN2IoUEGAGAGyKFJAGyoNkUYAbSKBYBhAYA
KSChQQYAbCjYAoA2AYFGACkgBQBgBgBsKFJBBsA2AbCjCA3YqBQBsijADABSQBsAwAwA2lcAXsID
ADZQYFCkgDZEGAGwo2UG0iA2EGwowAwA2AZYA3YA3YA2AYAYAYAYAYAbIo3YA3YA2UGAGEBgAhgG
ioNNACADABDQBoAS0AICDGADANBAhooBMACwAUgAMigDIIAyKAMgAEgAEioAyAASCAEioAyAAyCA
EigDIIEMAQAJkUCSIEFUaYQIYBpgCWAJKDCIMKo2FCiIFFBgUf/Q+kJ3fKflUSygSVBgBgBgBhFG
gyMANMKNFBoAwAwA0RBgBgBgBgBoA0FCSgwIMAMIDQBgBgBgBgBoIMAElUYAYAYQGAGAGmAaCDAD
ADGAJKowgNAGggwAwAwAwAwAwAwASVRoINEBgBgBgBgBgBgBgBgBgBgBgBgBgAllBoAwAwAwAwAw
AwA0QGAGAGAGAGAGAGAGAGBBooEhRhQYAYAYAYAYAYAYAYAYAYAYQGiAwAwA0VBgBjAElUYAYAYA
YAYAYAYAYAYAYAYAaCDAgwA0RQkKMAMAMAMAMAMAMANFQYEGACWVRoAwAwAwijADADADADADADAD
ADQQJKDQBgBgBgBgBgBgBgBgBgBgBgBgBgBgBoIMAMeYAgNDADADADADADADADADADAg2UG0AKID
ADADADADZQLIowIMAMANoKFIgNlBgBsAwihSCDYBsKMANoIFEBsqjABSCBRFGFBsAxACyAwAwoNg
G0gBRAYAYAYAbRVCkRBsAwAwAwAwA2FClkAICDADADADADADADADADADQQICjADADADADADADRUC
WRRoAwAxhBoASwo0AaCDTAEAGFBoIEBRgBoIMCBLQUaRFCysjaQULCDaChYApAC0RQQAIgoXEAIg
oIgAiCgqIAsQAsQoJEAKgoKgAqACoigsQAsQAsQoKgAqCgqACoAJEigsQAsQoKgAqCgqACoigiAC
oKCoALEKCxIAkQoLEKCxACoKCoAIiKCgBQoIAEQARAC0AEQASIULiALAMAFIihRUGyKMAMAMAMAM
AMAMAMANAGFQYAYAYAYAaYQICjAgQwDQAhgCQAbABsIESCAbAEMIESAEMIEMARIAGyoEMgEMoENA
CAgQAIaAEMIBgCGUCWECGAIkAIYQIYAhgCWEAwBDQAhoAQygGwgQwAbAESABsIBsAGwAbABsqAbA
BMAGwgGwBDCAbKAbIBOrrZLaUExh+j9WrnUtTj9rb2R299uslrUwD+NHC6OtZeNnuctnZHY1/E1w
I14gDidK1MS1G9tyivZZK9uVol0lyEfKLvm7N5Wbd+q0byv95oMjUqapK0suU3q98IeV2t2Cgkk4
K0rqL+tanF/gj5UutZg/fuGRT1fJvqverUoPlrPOfU7MH79wyjv8XfLb4qLSXXUl5S7boH78BMLQ
douKk90F4yd/vPK/OLXUD9+8KqLxb1pqMZcaj8ZP+FKy/FHtCgjg6yUpKU47pVZakLfZin6oyfUA
bjLx94RcqnGFKOpG3Fu132x7QDWusN6UKXKmtef8V8udpLqAC+JcPK1FG+evWd2+ajlfun1g/fkb
TWLer9JXa3RWrCPUs3bsgDn7wXxjw+TnCkvq0lrS/ivmuTn2BeP6BunR1VrQpKKeypWaz6k7RfVa
TBJ+6NznHENRlKdeW6MFqx7Lq/YorrCc/eHKc8NtcMOuEc5++a6m4oL/AACKFONS7pU5VWts55RX
NpOy/FJoEB6s8tWrVVv7umla/ZaHatZkAajCVtalSjCP95Uafc5Wj/CrhYEVZ05O9Sc60uV0v4pZ
9mqusAfRVWlmlDDx4vKXrvUfZkRf4BvHxSlkpVpvjkr9SvJ98XyKg6H0NjUjUqa6jBaqtBWTWe9e
d/FmYyd+mICq6c8fKMYOcnWd23kvKzslw4ttci+jHr8xY+mqU/FKU9SPlNrNt7Nyyy5tExdOqHmg
YqlgJukm767V1m3a2xdWzMlXDgV3Q1GpWxNNVZq6d1BO+xN7I+TH1PkWuePIkuk1ZyxEYQpqc1BZ
tOVs3u2d6YjXU5EzoiU8NhJzqvPynlZ2SVrK2W7ZlmSt4+IKVg3CpUjClC7bSvLynt222Ltv1mnG
C39KnGShGUtVXbtZtvdku/a0Zjr1Ay6MU6c6snCL8mPnN53fJZLfx6xU6YbaZi8RXk5zUYp2Sbu8
ssor32LEy80T2g4QwtCVSN2nd3e/V5Lt4kreHiCtVYVa+dWWqttpZd0Vn6iuXmi1NrReEyzut+V3
Izy7ezBWkq2JX1Yfwx/P1s05eaLRjHHRuHVNq91a17X3sy63xBXaU6uIypqy+yrd7+LNOXIsuMcc
DQVN3zVst/H9czLrfEFdhXd7Uo2fLOXf8LGnLfuFlrNYKhqydm1Zva7vaZdr4gryrRp+ZHtln6tn
tNOOxZcM3h6OtN+U88/UjLtPEFfcoQzzm+eS+L9RpxE7ou8k5vJbksl1ma64CMxMo1JuU5X4KOeX
Xs9ppzoNo/6adopRSzb2vv8AhYlax8hzpN+Mai2oxXHe+raSNZCLjKEXaK1nxfw+JpzFgq61CnZZ
y7kufBIy7XxBXvFwp+c7vhH4/C5pxEvoyOveVlGOxcX2ma6Yhnjb4iV5NRitl/htLGMvIaw1bqMI
60nvezu+JUgnsTOWHpqMM5PLJd75GXW+BWfEwpefLPhHN9+z2mnHQltFw8bLWjFRiu1t9fwsSumA
BpOUsa7LKnH0nkm/f2CJl5EV9FR4zfdH4v1FY8QWfDt4KlrTWf1UrdSS4mXaeIKviKEqsnOtJQvu
2vsXxsacrPeNYZxqTUKMLyfpSztztsXrBPuFl0hiJ4WCp07yqNbd6XF+78jLrboU2WGp0M6s7v6s
M32vYvWbcNaEpomMsbO1OKp015zXnPlrbe6xK3j5D7TdaeIXiaStFefJ5RXK7y6+4kazu/AqbjQw
nnN1ZcFlHv2vssacfEDbEaSqVo6qtCH1Yqy7ePbcukuQ1S0XOa152pw+tLLuW19g2doU62HwfmR8
bL608o9kd/a+wLuQMMTjauOaUm3witi6ksis27B46IlTWtXkqUeecn1RWffYm17feNPSFLB/uIXl
9epZvsj5q9Y0b1wIutVq6Rn5TlOb2bW+wrNuw9eiI4XPEzVP7C8qb7Ni7X2E2vbrkIlpeOEyw0FD
7b8qffsXYu0aO7XAiY06ukJ2SlOb622VnkSL0VSwOeKqWf8Ad07Sl2vzY+t8hte3XIDV066KccNF
UYva1nN9c3n3WGju93gRFDCVdIy1acZTk+Gfa/iysybEo9G4fR2eJqa0/wC6pNN/insXNK7Jtrtk
5DbEafqarp0IqhTe1Q85/el5z9S5DSXP3eBE4TR9bSUtWlBzfL3vYu0u2JNiX+b8LovPEVPGz/uq
Ty/FPZ1qN2Te29Sc/wAA0xnSCrVi6dJKjS+pDK/3pbZdr7BpLmK/YrAS0VAkASwBAAgAwA2kAKAM
AFJBQoiDADdig2FG7EQbAMANkUYAKSKDYQbIowAUkUCiAwAwAUkFCggwA2FG0gBQQbCjAo2AKSAN
gGAGACgoUkEGAGwDYUYAKSCDYUbIDADErgC0gDADADYBtIAUQGFBsA2FG7EBsIMANhRsoFJEQYAb
CjADYBuwBuwBsAwAwAwAwAwAwKN2ANpAG7AGwDADCA2AYFGBAloASUGggS0AJANBAkKEhAloKEhA
loASAIkEApFAFgApAAJFAKQQBkUAJAAJAAZFQBkAAkEAJBAGRQAkEAJFAGQQJAEACZFAggEsqBJF
CWVAlgGmAIZQYEGwo2iAUAbKoURB/9H6Qnd8p+VTW0AQaQYAYAYAYQGgDAgwASwo0UGAGAGggwgM
AMAMAMANBQkA0VBgBgBhAaAMAMAMAMANBBjAElUYAYQGAGAGgg0AYAYAYwBJVGEBoA0EGAGAGAGA
GAGAGACSqNMINEBgBgBgBgBgBgBgBgBgBgBgBgBgBpgCSgwAwAwAwAwAwAwA0QGAGAGAGAGAGAGA
GAGgg0yg0VRgBgBgBgBgBgBgBgBgBgBgBhAaIDADADRUGAGmAaKowAwAwAwAwAwAwAwAwAwAwA0E
GBBhFCWAaCjADADADADADADADRUGBBoKNFBoAwAwAwijADADADADADADADADTQQJKDQBgBgBgBgB
gBgBgBgBgBgBgBgBgBgBoIMANNFUJIowAwAwAwAwAwAwAwA2VBgAoiDYUYAYAYAYAKRQKIDADADA
BRGgoIMKDADZFGwBQQbKDCKMAFIIFIAwKNgCkRBsKNlBgApIgNgGAGygxACyAwAwAwAwoFogNgGA
GAGAGAGwoUkAYwgQAYAYAYAYAYAYAYAYAYAYAJYQJCjADADADADADQQaYAkKMAMANBBpgCQo0EGA
A3kAYUGBAlgCQowA0EGBBqwUbAFoA2AKQAoAXEAXEigiACBQRAC0FBIgBIhQWJAFiAEQUFQAZABU
FBIgBYkUFiAFQUFQAVABUFBIgBYgBYkUFiAFQUFQAVBQREAZBQRABYhQWIAWIUEiQBYhQWIUFQAR
BQVABURQVABAoIAEQARABEAEQASIULiAKAMAFIAUiA2FGAGAGAGAGAGAGAGAGAGioMAMAMAMAMAE
MINBQlhAkKEsIEACGADkECGEA2AIYQIYAhgCGECGADCBAAhlAgAQwBDCBDAEMIEMAQ0AIAENFQJA
BgCGECWADAEtACGEAwBDKBDABsIEMAGwAbCBDABsAHIAEwgGygGwAbCAbABsANh8FUxjtTi5ceC6
3sXaCTYmaegYUFrV5r7sbeuTyXc0+OZNt9vvDr5fTwXk0IKL2Xz1n2u8uxKwXeuBFV686ztJ2e5b
7/dV5X/huVm3YbSiqfnZX+s7X64xvLtbIgVOPi1Z5Rf1rU1/BHypdZV/fuGop6t431XldWpwfLWe
cup2YT9+4ZRz/d3dtviotW66kvKXrQIBLVg7JxUnugvGzfa/Jvzi0+QP37wqpHUetNRjLjVlrz/h
Sy/FHtB+/I24OulJqU47nUap0+pJP/DLsByNwn428IuU+MKMdVNc3a7tzi+sL+/AxNYXfTpfd+kn
33aT7YdQQE8U35eptz8ZWla/NLK/V5YX9+QnWWK8i86z2qFNasOtK3f5K6wcgik8N6VOhyh5U/4r
tp8U5R6gvAylR11rwpuSf9pVlaN+Wajfk3MJJ+6FVKsalo1KkqnCnTWrG/K6ST6ou/EAcqE8Nup4
fnLOp3eVNPnFRQX+AFTjDESepGpiJ7W5XS7Um5Nc9ZdQP4hxOcoLVqVY04vbCkk2+vVsn+KVwfvw
Mw9PXV6FG6X9pUaaXfaC6pa3WCfcF15xnbx1VztshDYuV3aK/CpIHxDqjGokpU6caUd052u+py3/
AHEmRYA1JUnLWqTnWnyul/FK8n/CusJ/ESEVWpq6UMPHi/Jlbk3eo+zINefgGq8RTfpVZfwxv65P
+VhPAkWq0VaTjh4Pd5ra5pXm+265kXz8Bb+g0acZ1VByk7K7aSW17Fn3t9hnJ26QaqNZ460pKEPH
3UbpOXlZeSs3fjLLmVPO/mH/AEyqwhUppw15arsm3bbwVm+/vJF6glaUXHRrVS1NuMr+TZK7e5Lh
3k9W/wCaIDorTpfKFqa0pKLes7JcMlnx237C1z6fIL0iVWrXmnNQpZbXZPJblm+5iGfIm5uOA0cr
eUtVbbq+s+/eT1dOMRD6DhWr1oNrUp7bJaqdllltln1lrnjvYN0lr03XSknJxila9lxz3v1dYi53
yJfo3L6GVRxjFXysrZJcdr7WSt4cCoyjSi3KcnOTd2o5L+J+5dppxF2xUZYbCqNJNSaSy3Xzeffm
Yd74gquGwMatSMZzvKT2R8p9r2d1zTlILJp7FSpOFOCzeey74K3rJHTOiN0fgp160XVeazabvLLl
u7bFrGM8h5pzGpVFDVTcVv2K/L43JGs6B6MoVcVUjKd9WOavkuVl8BUxloNpfEwlUs05OOVr2Xx9
gi5UD0XKWJqJLyYLNpKy5X49oqY+Q40vUhUmlKWUdy2369ntEXOhvgX42oowiore9rt1/CxamPkS
eln4y0W0ks3f4bSRrMRNJQclGK1m3tezuXvZWIJ7HXjT1ILbt3JL2IzHXIQPi4U/Od3wj8fhc046
E9Stg6Wtaze7nuMu08QQboSec3q347e7aactCT0bh4Sesk3bY3x6iV0xgaYupLGzajdxXd1hm3YH
RwsZSUW7t7o/HZ7Qkgk8fiFgoKEMm/UiRvK6EIqE5+VLJcZfq7NOWhNaPw0KMfGXvltatkZrrjNe
RC4rGTxkmle26KNOduxqjo91JKMmot7tr7t3aNnaJnHYhaNpqEPO3fEzy6W9orSjUxrvnLnw7dxp
y5E1ovRivryalbctl+v4EtbxxDTSelpVJONN2isrra+0SJlkImngp1lrbI/Wlkvz7Csa2LThcNDQ
tOVSTu3v9iRnl2k7RUsZpKrjW7vJ+itn59pvTjctheH0PUxDSdoX2X2vqW33DZMdiyYzEw0BRUKe
c3s97ZmeXa3tgpFfEVce1rNye5fBI08+9gr0aqGdeSh9nbLuWztsNr265CXpCGG/cQSf15eVLs3L
9ZjRvXAj7VdIT9Kc31tlZ5Dp6Pp4X9/Oz+pDypdr2L19Q21rXIG9LeIyoRVNfW2zf4ns7LDSd3uE
dRw1XSEnqpzlve3vfxKzrYePBUMF++nrS+pTz75bF2XI1qTkBq6ZnFOFFKlF/V859ctr9S5DSd3u
8CPw2Aq6QdqcXLi9y628l2l2zJsPXhcNgP3s/Gz+pTfk9s/+Cu0jWpA2xOm6k46lNKlT+rDK/W9r
7WXSdwY4TRlbSD+ji2ltexLrbyQ2kx2Hzw+E0d+9l4+f1IO0O2e1/hXaOV1J94Z4zTlXER8XG1On
9SC1V2732tjSXLYZYLRVbST+ji2ltlsiutvJF2kx2JB0MHov95L5RU+rB2guuW1/h7yctak+8Mcb
p2tjI+LVqdL+7gtWPbvfbcumblsQRWBpgCADTCBAUIYQJABsA2kFCgg2AbSChREGAGyqNgCiIMAM
Io2AbsUCrBBgBsijABSRQKIDADAoWkAbCDAo2AbSAFAGwDAo2AKSsAbAMANgG0goVYINgGBRsA2k
ECrAGyKMAMANpACgDADADYApIKNkQYUGwDYUKSIDAg2FGygwAURBsKMANgG0ig2QGwDADADADADA
DYUbsAbsAbsAYAYAYQG7AGBRgBsA0AaCDTQAgoMCBDyANACWAJANBAgA0ADAEsAFIqAMgAUigDIA
DIADIIASKAEgAMioASAASCAEgAMioASCAEigEwBIQDYBplAMgNMqBIUJYQJChIQJKDADYAogNlBt
EAoij//S+kJ3fKflUwASyoElBgBgBgBhFGgyMAMAEhRooMAMANEQYAYAYAYAYAaaChJQaCDADADR
AYAYAYAYAaCDTANFUYAYQGAGAGgg0AYAYAaZVGgDCA0AYEGgDADADADADADABJVGMINEBoAwAwAw
AwAwAwAwAwAwAwAwAwAwAQygwAwAwAwAwAwAwAwgNAGAGAGAGAGAGAGAGAGioEhRhQYAYAYAYAYA
YAYAYAYAYAYAYQGgDCAwA0VBgBpgGiqMAMAMAMAMAMAMAMAMAMAMANBBgQYRQhhRgBgBgBgBgBgB
gBgQaKDAg0woSUGAGAGAGEUYAYAYAYAYAYAYAYAJaCBJQYAYAYAYAYAYAYAYAYAYAYAYAYAYAYEG
gDABLKo0RRgBgBgBgBgBgBgBsqDaANkQbCjADADADYAtAGAGAGAGwoUiA2UGAGAGyKFIINgGygwi
jYAoINhRgBtBAsijADZQYgBZAYAYUGwBSRAbAMAMAMAFJFUKIgwAwAwAwA2FG0gBQQaYAgAwAwAw
AwAwAwAwAwAwAwA0ECWFGgDADADADADADRUCWRRoAwA0EGACAo0EGACZACSgwA0ECAowA0EGBBgB
tBQsIMChaAFAC0AEiRQtABEFCwoIgAiACRCgsSAIgAyCgqACxCgkQAsQAsSKCoAKgoKgAiACxCgs
QAsSALEKCRADIKCoAKgoIiAKgoLEALEKCRCgsQAqIAqCgiACoKCoKCoAIiAKgoIgoIAEQARABEAE
QARBQSIBsA2RQpFQKIowAwAwAwAwAwAwAwAwAwAwA0VBgBgBgBgAhhBoKNMIEBRphAgKESCAbCBD
ABhAhhAgAQwgSADYAhgA2VAlgA2QCWigQwgGAIYAhhAgAQygSEA2AJkECGAIAEMAQwBAQIYANlAh
gCGRANlAhgA2ADYQDYAOQANhANlAJgA2EEpQ0HWr5yWouMsu5bX3W5k23MRJU8DhsFZy+ke5vKPY
lt4NXb5EXUg3X0jOVoK0Vujst1RSv/KkFtETVnZ3k8913Z9WrG8u9pcisAU14pWfkrhLyF2wjeb5
O4AizUcr6r6qUH27ZruZT9+4Jpb/ABd7Lb4taqXXUl5S7boIERtB2i4qT3QXjJ363lfnF9hD9+8Z
UWo7zUYy41Za8/4UsvxR7SqNyi6yTalOPouo1Tp9kU/8MuwJ+/cNQl43yIylPjCjHVTXOVrvti+s
H78AeWG306X3fpJ9+aT7YBQvxTn5eo3f+0rysnzSur9V59QP35Ga/wAo+j1p1v8AjdKOrDrWXf5H
aE5BLvC76dD7vl1O/NxfK8AvH3BNOkq15wpyqcalWWrG/eknycpdQP35GqtaLWrUquS/u6UbRvzy
SvzUZA/fgOI0p4fNQhQX1qmc+uzTfbCKC/wAlqYmf9rianal75NfwhP4h25zoK0qkKC+rTzk1wer
d9k5Ii8fcBYalGpfxFGVS22c9i52VkvxOSKkBq09Zatetl/d0kml3asF1q/UFoJh4SktahRUY/3l
Rp+uVoeq4PgE15U5u9erKrJbo3suWtLZ2RaBfvDyiqqSlSpxow3TltfVKe/7iT5EUAm6KblUnOtP
fbJfxSvJ/wAK6wnj4iQpKvFXhGOHg9kn5LfVKV5v8PcGvPwDb6Ck7ycqsuXkx73eT7o9YZ8CRh49
RvFRw8Hv8y663ecuy5GvPwDVKhQ2uVWXLyY97vJ90Sp4HROhbm3NumqcGlq2ja+3e832tmMno6Yh
sPCjDSG2UputLYrJPWe93b7l1lYmt/MTfSzx7qR8W9SOpnK6jveWtk+xdxI31Nh5iFHD6MWt5a1Y
7Ha95Le17ierV8Yhh0Qm6tSTUFGCjbJb7r0nd9l7ci5MdMQ+mI0vlFSU5OT1n5MVwys5PZ2JljGX
IuOmVUo4aEKKet5KyzaSXHd15GY7ZceBF9GcLJVpTnNSko5q+s83vez1is4TyI/SmM18RPxcE561
rtazyyyTy3cL8yxnK+RZ7yoYJ+Nk1Jxd282tZ8Op2sZdeIKpgVSnUhCEXJuSV5f8Fe9s04wWbpHC
VbUimoxzbbdly6+y5I69TyGWgMNTdW6bk4q97WWeW/N+oVnCeRmk69XFVpRp31Y5O2Wzbd9fEQyt
tEhoDB+I1ptpvZk723vPZw2CtYTQhq2PdWblCKTb22vL17OyxdMd2xYtFUpYaEqlW93m77bIzXTG
a5FfqV4XcktZt3vLZ3L3tmnLYsmipSVJ1JvbsWxJL1IzXXHgQE9RScpy1pN3tHZ3v3I05Cf0UkoO
eqkt1ttlz2ma64CIrUnUk5VGo3eza+742NOdgktFUYSbkk8sk38P9SVvCBnipyxs243cVs4fArN8
heCwkak7N3tm7bO/4EtMcQfSeNkpakHa223ESNZZBjDCSm1rZX47X2bSsSCZxFRaPpqKzby+LM8u
tvbBCOc8TkrvktncacuRMaPw3yVOc7bO5Ga6YzQiq+PdSTlFJPi83+XYXTFyCMPhZ42Sbvbe2VJN
iV0lioUV4uzezJZdSZmOmVEDPFyatG0Vwjl69rNOWxOaMwywcHVnk3x3L8zNdcZoROJxcJycra75
5JdS+Pcac7QCm6mkZqF8uCySXUDkWHHVIYSn4tS1crcXbq58TLrfArHymFH93HP60s33bF6zTjvQ
k9EYWWNn46o20tl+P5e0lbxm/I1pivCvK05+THZGObb4t7F6xDO7EG8f4rKjFQ57Zd72dljWnPfu
Fs0VgngoOrO7qSV3fbbhd+v8jFrtjNCr42dOpN1K09eT9GGxctZ+65uOV+8MKmk5RWrSSpx+ztfX
LaxpnuDahgamLzist8nkl1t5F2kmwZ08PhPPbqy4Ryj/ABbX2LtIviBtX0pUqR1I2hD6scl2732l
0lyAcPo2pilrJWhvlJ2j3v3DaTHYNbDYLbetLl5MO/a/UF8T7wzxOlKuJWpdRh9SK1Y9y29ty6S5
bCMNoqrilrWUYfXk9WPe9vZcbJjsGbwuB4158/Jgv8z9SIvifeGGN0rVxi1ZO0FshFWiuxe8sjNy
2NYbQ9XFrXso0985vVj3vb2XGyY7Dhzwmj9idefF3jTXZ50u2yIvifeI7HaWrY9aspWgtkIq0V1J
ZF0zctjWE0NWxsddJRp75zerFdr29lxsmOw5csHozYniKnF3jTXZ50vUmOV8T7xF6Q0xW0gtWcrQ
WyEVqxXUll7xpm5WiIZWQgqBDANAAwDQAhgCWECGAJsFGwg2AbSIoUEGyg2FG7EBsIMANkUYUCkg
DYQbCjCAwAUkUCiAwA2FCkgDYQbCjAoUkEGwDYUYAbSuALSsAYAYAbANpBQoINgGwowA2kECgDZF
GAGACkgDYBgBgBuwUKSIDZUGwDAo2AKIgwA2FGygxIAURBsKMANgG0igUQGAGAGAGAGBRuwBuwAq
wBgBgBgBgBsgMCjADdgDdioFACWiASFGggS0AJKg01cASAaAENACQBLQAkIEtACGACkUAZBAGQAK
RQBkABkEAJFACQAGRUDeQAGQQAkUAJBACQQBkUAmAICBEgBIAgoNMIEBRoIEFUaIgQygwKFEQbQB
sqhSIgUVR//T+kJ6Hyn5VMIDTCBBoGAGAGAGEBogMKgwA0woSUGAGAGAGiIMAMAMAMAMANNBQkoN
BBgBhAaAMAMAMANBBplUaAMAMIDADADQQaAMAMAEsqjADCA0AYEGgDADADADADADABJVGAGgg0QG
AGAGAGAGAGAGAGAGAGAGAGAGACWVRoIMAMAMAMAMAMAMANEBgBgBgBgBgBgBgBgBgAllQaKowAwA
wAwAwAwAwAwAwAwAwAwAwA0QGEBgBoqDABIUYUGAGAGAGAGAGAGAGAGAGAGAGggwINEUJCjADADA
DADADADADADRUGBAkqjQBgBgBgBhFGAGAGAGAGAGAGAGACGrFQaAMAMAMAMAMAMAMAMAMAMAMAMA
MAMANBBgBphQkKMAMAMAMAMAMANlQYgBREGwowAwAwAwAUkAKAMAMAMANoKFkBhQYAbQBsihQQYU
GyKMAFIINkBsqjABaIg2FGygwAUkQGwDADZQbQAogMAMAMANooFkBgBgBgBgBsKNpACggwAwAS0A
JAMAMAMAMAMAMAMAMAMAMANNBAgKMAMAMAMAMANBBpgCQowAwA0ECAoxhBoA0wBBQYAaCDTQAkKM
ANBBgApACgDaAFgGyKCBAtBQRBQuIARBQQAIgAiIoKkAFSACoKCRACxCgsQAqIoKgAqACoKCIALE
ALEKCxACoigiADRACoKCoKCIALEigkQAsQAsQoJEKCxACoigqACIAKgoKgoKgAiIAqCgiACBQRAB
EAEQARABEFC4gCgDZFCkVAoijADADADADADADADADADADADADRUGAGAGACWECQowAQwg0AIYAhgA
2EA2AIYQIYQIYAlhANgCJACJACGEAwBLKBDAEACGggQwAYQIasAJZUCCARJFAh5gCABDCBLQAMAS
0ADkggQwAbAEMoESCAcgAbABsIEMAG0ACaCBdHCzxTtCLk+S9vALrYlqWg1TzrTUVvUc32vYvWTb
faJCE6eAsqcFB8X576t/8K1WF4DCvi3J2e18dt/uq76vNfMJaGFWepfWerfbrPVfU4xvN9bdisgc
k4rY1F/WtTi11Lypd9wfv3AcE2rwu47G4LUj2zlm+qXeEAYWi7QspcKcXOX8T2dcW+oATUSpu8tW
L4zfjJ9yy/iS6wn7943ODqJSkpSW6VWWpG32Yp/4ZPqKv78hMJeNvCLlPjClHVjbm7XfbF9YT9+A
htYbfTpfd+kn2O7SfVKPUDj97G3RcvLcG7/2leVr80rq/VeYX9+QnX+U/R6063/G6UdWHWsv8i6w
g228Nvp0Pu+XU7/KcXyvALx9w1Ciq16kacql9tSrLVjfvST65PqCc/0jKtdW1alW6/u6UbR7coxv
zSkF/fgFVGWHzVOFBfWq5ytxs1d9cIIAC3DFTzdXE1N21Ls2ya/hBz94d61TDbZ08Ovqwzn1ZXl2
TkkF4+4N8PShVb8TSnWa2yney5uMXl2yaCQOKs3q6tasox/u6STXdG0O27YW/vQ3hqeur0KF0v7S
o00u16tNdUk+sHwGYiUZ2+UVnO2yFPNLld2ivwqSBfvDihGbjrUKMYR/vKln/NO0L/dSZCfcB1nT
k9avVlWlwje3Vry2dkWip8Q8oeN1dajTjRhuqStfsnPf9y3URqAFRUU3KrUlWm9urdLtnJX/AJX1
lQP6DrOOtRpxow+u8u6c3e/3WuoizfoASjRpvWqVJVZb9XJdspK/8vaE8B9h5VprWoU40ofX2f8A
KSbyfU11Bqb9AGVOjTd6tSVSW9Q985e5PrCB5hqlWrnh6agltnvXXOWzs1SLPuF06GU9SpVcqinN
xV7Nu2e+TyfZfrM5O3SDLCVXLSLjTprKrLWlZye153d1Hst1j0Sc/MOemFKnOvF1J28heSleTzfU
vX2DFepyJnHt09Hw8VG7caeqmlJ7nstZvsJOW7wBdFadbWqSrPO0Uk3drbu9HqyFTp79RV61WlLE
SUYa0pVHnJ5ZvdFe9vqNOXqLb0rpurGEdZRjdttu3DdtfYmZjt1BropQhSjOUJOWaTdrLLhv377d
QqdOCtuvXxzk6a1Ytu7j5Kz4y39rK57tFs07qYbDwpzvbJWVs7Lns9fUSOufiCK6P1FWrJQgopJu
+18Nr691i1jDkK05TVau3OaikklvfcuvfYQz5EroGFOjSnUje1827Z2XDd6yVvDwK7NVsb5U3aPG
TtHs/Irn5otEUtG4TPO63ZX1jPLr7MFap4ipV8mktW+6Kz7Xt9Zpy2LRj1HC0FTk7XssldvezLrf
EFfhUjdRpxzbsnLN92z2mnLYsmlE1SUE1na7btkjMdsuBXqdOnFpZzk3ayyXft9hpxFg0jN4amqc
Fm8klwW0zHXLwIFYVx8+Sjy2vuXvsactCwVpLRtG0duxX4vaZ5dr9mCASqYvPNpdy9yNOXmifwlN
aPpOcrNvPL1Izy6YztghZYxttxSjfetvea053ISejMK3J1JJ8r+0lbxgDi8TCrO9nK2zcvi/UEtA
aTni5KGyO9LJWCTyJTSMoxioayit+926iRvIQXjoUvMjd8ZZ+rZ7TTnsWHCxlRp68ryk87excjLr
PAr1SEbuVSV290c337F6zTnQ80d9PO0IqMVm3tfVf4WJVx8g2lZzxL8XBeSvOexX6xFy8iG8XSo+
c9d8I5Lv+BXPxBZMO1gaTnJKOV7L1Li2Zdp4grU6NTGt1JZJ73kv11GnLWwXB4WnVmoK9R73sil7
X6iLIJPTOMWDgqNPJtbty/MRrO68CswwE5LWlaEeMsu5bX2GtuXaJ/Q+jaU34zOVnk3kr8l733Gb
XXHGCI03pN42epB+RH1vj8CyMZ5bEfHRs7a1RqnHjLa+pbWXbHaNOvRwv7uOvL609nZH4sLuQMcT
jKmMa1m3wW7sSyLGbdg0dFSitaq1Sj9ra+qO1k2vaNPF0cJ+6hry+vP3R2d9ym5BHYnF1Ma7zk5P
cvgt3YVm3Ycw0RKK1qzVKP2vOfVHa/UTa9vvGfLaGC/cw1pfXqZ90di7bg3JwIrFYypjpXqScnuv
7lu7Cs27DunoWaWvWaow4y2vqjtZNr2+8beOw+B/cQ15fXqZ90dnfcG5OBEYzG1cdLWqScnz3dS2
LsKzbsPKOg6koqdVqjT+tPJvqjtfcNrMQt43DaO/cw8bP69RZdkPjci7k4ENjtIVdIPWqycuHBdS
2LsNaYt2I6QZA5AA2AIKgRIA0AIYBoAQwBIQDYUaCDYBtIihQQbKDYUbSIg2AbsRRhQbAFWCDADZ
FGAGwBSRQbIDADaQUKSsAbCDYUYFCkggUAYFGACkrgCgDADADYApIA2AbANhRgApIINkUbAMAMtc
AWlYAwAwA2AbSChVgg2AYAbCjABREGAGyqNgG0gDZEGwo2AYUG0iAUAYAYAYAbCjdgDdgDYBgBgB
gBhAbAMCjADdgDdioFAGEBsKNBAhgGgDRQIZAaKgS0AJANMAQAaCBDANAA2ACkUAZBAJgAZFAGQA
CQQAkUAJAAZFQAkAAkEAJFACQQBkEAJAAmVAgATIAQAIZQaIgQyqNEQJZQJYAlgG0AbANlUbRECg
o2UH/9T6QnofJflUwijABDKg0UGAGAGAGEBoAwIMAEsKNFBgBgBoIMIDADADADADABLChJUGAGEB
oAwAwAxgGggSVRgBgBhAYAYAaCDQBgBgAllUYAYAaIDAg0AYAYAYAYAYAYAJKowA0EGiAwAwAwAw
AwAwAwAwAwAwAwAwAwA0yqEhBgBgBgBgBgBgBgBgBogMAMAMAMAMAMAMAMAMaCBBVGFBgBgBgBgB
gBgBgBgBgBgBgBgBgBogMIDADRUGMASVRgBgBgBgBgBgBgBgBgBgBgBgBoIMCDTIoSFGAGAGAGAG
AGAGAGAGioNMASUGAGAGAGAGEUYAYAYAYAYAYAYAYAIKg0AYAYAYAYAYAYAYAYAYAYAYAYAYAaCD
ADABLKo0RRgBgBgBgBgBsqBREGAGwowAwAwA2ALQBgBgBgBsKNogFAGFBgBsihSCDYBsoMIo2AKC
DaCjADaCBZFGAGygxACyAwA2UGACyAwAwAwAwoFoijYQYAYAYAbCjYAoIMAMAMAMeYAMAwAwAwAw
AwAwAwAwAwAwAwAS0AJAMAMAMAMAMANMIEBRgBgBoIEsKNAGggwAQwDRQYAaCBLANBRgBgApBBsA
UgBZAbRQLRFBAAiAFxCgkQoIgBYAVEUFQAVBQSIAaIUEiAFQAVEUFQARABUFBUAFiFBIgBYgBURQ
VABYgBUFBYhQSIAWJFBYgBIhQWIAWIUFiAERFBUAFQARBQVBQVABERQVABEFBUALQARABEAEQARB
QuIAoA2AbRAKQUbAMAMAMAMAMAMAMAMAMAMAMANBBhQYAYAaYQICjABMggSFCWECGADCAbAEMIEM
AQwgSADYQIYAhgAwBDKgSwBDIBEigQwgQADYAlhAgAQyoEgAwBDQAlhAhgCGAIYAgIBgCGUCGADa
IgG0UCGADYANhA+oaJq4jO2rHjLL832Jk21MdiTp6MoYezleo3svlHsW9rhe/Iba7dA9XFKHkZR4
QirepK/fFPmRdiLrYrVf1Xuu7PqtG8l3xT4FZ2GdR+LvfyU9us9S/XGN5vruyoB2bWV9V71anB9r
87tswn79wHTedqe1bqUXf+N+UvWgfvwAy1aTu9SL5/STf+W/8LCfv3jdWm3nOLf2q0rZcVFZ92sg
v78gcW8QnFOdRb401qQ627e2K6wgFrrD+lCnyprXn2SvZdkl1AG5UXHynCzeevWlm+ajlfqtMJ+/
ITrfKvIvUrWz1Ka1YLmlZ5fhj1lXn7xms8N6VOjyh5c+yV3Z8nKPUE4+4JjR8b5cabnf+0rS1Yt9
6V+TlIE/ewirXi1qVKrkv7ulHVjfnlFX5qMgv78Aioyw+ap06C+tV8qduNmm+2MEDWvuAW4Yqebq
4mpu2pf5pNfwhOfvDlyqYfbOnh1whnPqutafZOSQa/gG+HpQrN+JpTrSW2U7pdbjF5dbk0EgcVZy
UdWrWjCO+nSSfeo2g+tybBf3oJw1Pxivh6F0ttSo7pf4YLqlrdYJ90G8RJTssRX1rbKdNXS/wwXX
HWC/EGw8JSWth6CjH+8qWl/NO1P1XIT7giu4Td8RWlVkvRhd25a0rJfhUkVL94c4ZVJLWoUY04f3
k7P+edop/dSZF+AFWVOT1q9aVWfCN32OcvcpIpfvDvDurNa2Hoxpx/vJWf8APPyU/u6pFn3AVWNK
+tXrSqz3qF33zl7lJFT4h3hpVKqvhqKhFbZvNrrnPyYvmtUiz7gmrTg3rYis6kuELyfbKVl3awT4
g+GqSqu2GorLbJrXa621qrrSXWFn3BdaipvWxNbWlwi/GS776q73bgDXv/shVCtFy1cPR1pcZeXL
utq+p9YWX3BxXoTqO+JqqNvRvrSXVGOS6m4kLPeLd0KnSVWcaal5ucpNZ58Fs72ZydukFRp15aQW
vLVpqo3GLklfqjtfXbtHoed/MZ0vqUqVeLnBzlqKyvaO17bZvvQh1ORNaWjKpgYKDUbqF89VJW4t
7CRvLgC6IYeNCFS0lJ3V7J2VubtcVOnNCu6MxMsRiIqlBRjrpyaV3a+d5O7XZZFrnjd0TnSuMKk4
a89VJPJK7d32LdvZI31A+0I4UMJOdNNLynnZt2XVy2CtYeIK3hsLXxlSDquy1lZSdsr7o7e5WK5S
W8ie6T4iEJQjKOs0m0r2WfG2b2cUSOnUoN0ZqSrKcmkoqySSsufXu23FOn5FfxUKbqSnOd7ybtDP
a+OzuuVzotFSfyHBrUTTaVltflP2mXbiCuUsDVxUl4x2cmvOeb6lt9xpy1sWLTuIjRjGDjrb7Xyy
yWwkdM7oRmjJzxdWK2QWbSVll1e8VnHyH2mpQqTSlLzV5qV3d+pbhGswnRGrVqeTFJRV7vN/l2IV
MRrStOeJqN7IxyTbsufX2CGXkE0VhoSndNycc72svj7BTGAWkcXOtUcIN2WVlv4iGV2FaO0e3NOV
lbO2/wDXWLTHEG0njVr6qim473mu74iLlQzw8Z46aUrtb+CXsLwxPtCW0pVgkoNvLOy9XUZjplRE
wr52pxSb7X3/AAsac9ifxEXRpaqebybb72Zdb4gg1GnS2tyfLJd+005Cawj8VTc2kltsuBl1ngQt
SjOs3Odo34+5bTTnZsOcBhqdWWScrbW8l3fElaxgTpbEurLxcdi223sRMqGEcE157UeW193+hWdC
enq6JpZbXx3szy6+zBWalWpi3m3J8PyNON8iU0dotuWtO1lu335ktbxxGaT0p5WpBJ6u9558twkM
shCN1MY98pd5XPkWfCUY6HpOc/Oe33JGeXaTtgr1fSd5OUIpN+k85fBdhrTlcg1wuHnpOok23xbz
shfBJ3C06SxNLBU/E6zjla0c3b2K/FmY65WTwKk9IeJyoxUPtbZd72dljenHu9wYRp1MbLJOcn2s
rPIcvBU8N++nn9SGb7XsXrI1rXIHLSfiMqEVT+1tl3vZ2WGk7tcCPjSqY2VoqU5PtZWeQ8ej6eF/
fzs/qQ8qXa9i9Y21265A5aV+T5YeCp/a2z73s7LDR3a4EXGFTGSy1pyfW2ysch/81wwmeJmov6kf
Kn8F2vsJtrt1yEPS6wuWGgqf235U+95LsQ0d2uBDSc8XP0pzfW2ysciT+Zlhs8TNU/s+dN/hWzts
TbXbrkIlpeGCywtNRf8AeTtKfZuj2LtGju1wIPEYieJlrTk5Se9u5pi3YasIByABMIByABsAQVAl
gCQBMgBIAhgCQgQwo0EG0FCgg2FGwDdiIFEUYUGwDLACgg2RRgBgBuxQKSANkBgBtIKFoAwINhRs
KNpBAoAwKMAFpAGwDADABVgoUkEGwDADYUZYAUkECiKMAMANpFAogMAMANhRtIAUEGwDADYUbsAb
Ig3YqjYBgBtIgFAGAGwDCgUkQGwDADADdgoVYA2AYAYAYAYAbIDAowA2AbsVBuwBsAwgNhRgBgBg
BpoIEBRoIEtFAgAwIEPIA0AJYAgA00AICBMgAMigDIACwgFIoAyAASCAEigDIAbyCAEigDIIG8ig
DIIASCAEgAZUCGFCWEAwBMigSQCWVAkKEsIEsA0AYECiqMIBaANlUbsRB//V+kJ6XyX5VMIowgNM
qBBQYAYAYAYAaMgwqDADABIUaKDADADQQYQGAGAGAGgBJVGggwA0QGAGAGAGMA0ECSqMAMAMIDAD
ABIQYAYAYAaZVGgDADRAYAaCDADADADADADABJVGAGggwgNAGAGAGAGAGAGAGAGAGAGAGAGAGMAS
VRoIMAMAMAMAMAMAMAMANEBgBgBgBgBgBgBgBgBpooElBgBgBgBgBgBgBgBgBgBgBgBgBgBgBogM
IDADRUGmgDRVGAGAGAGAGAGAGAGAGAGAGAGBBoAwIEtEUaCjADADADADADADADADRUCWUGgDADAD
ADADCKMAMAMAMAMAMAMANNXAElQaAMAMAMAMAMAMAMAMAMAMAMAMAMYBoIMAMYAgNDADADADADZU
G0AbIg2FGAGAGAGACkgBQBgBgBgBtBQsgMKDADYBsihQQYUGwDCKFIINkBsqjABSCBRFGygwAUkQ
GwDADZQbSAFEBgBgBgApIqhREGAGAGAGwo2AKCDADADADADABMkAJAMAMAMAMAMAMAMAMAMAMAMA
ENWANAGAGAGAGAGggSFGgDADQQaYAkKNBBgAmQAkoMAMCDQQIDQwA2ggUAbChaCDZFC0VAuJFC0A
EChaACIKCIAWgoLEgCxACxCgkQAqCgqACoAIgoKiALEALEKCxACRCgqACoAKiKCoALEALEKCRACx
CgsSKCRACxCgqACIKCoAKiKCIAKgoKgAiCgqACIigqACIKCIAIAEQARABEAEiFCkALAMAFIgFIA2
FGAGAGAGAGAGAGAGAGAGAGAGAGioMAMAMAEMINBRphAgKNMIBsAGwgQwBAQDYAlhAgASwgGwBAAN
gCWggQAIZQIYAgIEMAQwBAQIeQAllQIIBEkUCHmAICBDQAhoAQAIaCAckAIYAhgA2UCGEGU6Mq7t
BNvggaErS0I9tWSit6Wb7XsXXn1E23MRI06VPBtKEbS4vOT6vjBNcSNTwA18Ur2bvJ7tr7ld+zsC
WiMr4hq93q323dm+TUbz/ilYqbDaacVmmov61qcWvurypdd7hP37gKF5J6ms1v1FqR7ZvP8AiXaE
AE1Tdk4xfCC15d7y/hfYVBqpDVd5JRfGrJyl/Cs+9NcwfvyE2eIj6dSK6qdNP2f4QcgaqqlkpqD+
rSjeXVrPPulLqB+/ARKj4nNwjT+1VetL+G3+V9YP35CH+15LxlfV3LyYR9uX8ATn7wl1fk3pwpcq
S1pfxX9Tn2A4/oCY4fLXjSyf9pWlZPmvNT6vLBr90Iq1o1fInUlU4U6S1Y37Ukn1QfWE2CeLnhvR
p4fnPyp9z1pLrjGJWuPuAFqYqeSq4mpzul6taTXbEM8/eDSnPD7alOgvq08524Xjd9k5ILx9wbYe
lCq34mjOs1tlO+qubUbW/FJoGgWtUajq1q8Yx306KT71HVg+vWbB+/A1hqXjFrYehdL+0qu6Xfqw
XVK/WCfdArETU0liK7klsp01dL/DBfh1gX76F4eEprWw9BRj/eVGpL+KdqfqvzBPugHiHCbviK8q
rWyMLtLlrSsl+FSQPiD4ZVJrWw9CMI/3k7P+adoJ9STIvwA6/i5PWxFaVWXCF32a8rJdikil+8Oc
M6lRXw1CMIr+0laVuuc/IT5pRZCfcEV4wk9bEV3UlwheXY5Ssl2ayKfGhxhJTq3+S0Ekts5LXa65
S8hdaSIT7oNV6cZvWxNfXlwh5b6tZtRS6m+oF++heGq+MerhaF5fWkvGS7raq/hy4gn3T9QbEUZV
XfFV1deinryXUk9VdV11Bb99CaVelF6tCk5y3OflPsirLsesE37g9r0K9XLE1FTivQb2dVOOztSQ
asvqARq4fD+bCVR8ZvVj/DF3/m7AniCRccVXj5TVGk9ztTi+zJy7myL5/fgNlDD4fa5VXy8mPe7y
fdEqeILr0LxEq1aVqcYU9R+bHfdbZO7fU32GMnfp3yEvD06ektaU/KdS6ik3t4t2S7Lj0TX2g56V
15068I04JzcMnq60tr2Xuu5X5iL1L5Epp+n4zBwVSWr5l202724Lf3dZI1nwNdFfF06E3T1mlJ3c
rK9ktyvbvYq9PgQeg/lGKrU5Suqad7Jasdm5KyfrZa547tDzpPKkq6c9ZtQXkqyW17Xn3W7RF6nI
mKDccBelHVk4uyjdvN7t9yNzgQWhMBJYiMqklrK71b3ls32vbtzLWMZ5DjpBjIwr21FKUYpXlmlv
2bN++4hnfImtFVJvCynJ5vWavkluXJIzXTHgVOlh6SkouTnJtK0clnzefq7TTjJBatPV5UIwp07p
u+zbZf6kjrndCO0NgJqspTyaTdm8+Ga+IrOOPkK0vi4eNfk60o2V28uOzt3iGd8iR0FOdZSnJ5LJ
LYlveSy4EreAiMQoTnKc5Xbbyjn69ndc050T2jXGhRdRR1Vm9t20jNdMfEFe8RUr+XPJPfJ2/XYa
c9bFjwcI4Ci53vfO+y/AzXTHxBX3i51co5X3R3+9mnPYsGj6XyKk5zybzfuM10xmoISVaEW2lrN7
5fBe8057E7ovWnFzk9uSW6y4IzXTARNeCnJyqSSbexZv4FYokNGQjNtxjkt7zd/YK1iGuMcsbN6q
ullyCXyN4bBxnJRcrvgviNkxDzSWLdG0IZcfcSNZXQh40Z4jPN838Wac9bE7FLRdLPN+1meXX2YI
CeMlnq2j1be/aa05dwfaIwjqS8ZLYtnN8SVvGBOkMVTrSu7ytsSyXf8AARMrKI9YmdZqELRTytHL
ve0rO9iyVKfyKjqwaT4t262ZdeIKw1Sobb1H3R+L9Rpy8QTGiVPEvWdowWyKVk37+0lbx8hrpNz0
hLLKnH0m7Jvjz5WETLyIq1GhxqS7o/F+orHiC1Kr810NaaSf1UrK72L4szy7b7YKb8lq45upLJN3
cpZL1+424atCWqGG23qy/hj8X6geIG9fSNSqtVWjD6sVZfn2jSdwDQ0fUxKulaO+Tyj3suyTYM4Y
fCec3VlwWUe/a+yxDxA2xGlKlSOrG0IfVirLt3vtLpLkG2GwFTGeZG6W17EutvIbJNhy6GHwf7yT
qy+rDKPbJ+5doXUgBW0vUktSmlShwhlfre1jSXIR+GwVTGu1OLk+XvexdpWZNh/8hoYL9/U1pfUp
598ti7Lk21qTkBq6alTTjQiqMX9Xzn1yefsGju9wgpvWd3tNOYFIAHIAGwgHIAGwgHIAGwAbANFQ
IANACABLAEACGAYAKSCBQUYAKsRBsKNgGFBtIgFAGEBgBhQKSAFEBgBgApIKFBBgBsKNgCrAGwDA
o2AKSsAbAMANgG0goUEGwDAo2AbSCBVgDZFGAGFApIA2QGAGwDAoUkAKCDADYUYAbsQGwg2VRsAw
AUkQGwDYBhQbSuAKSsQGAGAGwo2kAKAMAMAMAMIDdgDAo2AZYoN2CDYBsAwgNhRgBgBgBtK4Bpqw
BgAloqBBFGioEtACQg00AIANNACADQQIYAmQAGQAGRQBkEApFACQACQAGRUAJAAJAAJFQAkEDeRQ
BkEAJBACQAMqBDANAAwBMigQQGmVAkKEsIElUJIyNoKNlUKSIgUFGIqBZlR//9b6QnpfJflUwgMI
owAQyoNFBgBgBgBhAaAMCDADTChJQYAYAaCDCAwAwAwASwo0yg0EGEBoAwAwAwAxhAlgGiqMAMAM
IDADQBoIMAMAMANMqjQBgBogMANBBgBgBgBgBgBgAkqjADGEGgDRAYAYAYAYAYAYAYAYAYAYAYAY
AYAJKowINAGAGAGAGAGAGAGAGEBoAwAwAwAwAwAwAwAwAS0UGigwAwAwAwAwAwAwAwAwAwAwAwAw
AwAwgNEBgBhUCWgDRVGAGAGAGAGAGAGAGAGAGAGAGBBoINMKEhRhAYAYAYAYAYAYAYAYVAkA0UGg
DADADADADCKMAMAMAMAMAMAMANNBAkoNAGAGAGAGAGAGAGAGAGAGAGAGAGggwAwASwo0FGAGAGAG
0VAoiDADYUYAYAYAbQAsAwAwAwAwAWiKNgGFBgBsihSCDYBsoMIo2AKCDaAMCjaAFEQbCjZQbQAo
gMANlBizAFkBgBgBgBtFAsgMAMAMAMANhQpBBsAwAwAwAwAwAwAG1YAwAwAwAwAwAwAwAwAwAwAw
AwAGAYAYAYAYAYAJYAkAwAwA0ECAo0EGAGAAwDCgwA0EGmgBIUKQQKCjaQQLIo2ioFkULQAtABEF
CwAiCgiAFxCgsSALEAJEKCoAKgoIgAqACoigsQAsQAsQoJEAKgoKgAqACIigqADRCgsQAkQoKiAK
goIgAqCgqACIKCoAIiKCoAKgoIgAqCgiACoigqAFoKCIAIAEQARABEAEiFCkALAMAFIihRUGyKMA
MAMAMAMAMAMAMAMAMAMAMAMANFQYAYAJYQJCjABDCDQUDYQDkECGADCBDAEhAhgCWEA2AIYAhgCA
gQwBLKBBADZUCGAIYQIYAmQAgAQyoEsAGAIYQJYANgCGAJYANhAMAQwB3Q0bUxOaVlxeS/PsuNrM
diUp6KpUM5vXfDYuri32p8ibb7Q6dZR8iKS5JW9Vr/xL8TC7DGtiksr57lfPqtG8vXHrCWiPq1Gr
p+SntUnq364xvJ9bbKzQDNxyT1X1U4P/AIXemE/fuAYSztB58KUXf+J+V/iQP34ApJUtupF834yX
dnG/WohP37xqcHVSk4ymt0qktWPYr+yXYADjU1vJjJyb9ClG1+Tdk33SB+/AHqfJ91On97y59qzs
+yJUCdT5T5WrOrb05vVguTzy/iXUDkIlX8Vk6ij9mlHPqcsr9d5A/fgJ+TuirqnGmvrVnd9ai7Jr
qjIGv3QGpOOJajKVSu90ILVj+G6b7FFBOfvCmp4b+6w/80/804v+FA4+4N4QjiZNwhUxE9rlK6Xa
otvt1kU5+8GnUlRVpVYUlvhSScmubjk/xTuQ/fgAoUY1FejRc0ts6j8lc8tWK/E5IJBuvVutWtX8
n+7pJNerVh2pyKt/ehlCk5LWoUEo/wB5Vaa75atPsab5hNe6fiBYmcZ2+UV3UtshTV0uV3aK/CpI
LfvoNh6c3HWoUIwj/eVLP+adoX6kmD4QDxEqc3fEV5VZLdC7S5a0rJfhUkC/fQfDqpKOth6EacP7
ydn/ADztBP7qTCz7gDEeLk9bEV5VpcIXfZrztbsUkE+Ic4XxlRa2GoRhFf2k7S75z8hPmlFhZ9wF
iIwm9bE13VlwheXZrSsl+HWQT40HwkpVr/JcOsts5LXa63Jai69VdYWfdBmIpqo9bFYjWkvRh9I1
yvdQS6m7cAX76FYaqpvVwtDWlxkvGS7rKNuuL6wT7p+oPiaU6tvlVdK2yCeu11Rj5MepuJC/fQGn
Wo0mlRpOpLc5u/dCNl2NyKm4H9ajiKqtiKkaMPqPyf8AlHBX/lXWRq79Q1U8LhtkZVZcZeRHuTcn
3x6ip4gkofK68MkqNJ9VOLXXk5d8mRrzfu/gGyo4bDedOVV8ILVj/FJX/l7QngPcLiK1bLC0lC2+
Ku11zd2uxpBZfcEzwkYPWr1U5b1Hy5drvq+t9RDXvCoYunSdqNJN7nPy32LKPqfWDfuFz6LxxHyj
Wrtq8GlGTs9zyjtS7EjNdunvfkbxkqNHSS8mTm5wzvaKulu2v1dTHoXXcHvSuGIqTiqWsoOPlNOy
273ku9ki9TYd6ejCODp+MbstTzbZ5Pe93PPqEaz4CujVSLws3TjqrWlZXu35KzfPqSQphwIbQOFr
PExqVn5VpZSl5Wx7tvfYtYwl35CukVelTxDvDXkktrtFZcFm+8RM75E9jYTq4GKgs5RhksktjfUi
Ol4EZ0Zwao1ZPXjKSjsjna7W/Z3XFZwnkMtK4/Vrz1IxUr21mrvLLK+S7EWM5XyLJiFL5GlKVpSj
G7k+Lu+Zl1vAgtEUKLrRScpyTvfZFWz636jVc8ZNh9pzE1J1fF02/NV1Hbn1Z8CRrOh7oDBvDKcp
2u7Lbe1uIq4TQgauLg5OUYXbbd5Z7eWzvuVztFppOawt9spR5Lbs5LIy7egrMMPCn50rvhHP17O6
5px0LJpKr8goxjDJ5JdhmOuXiCBpYWri2m7575fnt7DTnrYntKVYUIRptNrgnbJcTMdMvAhaNeVa
ShC0U3byfjtNOe9id0mvIUE1Fb7vcvWzMdchCU4000opzk3bPJd2005Cb0lPxNNU47XlZcDMdMvA
hY4Rx89qPXt7tppz0J6bWjqWW3nxZnl19mCBdWeIds3yXwRpy3sTuBofJIuc8n7jNdMZoRNXFRcn
JRu3vln6tntKxaHOAjLFz1pO6j7dwq4+QrSTVWXlSSityzfd8RFyEfTqJtRpRze+Wb7tiKx8BN46
pKjTUI3lOWXPmzMdcvAr3yVUv3kkuSzfwXaacdCb0ZRhCLqKNlubedt74IzXXGCCxVeWkKjaTfBc
jTlbsKo6Mc5KMpJN7lm/y7SbamImNIYpaLpqnT27uriSeW8r2iqTnPFPO8pd5txvkT+iNEypy8ZU
VrbFz4sza644hppLTSqytCKersk8+1LZ33EjOWYgKtaeLl5Tcn+thpzt2DrRrhnVkqa5+d2RWffY
bXtGniqOF/dQ1n9aefdHZ33BuQR+JxdTFu85N8OHYthYzbsGhoqbWtUapx4yy7ltZNr2jbrYfB+Z
HxsvrTyj2R39rBuQMMXj6mMynLJbEskupLIukt2FYfRdXErWsow+tJ6se97ey42THYL+y4LjWn/D
D4v1IL4n3hlitK1cUtVvVh9SK1Y9y29txpm5bEUysgbCAcigHIAHIAHIIBsAGwgGwAYAhgGioEMi
jRUCGAJYAgAQwg2kAKCjABSREGwo2AZYAUkAbIDADCg3YAUkAbIDADABSQUKCDADYUbSAFAGwDAo
2lcAWlYAwAwA2FCkgg2AbANhRgApIINkUbAMAMsUC0gDCAwA2FGwBSVgg2UGEBsKMAFEQbKDYUYA
ZYAUkQGwDZQYAbSAFEBgBgBuxVCkiA2AYAYAbIDAo2AYUG7BBuwBgQbCjCA2FGAGAGAG7AG7AGwD
GrgCADQQIaANAGnmUCGAaCBDQBoASwBABpoIBsAFIADIoAyCAUigBIABIABIqAMgBvIADIqBvIIA
SKAEggBIADIIBFAlhAkAGwDTKBBAaZUCAo0ECCqNEQbKo2iIFAGyqFJEQKCj/9f6QnpfJflUwAwi
jCA0yoEFBgBgBgBgBogMCDADTChJQYAYAaCDCAwAwAwAQVRoIMAMIDQBgBgBgBgQJZVGgDADADCA
wAwASEGAGAGACWVRgBgBogMANBBgBgBgBgBgBgAkqjADADQQaIDADADADADADADADADADADADADA
BJVGAGggwAwAwAwAwAwAwAwAwgNAGAGAGAGAGAGAGAGMAQUGFBgBgBgBgBgBgBgBgBgBgBgBgBgB
gBhAaIDADAgSyqNFBgBgBgBgBgBgBgBgBgBgBgBgQaCBLCjRFGAGAGAGAGAGAGAGAGBAllAkoMAM
AMAMAMAMIowAwAwAwAwAwAwAS0EGig0AYAYAYAYAYAYAYAYAYAYAYAaCDADADTKoSRRgBgBsqBRE
GAGwowAwAwAwAWgDYBgBgBgBtBQsgMKDADABRFCggwA2UGEUKQQbANhRgApBAoijZQYAKRAbAMAN
lApKxAbAMAMAMKBaIo2EGAGAGAGwoUkAbCDADADADADADADADTVwBABgBgBgBgBgBgBgBgBgBgBg
AlgCQDADADADADTAEAGAGAGggSwo0AaCDABDQBooMAMANBBqwBsA3tAFoA2RQtIqDZFBAAiAFxCh
aCgiACABERQRABUAESCgqACoAKgoIgAsSKCxACRCgsQAqACIKCoAKgAqIoLEAMgoIgAqCgqIAiCg
qACIKCoAKgoIgAqIoKgAiCgqACIKCoAJEigqACIKCIAWgAiACIAIgAkQo2AEAMANkULKg2RRgBgB
gBgBgBgBgBgBgBgBgBgBgBgBoqDADAAYBgAmQQJChEggGwgQwAbCBLAEMASwgQADYQIYAgAQAJZU
CGQA2AIkVAhgCGAIaCBIAMASyoEkANlAlgCAgGwBLAEAGoU3Udopt8FmASdLQsnnUaiu9/D9bCba
mIkIYelhPNjeW5vN9i98U7Ea1oZPEObtv4bX3K+f8L5A2I6tiFHft4t91o+V3tIqWhpUk0rSyjwl
5C/gjm+vMMgEbzT1dZrY9VKEe2W/tsUAdZUsk4xfCC1pd79z7Ag1Up6rvKKT41ZXfXqrPvUgfvyE
f8UKy16iW1RWrBc9j9kQcgTn4j0oU+UFry7JXdv4l1BAl0dby9Ru/p1ZWT5pXXdeQP35ApVVPyHO
U7+hSjqxfqWf4WAadN4f0adHnPyp9sc2utRQOAFpYyWSq4iS7Ev8Tt2xKnP3jbnLD7Zwo8qflT/i
V32SkgcBvSoxq3lTpSqcZ1HaPW7NJdsmgDKtWycalZRjvhSSt221YPrvJhP34CKNFta1KglH+8qt
Nd71YdjTBr90DxFWM1atWc0tkKa8ld+rFfhUkEv3glKlNLWpUY047qlVp37Z2g/wxuGv35DfE1Kc
3evWnWa2KF7dWtPZ2RaKzfvB6dOrFKVKjCjF7KlS131SqZX+4kyLP3+6GmIlSk9avWnXl9m9v455
90WuZS/f5DqjGtq61GjCjDdUnbPqnUyv9xJ8gefT9/iGtfxLlrV6060/s3/xzz7otcwnx8h1h/Gz
jrYejGnD+8lZ/wA9TyU/u6rDU+79/iG9eNOUtbEV5VZ8IXl2Oc7W7FJBPjQ4wrnVzwuHSS2zktdr
rlLyF1pRCz7oE4mnGo9bFYjXkvRheo1yu2oJdTfUEv30ZhqiqPVwuH1pcZLxku6yhbri+siz7p+o
PiaU6tvlddJLZBPXa6ox8mPU3EF++gFKtQpO1Gk6knsdR37oRt3NyKm4JGtRxVVauIqRow+o2o/8
o4K/8vaRq79fAZ62Fw2xTrS5+RHuV5PviVPEElTli68LwSoUnvVqcX+J2cuq8mRfPw/gGfiMNhvP
qOrLhTVl/FJeyL6ypqQPcLiatZ6uEoqLW+MdaXW5SvbrWqRZfcMq4PPWxNZa29J+Mn6nq98r8ga9
9/UZHF0aGVGlrP61R6z7Iq0ex6wNwPq2HxOKS8fLxcNym9VdkFn3RIureQFfJsN9aq/4I++T/lKn
iB3h8RiMVdYeGpHf4tW75be9kalt4E70YwywuKjrVIubUlqx8rc9sl5Pc2St9Oaok9L4iOH0hBKE
XKUqd5O7e1LJbF12vzJGsrqg/TDCPESpvWjGKTu5O3ctr7ExivUmw+05KFPBQclrxWpbNq+W3jbl
kyRrLgK6P1XXwk3GKjnJJRy3LtvzYph5gh+jWCdDEXlKOtqvyU7vtay9dy1jCeQPT2LjSxM7Qi5Z
eVLPcti2d9xEzvkWHT1GVbDQirXvG7bSWx9SJHTObgb9F8NGjrtTUnknZOy273tFTpwQFbSEpVJe
KiotyeaV5O74u77rFc7kLXp+mpUowclFXV2+S7WyR1z4DHo9RpKpJwcpNR2tWWfBZv8AWwVMIGOk
MTVxVacIXava0eWWdtvaWM5W2iwYWl8hwj1/JbTvvtfJe4y6SagrlKpBSUacLttK8s9vLZ33NOUF
l01CVSEYQTed31LjuRmOuYi9HYKPjI3km1nZZ7OL2e0tYxgdaXxrhU1YpXS22u1fgI1lQjRNKWIq
eMndpLa+IqYeRmkqlOdRuTbtlZcuLfuEMg60Q/GSbUVGKXW8+bFXDyGeNpzxdRy2RWSbyWQS+Q70
XhYa2snrOPBZZ9e0VcYG+Px0pTai7JZZfESJlkN6Owcqk1KSeqs894pjA60jiISlZ3lq7tiEXKhp
QqSxElCPkp7lkGZdiV0hFuKgrJb23ZdRI6ZCFtTp8ZvuXx9hXPwJutU+RUtiUnuXFkdLdQV6GFnN
XeS4vJGnLQmtG4WFL6S9+drLmZrpjPURGL0hPEN2do7kuHMumLlsDwuAniWsmo72XaTHYmtJYuGG
iqVr5bE7ZczMdMroV+eNnJWjaMeEcvzZrTl3Ce0RhVhoOpLa/UvzM11xmhD4upTlJzm3OT3RyS5X
+CNMUIw1WeMkqdO0Ivbq8Ob2hJdia0m5QgqFFO7Wb4Lm+ZmOmXugrHyelh/3k9Z/Vh75bO65py1I
BS0k4ZUkqa5ed2yefdYuk7vcGEKU8VK0U5SfaVOQ7eAhh/300n9WPlS+CJte3XIQ9JLD5UIKH2n5
Uu95LsGju1wIupKeJlm3KT7Wysch781Okr15KkuDzk+qKz77E212+8aeOpYT9zC7+vPN9kdi9ZdG
5OBF4rF1MW9apJyfP3cCs27DMIBBAhgA2ADkVAOQAOQAOQQDYANhANgA2AJYAkqBLIoSVAiQBoAG
wDQQbCjABSRAKAMKDaRAKIDADCg2AbSAFEBgBgBsKFJAGwg2FGBQpIINgGwowAUkAKAMAMAFJBQp
IINgGAGwoywApIIFEUYAYAbSKBRAYAbANhRtIAUVBhAbCjADaQBsINhRsAwA2kAKIDYBhQYAKSIo
2EGAGwDdiqFWIDADADdiA2VRgBlgg3YA2AbAMIDYUYAYAYAYAbsUG7EBsAwAwAwAS0AaANNFQIIo
SEGmigQAaeYQIANMAQwDQQDYAKRQBkABkABkVACQAGQACRUAJAAJAAJFQN5BACRQBkEAJBACQANl
AlhAgARIASAIZQaIBLKgSQCWUGiqMCBRAKCjaCBRFGzQP//Q+kJ6XyX5VMAMIowgNBAllBooMAMA
MAMIDQQYAJYUaKDADADREGAGAGAGmFCSg0EGAGEBoAwAwAwA0ECSqMAMAMIDADADADQQaAMAMAEl
UYAYAaIDAg0AYAYAYAYAYAYAJKowAwA0EGEBoAwAwAwAwAwAwAwAwAwAwAwAwA0yqNAGAGggwAwA
wAwAwAwAwAwAwgNAGAGAGAGAGAGAGAGmVRoA0EGFBgBgBgBgBgBgBgBgBgBgBgBgBgBhAaIDADTV
ygSAYUGAGAGAGAGAGAGAGAGAGAGAGgg0wBIUYQGAGAGAGAGAGAGAGAGFQIaANFBgBgBgBgBgBhFG
AGAGAGAGAGAGBAloA0UGgDADADADADADADADADADADQQYAYAaYUJCjADABSRUGyIMANhRgBgBgBt
AC0AYAYAYAYAKRFCgDCgwA2QCkAbAMKg2RobAFBBiANhRsAURBsKNlBtBAoijADZQbQAogMAMAMK
BSQUKIgwAwAwA2FG0igURBgBgBgBgBgBgBgBgBgBpq4AmwUaCDADADADADADADADADADTAEAGAGA
GAGAGACWgBIBgBoINMASFGggwA08wBABhQYAYAaCDYUKSCBRFG0gBYAqIAtABAoWgAiChaACIAIi
KCIAKgAqCgiACxCgsQAkQAsSKCoAIgoKgAqACoKCIALEALEigsQAqCgqACoKCIgCoKCIAKgoKgAi
CgqACIigqACIKCxACxCgkQAsSKCRACRCgiACIAWgAgARABIhRsAIQGFBsihZUGyKMAMAMAMAMAMA
MAMAMAMAMAMAMAMANFQYAYAJaAEgGmECAoTIIBsIBgCJBAlgCGAJCAbAEMIEgA2AIkgBLCBAAhlA
h5hAMAQwBLCAYAmSAEhAhlAhgCAAbAEsIHNDAVMV5qy4vJfrqJtZNiTpaKp0s6j1nwWS79r9Q232
h06yo+RBavJLPus33q32iKGsq19+fBZvqSV+65U2GFaso3TsuN3a/wCGOf8AEwloBNyks09X7VoR
/hW3sYS/v0AISvlBt8qcbZc5PPvTKgE0qP1Idfly96T/AIQDUoOtaTjKa3SqS1Y+32S7AAbq6uWv
t9GlG1+TeV/5ggQ6XifRjT51HrS/ht/l7QcAb/asvpKzW5ZRXty7Ig5CXJ0PSp0vueVLsebXU5IA
FGkq15xpyqcZ1HaPbZq3bIIEVK2orSqqK3wpL2tasX13kDf7gTCg0tanRSW6dV5dl9WL6rSBr90B
r1ozVqtWU0tkKatH12S7ItFShcaM6SvGlCkt0qtm2uWvk/wxuQDOvUp1GvG1J1pblHJdkpZ9mqVL
+IOqdWhnGnTw6+tPzuta95dsEgv8AwrzoylepOpXnyyX8UryfVqoJ/EPVCvRV4wp4aP1pZS605Xn
/Auwi+fgI6rKhra1SdSvN7beSn+KV5P+FdZWfHxD6EcRSV4Qhho7pS8mXWpTbm/wdwa8/AMKvyeL
cqlSdee/V8lP8Uryf8K6ys3XxDyksQkpUqUKEN05WT7J1He/3LdRGpv4fv7wyrKhra1arOtPfqXz
65zz/la5lTx6h1hnVqLWw1CMI/3klfvnU8lPq1SLPun7+YBiKcJy1sTiHUnwheb6nKVkuzWKl++g
uFm6rthMPdr0pLxjXXdKC69XtCz7p+oXiqUqtni8QstkYvxjXUovUXVrLqIX77+oBTr0YPVoUXUk
9jqNy7oRsuxuRT4B9iKOJqrVxNSNGH1G9X/lFBXXbFdZFu/UMtfCYbZGdaXGXkR7leT/AIo9RWfE
EpTljK0LwSoUnvVqUWvvOzl3yZGvPw/gGfyfDYb95UlVlwpqy/jkr90X1lTUgdYTFVaz1cJRUWt8
Yucutyle3WtUiy+4ZWwetLWxVda29J+Mn6nq98kEs99/UJWLoUMqVLWf1qjv3RVl2PWKbk/pEhVo
YvFxXjpeLp7lNqEeyCtf8MWRrVvIbqOFw21yrPl5Ee93k+6IZ8QPcNi8RiHq4anqLf4uOfbN3l3u
xGpbeAh4CFN3r1VffGPly709X+bsLtNe/wDshSxlGh+6pJv61R6z/hyj3pg3oPKlDFY5J1Xqw3a7
1I9kcv5URrVoktAxoYXE07TlOetZWVoq6tteb7kStYalFk6QV6tLF01SW1Ru1G8vOd87XsSOmd8g
vTDDQreKlOaglrbm2722Je9omK9SBzpapGngYSSU0lC2suWTaT9WzrEMr4G9A1pYvCTbtfykrJRW
zlZCrh5gi+i+FjQrvy4ylqPKN2lmt+zuuWsdOeQ10xjfFYmahGKldeU1d7FsvkuxCJlfIsXSeg8R
CCTikpXbk7LZ6+wkdOpNjOjdKGHpTlGWtnm7NLJbr5+wUw8CuYLGzq1YQglBOSvqrO187vN+srlK
LB0jpKs4XlGKV9u3O2xLNkjp1JsG6PU6dKE5QbavZtq2xXyXaKuArUsXWxrcY3s/Rirezb2lct2i
16ThGlQjTlLVWS2X2LcZjtlwIvRKpzqpQi3a71pPhwSy9paxiC6Yc8VV1IXaSWS47RFy80PdC4N0
HKTavsyd7cb+oVcJoRVfGxlNyhFXb8559y2e0rNon9GSl4pzk227tdhmt48CvOhGDvUnnwjm+/Z7
TTnoWGk44Og5xVrq+eeb2GXWeIK6o1MW75yfE05cix4eK0fRvLbtduewzy6z7MEH8qUPMilzeb9Z
py2J7AxlCm5u7lLPP1Ga64iGlSjF3nK74Rz9ew056Exo6MVFzUdVcdr5ma6YiIqOWMm2k37jTlfI
eYHA+XrNp6u5ZktbxxCcfj3rWjbyd+3uEiZZCMpxnjJpXbb3lZ5E/jpwoU1Tvqq27N2Mx1y8CA+U
xpfu4rrlm/gjTnsT+BjKlB1J3cmr87bkuszXTH3iCrYdzk51ZKN87bX3L3lc7PeHWjqdOtO0I3Sz
cpZ9y2e0VcfIzTeL134qOxbevgIZ0RSwErXm1BcZbexbS7Y7RY8PQhoik55ttb8nyRnl1k7RUsVj
6mL85u3DcbkcbdhFHAVKy1rasfrSyX66hs7dhdqGG23qy5eTH4v1BfEDetpKpUWqrQj9WOS+L7Rp
O4NaGDqYt+RFvnuXW9hUk2HLwtHC/vZ67+rD3yeXdci6kA6mlZU1q0Yqkvs+d2yefsGk7vcIecnL
N5srIEyoEMAGEAgBDABsAHIqAcgAcgAbCAbABsIBsAGAaYAhgGmVAgASwBIAhgGgDABSRAKAMKBS
RAbIDCg2AbSAFWsAYQGAGACkgoUlYAwINhRsKNpBAoAwKMAFJBAoKMANgG0gBQBsAwKNgG0ggVYA
2RRgBhQKSANkBgBsKNgG0igUEGEBsKMANpACgg2FGAGAG0iAUAbKDADABSViKNhBgBsqjaRAKAMA
MIDZVG7BBuwBsAwINhRhAbCjADADADCg3YAVaxAYAYAYAbAMAMANACHkAYAIaKgSRRoqBDQBoIEs
ASAJYAgATIIAyKAMgAMgAMioAyAASAASKgbyAASCAEigbyCAEigDIIASCAEgAbKBIQIAEyAEACZF
AkgEsqBIUJYQaKoURBsKNlApIiBQUbsAf//R+kJ6XyX5VMAMAMIowgEsqBJQYAYAYQGgDAg0woSU
GAGAGBBogMAMAMAEBRjKDQQYAYQGgDADADADQQJKowAwAwgMAMAMAEhBgBgBplBoKMAMANEBgQaA
MAMAMAMAMAMAElUYAYAaCDADRAYAYAYAYAYAYAYAYAYAYAYAYAYwBJVGAGggwAwAwAwAwAwAwAwA
wAwgNAGAGAGAGAGAGAGACSqMANBBhQYAYAYAYAYAYAYAYAYAYAYAYAYAYQGgDCA01coEgGFBgBgB
gBgBgBgBgBgBgBgBgBphAgKMIDADADADADADADADADADRUCSg0AYAYAYAYAYAYRRgBgBgBgBgBgB
oINNACSgwAwAwAwAwAwAwAwAwAwAxgGggwAxgCA0MANpFQKIgwA2FGAGAGAGwBSCDYUYAYAYAbQU
LIDCgwAwAURQoIMANlBhFCkEGwDYUYAKQQKIo2UGACkRBsKMANlApZEBsAwAwA2UCyAwAwAwA2FG
ygURBgBgBgBsKNAGBBgBgBgBgBgBpoASFGggwAwAwAwAwAwAwAwAwAQwo0EGAGAGAGAGmAIAMAMA
NBAgKMYQaAMAEtACSgwAwAwAxZhAQijABaVgDYAtAC0FBEALCgiACIAXEKCRIAqACRCgsQAsQoIg
AqACIigqACoAKgoIgAsQAsQoJEALEigsQAsQAqCgqACIKCogCIKCoAKgoIgAiCgqIAkQoKgAsQoJ
EALEKCRACxIoJEAJEAJEKCIAWgAgARABEAbCgiIDCg2RQoqBRFGAGAGAGAGAGAGAGAGAGAGAGAGA
GioMAMAMANACADABDAEsIBgA2ECXmEAwBLCBAAlgCGEA2AJaAEPMAGAJYQIZQIIAbVioEtACABDQ
QJABgCWVAggNRg5uyV3wQBI09ESlnNqC55vu+NhtvtEhTw1LDbI3l9rN93wTIutBNTEuo7bXw2vu
Xtbgwuw2nV57ed2+yO18mwyGVWpZWdkuEnZfwRz77lQBbdVek49kIfn6mE/fuAFNQyUknwpq7/ie
fc2AJlT1HdxUXxqO7/h/5ZYQIb8f5Pl1LejFasV7fYinIQ34nfCn93ypdjzs+1ACPF+O8pQlP7dR
2j7V/iAETrais6iS+rTj6m/JT67yCbCFQcFeNNRW6VV+xOyfcwa/dAatWNTyZ1JVOEIK0ey6y7Ig
oV4qVH0IUVxnnLud32xigBpUlCvJa0qlee5LJdjd21ytEJ/EFcalD+7w/XnP/NNdlkF4+4M/o60v
7SvUfZf/ABSf8rDP8Q4fjcPvp4dcF5/q1qnfZBePuEelRlK0Y1K83x8lN9SvJ98WVP4h1Lx1DbKn
hlwWUup21qn8WRF8/ARv0CfkxnWm+PkpvqV5Pviys+PiHzWIobXTwseHmy9V6r7boL5n3fv8RFt4
ak/TrSf4I3/mk/5WVnx8RJJYmkrpQwsePmStybvUfZcy15+H7/ERdRYak25znWlv1fJj/FK8n/Cu
s0z4D+j8ocdajShQhum7R7qlR3v91rqI1N/D9/eGVanQTcq9aVae/UT9c529UZIrN16g2FnUrX+S
YdJLbNrXa65S8hdaUQs+6BGJoqq9bFYjWl9WLdSXfdQt1SfUC/ff1GqFenrauGoa89znepLsiko9
jUgS+6B1iqNesrYqtGnFeg3s6qcL6vaokWy+oY+NwuF82Eq0uM3qx/hi7/zLqKniCTXy2tDK2HpP
qpRa9Tn/ADMjXn4fwDBUMLhfPnKrLhBasf4pK/8AL2lZ8B7g8VWru2EoqFvSjHWkubnK9utaqI1L
fQJrYNOWtiq61t6i/Gz709XvkEs99/UJWMoUMqNHWl9ao9buirLsesDcgkK1DGYqK8fJUqe5Tapx
7IKzf4YsLq3kNFDCYXa51pcvIj3u8n3RKnifeHuFxmIxLccLTUFxpxzXXN3ku9Iiy28BEtHxpvWx
FaKlvUfpJep6vfIbTXv/ALIVHGUMP+6paz+tUet/KrR79YLuQPZUcXj4p1HqU92s1CHYsl/CmRfN
AVRw2G86cqr4QWrH+KSv/L2lTxA4o6RqN6uGpqD3aq1p/wATu+6xNL3e4Lno2d9bEVFB79Z60/4V
d99hs7feHuja+HwtanqRlN68fKk9VLPaoq/rfYK1LJRc+llKvUlTVHWaaeslsytt3d5iO3U36A3S
2lTqU4SqSaSk9iu3ddaW7aMTqBWNrKno+M4LJRhbWSe9LPdcLb4CtA1KmKwk3Ubu3KzeWVl6vUKY
eYIzoth4UK0rTU5ajuknZZre7X7rcy1jpzVDbSGOlTxbjBRi9dJySvJ7N7vbssEt8ib6UYd4hU84
xS1ruTtw7X2XJHTqTYNomMMLhJuL115Tbs1ey79wpj4gg9DYyVavCEUoRzuoq2xN5va+1lrGN8h/
0gw/jqqcpRjFRSzee17ErskXObokcAo4PCSlF6ytJ5q13s2cMiNzxBXsHiamKqRgsouSvGKsrb9m
3tNOUuxPaegqripSUUk3nm8+CXUSOmYzQVKneUoXdkld8+C7OIpgIjFYqpjKkoptq7sl8EVi3YsO
Fp/IsO9byW735XyXuMukmoICNSnT8yOs+Mvgvfc057Fh0m3CkoJXbsrJcNpmOmXAhKOj3KSU2ot7
tr7l7zW3PtEzpXErDqMEk+vYrGY6ZXQh6U542cYN5X2bFbqNMcia0paSUXJRW18eVkZjeQjMOqcp
qMY6zb2y+C95WIJHS1WyVNb87ewkbzojaeClJrWtG/Hb3bS7YmImcXVWDpqCV9xI6ZXQhJ4iVTK+
XBZI05bE7Rh8jpbUm974sy6zxBBt06XGb7l8TTl4Evo2TcXOVlHckrLLazNdcREVoTxsnO1o8Xkr
Fc75BcFgqdWVm9a2btku/eFkB9LY5wfi4O1ttvYJFzyEFSw88Q/JTf64lc5Niz0ox0RSvLa9tt7M
8u0+zBXqmkHFvxaUb79su9+41py7gfRWEeMqa881HPPeyVcZsPNMyjWkozmoxjuWbb6t3aI1mIN4
yGH/AHUM/rSzfdsXrK570GFavPEu8m2+ZWbdg0NGTa1p2px4yy7ltY2vaMdWhhfNi6kuMso9219o
PEDPE4+pispPyd0Vku5DSW7EeyshEgAcioBsAQwAYANhANgA2ADkVAiQAOQANhANgAmADYQIAEhA
kKNFQDZFGmVAgARIA0ALSIDZQYQCkrAGwDYBhVCkiA2RBgBgBuwUKSKDZEGAGwo2AKsAbAMCjYAp
KwQbCjADYApIA2AbANhRgApIINkUbAMANpFAqwBhAbAMCjdigUkEGyA2FGAGACkgg2FGwDADABSR
AKKDADADaQUKIDAg2UGBQpIgNgGAG7AGwo2kEGwg2FGEBsKMAMAMAMKDdgg3YA2RRgBgBgBsAwA2
FG7AGmgDQQJauAJANMIEMKNBAllAgA0wgSAJYAhgCJBAGRQCkAAkABkVAGQACQACRQAkEAJADeRU
AJBACQACRUAJBACQAhgCSoEMASwAYBplAggNMqBIUJCDSQAoA2FG0ECiKNlAsgP/0vpCel8l+VTA
DADDKjQQJNA0AYAYAYQGggwASwo0UGAGAGggwgMAMANMKElBjANBBgBhAaAMAMAMANMIElUYAYAY
QGAGAGgDQQYAYAaZVGgDADCA0AYEGgDADADADADADABJVGAGAGAGggwgNAGAGAGAGAGAGAGAGAGA
GAGAGACSqMAMANBBgBgBgBgBgBgBgBgBgBhAaAMAMAMAMAMAMAMYAkqjADQQYUGAGAGAGAGAGAGA
GAGAGAGAGAGAGEBoAwgNNFAkAwoMAMAMAMAMAMAMAMAMAMAMAEMqDRFGEBgBgBgBgBgBgBgBgBgB
pooEFQYAYAYAYAYAYRRgBgBgBgBgBgBgBoMjTQUJKDADADADADADADADADADGAaCDADABAaG0ECg
gwAwA2FGAGAGACkAKQBgBgBgBgAtEUbAMKDADYApEBsAwqDZFGwoUEGAGwo2AKIg2FGyg2ggURRg
BsoNoAUQGAGAGFAtIgNgGAGAGACgo2EGwDADADAo2AaCDADADADADADADADTQAkKNBBgBgBgBgBg
BgBgBgBphQkA0EGAGAGAGAAwDADADQQJYUaANBBgBgAhqwBooMAMAFJBAoijaQAsAxABABaCgkQB
aCgiACAC0FBIkAWIARBQVABUFBEAFQAVBQVEASIAWIUFiAEiFBUAFQAREUFQAaIAWIUEiAEiFBYk
UEiAFiAFiFBIgBIhQWJAEiFBYgBIhQWIASIUFiAEiRQWIAuIASIUEQARACwAiACIA2FC0QGyg2RQ
pFQKIowAwAwAwAwAwAwAwAwAwAwA0AYVBgBgBgBgBoAQAYAJkAIYQDYAhhAkIEMAQECGAJYAgAQw
gQwBAAhgCWEAwBDKBDQQIAEMASEAwBMkAHoYOpifNWXHYu8LrYkaei4U/PlrPgvjtfZmTbXaHaqK
irQSXVt977w0GnjnN5Zvlm/U7Lqcn1BnYbTqJKzatwve/Uo2XYwgb1JOOTWX23qrshH8yoAazq3S
1pcVFaq7Xv7UgAV1S3wh1eVLvzXrQQJdPX8rVcvtVJWT9a9rAESq6uWvt9GnG1+TeX+YAS6PivQj
DnUd3/Dv/hYTgDlJV/Jcp1HujFWXZt/wooNOLo7qdLr8qX+Zp9kSHAAksTLJVK0ueS9V3btRTn7w
rWlR9KFLlDOXervsckANqdONZvUpzqve5ZLtUc+3WCBc6kqWUqkaa+rTzffHJ/ikANaNKNT91SlU
a2uV7ddo2t2yaAFVJygnGdWMI74U0nf+C0X2yuANqNOFR2o0ZVGtrle3XaNrdraCT7gurKaWrUrR
px3wp2d+yFo/xO4A1oxpzerRoyqy4yv36sLW7ZNFSfcDVXVS1atWFKO+ELZ9caeV/vNMi/v96DCn
4m+rSpzrS3a2Sf4IZ/zFZ8B3U+UU01OcMPHfFWi+pxgnN/i7yL5+Ai08NReSnWlz8iPcryffFlZ8
CStiqayUMLF78qbt1u9SS7w15+H8BFyjhqLvOc60t+r5Mf4pXk/4V1lTwH2HliJx1sPRjRh/eWS/
5SVHk/utdRF8+n7/ABDKvRpa2tiK7qT3qF5PtnKy7VrFT40Ew1Z1Xq4TDpvjJOrLtutRfw9oJ90/
UKxVCpWs8XiErbIKXjGuqMfJXU3EFnvv6hrHEYbD5UqUqkuNR5dkIW9cpIJ4gkqlPG1Y2qSWHpP0
XakmvuK0pddmRrz8P4CO1MJhdsp1pcIrUj3u8n/DEqeIH+ExGJxH/ElJU4rbKEc111JXa70iNS30
DergqcW5YmunLeofSS7ZXUf5n1FZ177+o1HG0aLtQoKUt0qj132RVo9jUgu/cH+Iw2LxSXymapQ3
Rm9VLqprPuiRdW8hqlhMLvnWl/BH3yf8pU8QPcLi8VirrC0/FpbXTjZrrm7y75WIstvADPR8Kb1s
RWjrb4w+kl3p6v8AME17/wCyNrG0MN+5paz+tUet3RVo9+sU3J/SH06GM0hFOq3Cnu12qcOyOS/h
TIvm/vQCqGFwvnzlVlwgtWP8Ulf+XtCakB6Okp31cNTjB7tWOtP+J3fdYaWZe4EqaNqN62JqKD36
8taf8KvLvsNr2+8YquFw3mxlVfGb1Y/wxd/5uwJ4gc0sVisenCimo74046q7Wv8AMyNbt4Glo6GH
/fVYp/Vh5cvV5K7xtNe8EhjqWFd6VK7XpTes+xK0V23C70Og9LcJPHUqbhsTzu0lZra22kYjv1Js
E6QRpzwkJVLtJxfk2zya2vdntz6hFz4GSxFtHa9Natoq1/KtaXNe4epv7IV0cdWvhpurrXlKVnK+
zVXHcKYcCO6LUadGtJRnry1HeytHat7zfcKz04AYvHShjHCCjG80m0vKd2t7z7rFS3yJXpPhXiHT
zjFLWu5O223a+wka6k2HGFUMPgXZ68bS4q+b7Qs8QRmgMU69bVSjGKi3aK9r2vvLWcLuhOmsHKtX
lKTjGOVnJ7clsW19wiZTyJms44PBpefGy4q93frMul8QRuhcVKvWUUlGKTbUVZdu99paxhd0E0zh
pVqrk2oxSSTb7cltYhnN0SejYxwdCU4vWWbva17f6ErePiCufLJ1PJj5Ke6Kt+b7TTlsWbSdK1KM
LpLLNvckZjtlPAi9H0aUqkYq8ntvsWXrfqLXPGTYcaZxcoz1ItpJZ25iNZUa0PhJKevJNJLK/EVM
YNaQrU5VG3eTWVtiy57RDKh5oibq6zsoxWSSX6ZK1iI/EU54ucppWjfJvJWKxZsSGi8LGDc76zWW
WwlbxgZYnHynJ6uS4rbbrLpi5A+iqLqTc3u9orWECsbKFSbcpXtkkvjsETIbwMvGTtGKSWbe194q
4hOkpvET1Ipu3DiIZeQ1pYLWajKSTe5Zv8htntEnj8R8igoQ2+4kbyuhXalSVd5ttmnK3YseDpLR
9LWlk3m7+pGXaeIIOdenBtpa8nvls7l7zTlsP9GqeMlrSfkx2LYr9RK3j5A9IqeNnllCOV3kubET
LyGEKVKLUc6knlZZLv2lZ1BO4+utG0tWNlJ5K3rZmeXW3tgp9LDzxLtFNs24a2HDwlOh+9nn9WOb
79i9ZF1oIekPE5UYqHPbLvezsGju9wi6lR1XeTbfFlZoCyoBsIBsARIAHIqAbAEMAGwAYQDYANgA
2VAiQANgA2EA2ACYAgIBgGgBABoqBDIo0VAMgEyKDaViA2UGJXIBdrAGAGyg2kRQogMCDADdiqN2
AFWIDAgwA2FG0gBQBsAwKNpXAFpWAMAMANhQpIIFAGAGwoywApIIFEUYAYAbSKBRAYAbANhRuxQK
CDCKNgGAG0gBVgDYBgBgBtK4AqxAbKDADAoUkQGwgwA2VRsA2kQGwDABQUYAKSCDYBhAbCjADADC
gywAqwQbsAYRRgBgBgBsAwA2FG7AGwg2AaauAIYBoAS0AaAEtFQIIo0VAhoA0ECWAJAEMARIADII
AyKAMgALAAyKgBIAbyKAEggBIAbyKgBIIASAASKgBIIASKBDIgSUCGAJAEAGgBBQaCBDCjTCDQAo
KMKBaIg2FCkAbID/0/pCel8l+VTADCKMIBLKgSUGAGAGAGiAwINBQkoMAMAMYBoiDADADABLCjRQ
aAMCDADCA0AYAYAYAJZQaAMAMAMIDADADTANBBgBgAkqjADADADRAYEGgDADADADADADABJVGAGA
GAGggwA0QGAGAGAGAGAGAGAGAGAGAGAGACSqMAMAMANBBgBgBgBgBgBgBgBgBgBhAaAMAMAMAMAM
AMANMqjQBgBoIMKDADADADADADADADADADADADADADCA0AYQGmiqEhBhQYAYAYAYAYAYAYAYAYAY
AJYQJKowgMIDADADADADADADADADABLRQJKgwAwAwAwAwAwijADADADADADADTCDAgSyqNAGAGAG
AGAGAGAGAGAGAGggwAwASFCkEGAGAGwowAwAwA2AKCDYUYAYAYAbQAsyow0DADABRFCggwA2UGEU
KQQbANoAwKFIIFEUbKDABREGwowoNgCyAwAwAwA2kUCyAwAwAwA2FCkAbCDADADADYUYAaCDADAD
ADADADADADADTChIBoIMAMAMAMAMAMAMAMAEsKNAGggwAwAwAQwDQBgBoIMAEBRjCDQBgBgANqwB
hQYlcAIQGABFkAYAKQAtBQQAWgAiChaACACyKCoAIgAqQUFQARBQVABIgBYkUFiAEiAFQUFQARBQ
VABUAERFBUAGiAFiFBIgBURQSIUEQAWIUEiAFQASIUFRAEQUFiAEQUFiFBIgBEAFiRQSIAuIASIU
EQARACwAiACIA2FC0QGyg2RQpBAoKMAMAMAMAMAMAMAMAMAMANBBhQYAYAYAYAYAaYAgAwAwAGAD
kECGRAhlAlhAhgCWECABDAEMIEACGAIauAICBDAEsoEBAN5ACGAaUXJ2WbCB/T0XOWc2oLnt7vjY
m2+0PqeGpUNi1pLj8N3Ju/WGtSDdTEOeW3qz9nxRDYZ6+vdbeNvK9nk97kysgFWaSzaS5u/dFZd4
SgMpO2xtbtdqMeyKt6mAAdS7spNt7oK1+3b6mVANw8XujD73lPtWfsQAj/ij69S3Yl7cu4JyEt+K
3wh93ypdjzt3oARqeN8pRlPjKbsu3/8AaANSqais6ijyprPtasn3sAFCjdXjTy+tN5f5V2O4NBFS
qrWnUy+rTWXb5q7VcJRqNFpXhSSW6VR+y9ovuYAGvUUsqlVyX1YLyfXZLsTKUbjSklrQpKK3TqNP
/FaL7rgAMROM/wB7Vc7bIwWS7XZLsTQQZCnK2tSoqMfr1LP1ytD1XAAYican76s522Rgm0uWdkux
NAv3jVKDmr0aKt9eflJdbdod6BPugFiHr5V690vQh5VvZBdjYT40DoJVf+J6Dm16U7ytzsrRX4kw
T7oN4jXmtWvXjGP1IeV3RhaC70C/fQ0pOk3q0aMqst2s2+6ELetsqfAOaqxCWrVqQoQ3wVl3wppv
+JdpFu/h+/uEXrYXD7Izqy5+RHuV5PviVnwJBLFxV4qOGg9+VO6635cu+RGvPw/gI2VPDUXedSda
W9QWqv4pK/8AKVnwHWGqVqyvhaEYRW2errW65zuo9a1Qs36QAxFCM3rYrEa0uEb1Jd7aj3SfUVL9
9/UDpYiknq4ehry3Obc32RVo9jUiG/dA6xNDFVlq4mrGjD6kna3VSgm1/CusLZfUR+tg8LsU6z5+
RHuV5PviVPEEjh6uMxEb0IKjT+tFKmu2pJ3fbJkWb9PAYywdCi71q2vLeqacu+UrLtWsVNT1BKON
imo4agtbc5fSz7rav8o0u/dP1DrFYPE4izxdVU0tkaks11U43a7kiFlvIaa2DwuxTrS5+RHuV5Pv
iU8QPsLicZjU1hoeLhvdOOou2bz/AIpEWW3gN3o+jQd69dN74014x/xZR7mxtNe8KWkKOHyoUU39
ao9d/wAOUe9PrBvXAfVcNjcfFOvLUp7vGSUI/hjl/KmFst5DZUcJhfOlOtLhBakf4pJyf8K6yp4g
PR0nVk9TC04we7Ui5T/id5d1iaO73BdXRdRvWxVSMHv15a0/4Vd99hte33jFWwuF82Eqr4zerH+G
Lv8AzdgNyB1RxWL0gnCimo74046se1r/ADMLLbwErRtPD/v6sU/qw8uXq8lfxDaduuQtY2hhv3VJ
N/WqPW/lVo9+sRdyBwli9LL0nBdUYL2RQ4POQxYOhhv3tXWf1aav/M7Lu1gakC1pKFD9zTjH7UvL
l68l2IaXu1wOhaYoy0ngabuk7Qk3JpLZndvrMR3ym4F4yMHo6Ov5cYxh5rtezSybXuHqt4G8FiNb
R7lSWpqxnZXvazb2sepL4G+i6qzpTdXWvKV05XzVuYp0xHdF6NOhWkoz15ajvZWjtW95vuFZ6c1Q
PE46VPG6kVGN6kU2lm722t591ipb5Eh0mwksTKDTiopO7k0lu/WRI11JsO0o4bA2flxS3ZXvLqC8
QMujmI8dUkoxjGKjuWe1bW8xU6dEfpHA1K9acmtWOt50nZZde3sLGcp5Fh0w4YehGM02rpWTtsXs
Mx0y8QN9AVfHSlaMYxSWxZ58W89xazhdiMxeFqYmrOdrR1n5TyWWW1lZs3RP1lHB4VRlmrJZO175
7TLpfEEVo7EeMqxjCKir52zdlnm3mWsY3yH2mKM8TNKKyis3sWfMRrPyCaHwqpuUtZSdrZbF2imE
EdidINzk4JJ387a+97OwaZuQmdGKSpObu5O7z5ErePAg3QjDOpNX4RzffsNMaE9FrB0NaKtdXV9t
2ZdOIK65TxL3yfeacuRZIwWDoWk7NrPrZl14ghfHQpebG74y+Gw057E54yVCjd+c162ZdN6ghY4W
W2Vorn8Nppy0JnDQjg6bne9877Ooy6zxBBVcXOrvsuCyNOVok9E0LXqPqXvJW8IGeLqU5zcpNy4J
bO/4BKC4CbrztFKMVm7be/aKY+RmlassTNU4Ju223ERcrsMI4JRaU5JN+is38EXbHaJvFVFoulqw
2vZ72Z5db9mCq1K0q7vJts04W7E/ojBOlerNWtsv62SuuEDHH4+lVnrWc3uvlFdm19okZuUEXXx0
6ys3aP1Vku5GmbQwYZA2ECAAZQDYQDYANgA5FQIYAhgA2ADCAbABsAGyoByAByAEMIBMAGwBAQIY
AkASwBIQJYUJKgGyAwoMANpXIoUEGwDAoUkAbIgwA2VRsA3YA2RBgBsKMChSQQbANhRgApK4AoAw
AwAUkFCrBBsAwKNgG0ggVYA2RRgBhQKSANkBgBsKNlBuwAoiDYUYAYAKSKDZAbAMAMAFJACgDADA
DAoUkQGwg2UGBRsihQQYAbsAbCjAgUAbANkUYAYUGAG7BBuwBsijADADADADYBlgDdgo3YA2EGwD
ADYUaCBLQUJCDW0AQAaCBLRQJIBLKBABphAgA0wAbAAyCAMigDIADIADIqBvIABIoASCAEgBvIqB
vIIASAASKgBIIAsoEEQIKoSwgSADYBoASyoEkUJZUCQowgNlApIINkUbKBZAbAP/1PpCel8l+VTA
DCKNEQJZQaKDADADCA0AYECWFGigwAwAwINEBgBgBgAlhRooNBBgBgBogMAMAMANMASUGAGAGAGE
BgBgBphBoAwAxgCSqMAMAMANEBgBoIMAMAMAMAMAMAElUYAYAYAaCDADRAYAYAYAYAYAYAYAYAYA
YAYAYAaZVGgDADADAg0AYAYAYAYAYAYAYAYAYAYQGgDADADADADADABJVGAGAGggwoMAMAMAMAMA
MAMAMAMAMAMAMAMAMANEBhAJaKo0EGFBgBgBgBgBgBgBgBgBgBp5gCCgwgMIDADADADADADADADA
DADABBoGggwAwAwAwAwAwijADADADADADAg0EGACSqNAGAGAGAGAGAGAGAGAGggwAwA1YKNhBgBs
AwKMAMANgG0QCkUGAGAGAGAC0QGwowoMANgCkQGwDCg2AbIoUEGAGwo2gBREGwo2UG0ECiKMANlA
pAGyAwAwAwoFogNgGAGAGwoUkUGyIMAMAMANhRgBoAwIMAMAMAMAMAMAMAMAMAEtBRoA0AYEGAGA
GAGAGAGAGACAo0EGAGAGACZACQDADADQQJYUaANBBgBgBpq4AgoFpWIDYApIAUAbQAsAUgoIgBYU
EQARAC4gC0RQVABEFBYgBYgBIhQWIAVBQVEARABUFBEAFQARBQVABUAERFBYgBYhQZABEFBUQBEF
BEAFQUEQAVBQRABURQRABEAFQUFQUEQAREARBQRABIgBIhQtABEALQARABEAbChUSAUUGyKNoIFh
RgBgBgBgBgBgBgBgBoAwqDADADADADADADABLIBJQYAYADAESCBDIgQygSRAhlAkIBvIASwBAQIY
AhgCQAbAEsIEMoBsALTws8R5qvz3d5CTYf09GRh58r8o/H4Iba7Q5jUjRuoJJb7e9+5tEaAJVXLZ
6s7exLtduRU2GqlrZepeVbutHuzCAdaVvOsvvO/dFe8IBOTqLJSkuLtGPds9aYQNnU1PSUfuK77/
AM2UGnStnqW5zfs2X9YQDlUUvJc27+jBWT9nsYBrxbp+jGHObu+5+6IAKclVdnKdR7ksl2Xv7EEG
3GVLdCn97OXc7tdiQUAk413m51Zd3xb9QQLtKl9Sl65f5pL1ADZ6lWXp1Zvs/wCE36gn8QRqpR+p
R/xf5pr1Bf4BnLxc5enVk+z4t+oqA7VWjuhQ68pf5p9xF/gGM3SbvJzqyf4V3u7fcishxq1aauoQ
oLjLJ9acry/hIv8AAMazpN3qTnVlyyX8Urv+UqUGpxq21qdKNOP15W/xTyv92wP3+9hpX1Ju9etK
pLhFN9mtKyXYmgl+8ZQvV/4noXt6UvLt13tBdqB8IE4iLqf8UV1ZehHy7dSVoLvQL99DWnOlfVo0
XUl9tt90Y29bkE+AdV44hrVrVI0Yb4XUe+EFfvXaF8/D9/cItvC4fYp1XztCPcrt98Ss+A/g8W46
1OEcPB+llT/nk9Z9SbI15+H8BGVKGHpvWq1ZVZb1TW3rnO3qjIrPgGw1eVZ6uEw6ut7i6ku261V1
qKCy+6fqN4rDzr54vEJW9HW8ZJdSjeK6m4gs99/UMvH4XDeZTlVfGo7L+CGf8zKm5BJNY6tDO2Hp
Pqoxa9Tl/MyNefh/ARjw+Ew3n1JVXwprVX8c1f8AlKxqQHw2MqVnq4OhFPioupPvle3WlENS+6fq
N4nA1K0tbGV4p8HJ1J90b26m4gs99/UA8fhMJ5lOVV8aj1Y/wQd/5gm5BIU547HQ+jXiqL3xSpQ7
ZeSn2tsi+b+9Bl8hw2F/e1td/VpK/fKVl3KRTUgVDSUKTthqEU90p/SS9a1e6JNG/d/ZDzEYDF4y
0sVPxa3eNla3VDOXdGwWy3kAVPB4Ta51pcvo497vJ90Ss+J94dYfSNes9TCU1B/8ai3L+J3l67E0
1LfT+A1PRTi3LE1Ywe9N68+6N7fiaG0uPvGvlGFwvmU5VXxqOy/hi798mU3IHNHEYzSicaSap71T
ioQ7WrL+Jk4XdoGtG0sN+/rRT+rT8uXerR9bG07dchax9DDfuaKb+tUes/4VaPemF3IHWrjNLxu9
Z01xtCmvZFDhfOQSsFh8N+9q6z+rTV/5nZd2sE1J/QCLScKH7mlGP2peXL1+SuxE0vdrgGeFxWk1
r1NbV+tN6sV1OVl3Dg1aNrDYbDfvKjqPhTWX8UvcmDUgItK+J/c040+fnS75bOxIaXu9w6DTjPSW
jbTflOLu5ZbJXu2+ox6vRziFYSnB6OcW1OMYyvq5Xs27Jteuw9SeyFaDrqtg5+LjqW10km3na97v
fmKYXwB9E/GyjUlU1s2rOV89vEVOmGnR6hTw2IklPWnqyVknZZre9vd2iphNUJxeMdLG6kYxV5wT
dryd7b3e3ZYqW+Q86S4OeKlBxWSTu20ku1kjXUmw7rRjQwKU/KioxvqvbmtjaC3xADo3VjVc9SCi
klxbd77W/wAhTAQtXC1cdXk0m467zexK/Flc7N0WPpA6doKo3tbSS29r2EjpmF6BlBwlKMdVXttu
3Zb+8lXAVhRq6QlfypO/Xb4GnHkWrTOooRjJtK+xK7dl+ZmO2YbaG1JTepG1ltbu8/Ui1MAwx85Y
qtJK7s7JbdmRYzl5onMDS+RUG5ZPNvluM1vGaggVVp0/MjrPjL4L8zTnsT2k5ulRUd7ssjMdMuBD
UNHzqNa3kp8cn2LaXbExEzpSvGmlFq++17IkbyojsLWniZqC8mN80ssisy7EhpOEq7UUslm3sXeS
NZeQzwuFhOai5az4LZ3lZkDzSWLdNqMXbiJGsshGUabxM0s3fayucmxMaQlGyi5WXBZszHXIREas
U0qcc3vlm+7YVz2JbSNV0Kere8pZfEkdMrqCCjg5NXlaK4yy9W005aE9RhHRtJy23z4X4GeXWfZg
r1XHTrb7J7lka05XLYkNDYXXk6j2LJdZK1hAjSE6dWd5yulkox+OwRcg3w1Z1ZqFKKhfftdt+bDM
vuEjpnFeIgqUXm9vV+ZI3ndCpSNuAHIAQwAbCAYAMoBsIEMAGwAcigQwgQwAbABhANgA2ADZUA5A
A5AA5BANgA2AICBMgBIAhgGgBDAElQIZFGioNpEUKCDZQbIo3YA2RBsoMsFG7ACiIMANhRgUbANp
BAoAwKNgG0ggUFGAGwDaQUKCDYBsKMAFJBBsijYBgBtIoFWAMIDYBgUbKBVgg2QGwowAwoFJEAoA
wAwAxK4AtKwBsAwAwKN2AFWIDZUGBRsA3YgNgGAG7AGyqN2Ig2AbIDYUYUG7BBuwBuxAYFGAGAGA
GAGwDLBRtIAVYqDZAYAYAYFGwDADADQQIYUJCDTQAkA0yoEEUJCBLRQJCBDANMAHIADIqAMgAMgA
EigDIIG8gAEigBIIASAG8ioG8ggDIAbyKgDIIAMAQECWVQlhAgATIAQAaZQIIDTKgSFGAG0ggUQG
yqFJAGyAUUH/1fpCel8l+VTCAwihLKgSUGAGAGAGEBoIMAElUaAMAMANBBhAYAYAYAICjCg0EGAG
AGiAwAwAwASwDRQYAYAYAYQGAGAGgg0AYAaZVGgDADADADRAYAaCDADADADADADGAJKowAwAwA0E
GAGAGiAwAwAwAwAwAwAwAwAwAwAwAxgCSqMAMAMANBBgBgBgBgBgBgBgBgBgBgBhAaAMAMAMAMAM
ANMA0VRgBgBoIMKDADADADADADADADADADADADADADADCA0QCSqNBBhQYAYAYAYAYAYAYAYAYAJa
AElBhAYQGAGAGAGAGAGAGAGAGAGmigSUGggwAwAwAwAwAwijADADADADADQQYEGgo0UGgDADADAD
ADADADADQQYAYAYAYAYAbCjADADABSIDZUGwowAwAwA2kALMqMNAwAwAUkRQoIMANlBhFCkEGwDE
AbChSCBRAbKoxACiINhRhQbQAsgMAMAMKBaRAbAMAMANhRtFAoiDADADADYUYAb2ACQgwAwAwAwA
wAwAwAwAwAwAwASFGgDADQQYAYAYAYAYAYAJYUaANBBgBgBgAMAwAwA0EGmAJCjAg0AYAYAatcA2
AYALQBsAUgoUEC0FBIgC0FBEAEQAtAC4kUFiAFiFBIgBUFBUAEQAVEUEQAVABUFBEAFQARBQWIAR
EAWIUEiAHiFBUAEQUFRAEQUEQAVBQVABEFBUQBEFBEAFQUEQAQKCgBERQRABEAEQAuIUEiALQARA
CwAiANhQqJAKKDZAbQUKANgGAGrhBhQYAYAYAYAYAYAYAYAYAYAYAYAYAJkQCSgwAwAGwBEggQwg
QwBJECGUCQgGwBLYAgAS2ECABDAEyQAm1wgd09HTn53krnt7v9BtrtDuGGp0d2s+fw+NyNa0FSru
a5er4dz7AbDSU9e+/jZX79ke+4QCc096vu9J/wDB7EVAKp9rL772dUVn33CUCdTxmS1pdSsv12Lr
AAt6m+Meryn35270ECNXx2aUp85Oy7f9QcjTn4v0ow5QV33r/hFAONNTzjBy+1J2Xu9bYQadTUyc
1FcIL4WT72ADhSvnCm2vrTeXuXe2AaqTsrSqWX1YL22tH1sAHTp6yvCm2vrTeXuS7bhBqpN2tOok
vqwXwtH1sFAqdNT/AHdJy+1Jtpd1ku24BurOSVp1VFb4wz9UbR9YA3pxjPKlTlUfF39kbW7WwgJO
VSKtOpGmvqx+EP8AMwoZQVK9oQlUlzyX8Mbv+YqBy/HUsm4UFwXky7Urz7yL5+AjpeIpvNzqP+Fe
9v1FZ8B1FV4q8IRox3SdovslN638PcRfPwDCtGlfWq1ZVJfZT/xSz9TKlC6DlV/4noKy9KS17dbl
5C67IE+6AWJg6v8AxRXTt6MXrtdVrQX8QL99DaFWjF6tKk6ktzm2+6MbetyCB3WhiWtWrONCG+N1
DvhBaz7UF8/ARbWFw/16r7IR/wAzf8pWfEDyhUxNVa2HpRpQ+ulb/lJN3XZJEWb9AxrYandyxFfX
lvUE5vtk7R7nIrOvfQiliqaerh6GtLc53qS7IpKPemDfun6h1isPiq6tiaqpQ+pKVrdVOKbX8KEW
y+oj/wBkwv16z7Kcf80n/KE8QPcLiMViU/ktJU4r0oRtbrqSu1/EiLLbwGVTA04NyxOITlvUPpJd
91H+Zmk177+oQsdh8PlRo6z+tVet3Rjqx7HrA3IH1ahjsbBeNl4qk9ik1Sh2Ryv2JkXzf3oMfk+E
wnn1JVnwprVj/FJX/lKmpAehpKcpamEoxjLdaLqT75Xt+FIaWX3AuJ0bWrS18ZWUH/xyblP+Fa0l
22JssvqAqeDwvmxnWlxk9SPcryf8SKeJ94eYbG4zG3jhoakd6pR1e+W233mQlt4/gAS0XCi74itG
L3xj9JL1eT3yGzt9/wDZCvlmGwv7qk5v61V3/ljZd7kVNyf0h1GeO0tG0VJUuSVOmuvzY95OGvN/
egBaPoYX99WTf1aS1n/E7R7nIu01Jz/AK+cqOG/c0Y3+tUeu+7KPqZNHdrgOHQxul4603Lxe5zah
BdV7R7hwurkELB4bC/vKrm/q0ll/FKy7kwak/oBFpaOH/cUoQ+1Ly5d8sl2JDR3a4B5YLF6S+kqu
Wr9epLVj2a1vUF1aMWGwuF8+o6j4U1ZfxS90WE1ICLS3if3FOFPnbWl/FK9uxIml7vcC/IMTj/pK
l7fXqSsu+W3sGzVoUsPhsN583UfCCsv4pe5BdSAi0t4n9zCNPnbWl/FK/qsNHd7h0Do54zG4Scau
s3JyScr5ppb2Yrvh5gX0coxWGnS1lPOSere2a2Xa9ewVcJ4GuimIhXpzjCCglLZdt5ra2+rkKdOg
HRSVWcqrqazvbynfO197FTphGicPDD4yflpybn5KTyz3t2z5K4qYzVCcfi/E41RjCKblC8mrvO3H
JdgLdUOek2EqYqVNQi3ZO/BbNr2IRepNh5iacaeCUajdlGN9Wz3rZuC3gD6NypyU/FxcVlm3dvb2
dwpgIOhUqY7ERu5SSmupK/qK5zzROafpRqShrzUUk8rXbvwRI6Zhzo5woYaUoXt5T8rfZfkSrj4g
gcHiKmLqwjJ5ayyWSyz2LI05y7Ezpuj46UbyjGKW1vjwW0kbzgcaHpwpQlKLbV821bZw7yVcBAVM
fOpez1U9yy/1NacrkLHi6Ljh1BWWSTbdusy7WeBFYLDU3UitbWd9yyyz2srnIHmlsZKlJRi7ZZvf
mI1lQDQ9N1ajm87LbzYqYBePjGdRucstiSzfwQhkHmiowd5Rja2V27t+4laxERiazxM282r5I052
7EvovDOinOSt18DNdMJoMq1am5OVnJvjkviVi2CR0dOVROTslsSWSJXTERdSM8ZJySy47rFc75Dz
R+DSlraybXDZ3it4wN8ZpBuT1bK2V94kZyyDXB0njKi1s97CSbErpReMtFyUYrN8e4kbzERCVOLU
YR1pPfLZ3L3lYE1pGv8AJaWqvOeXxJG8rqCos04izaJoLC03VlvXq/MldcZryK3iq7xM3J7yuduw
1kVkDkAIYANhANgAygGwgQwAbAByKBDCAbABsAQEAwAbABsqAcgAcgAcggGwAbAEBAmQAkASwBIA
llQIZFCJAGgBYQbKDZFCgDAg3YKNgG7AGyINhRgBsKMsECgDYBgUbAFJWCDYUYAbAFJAGwDYBsKM
sALSCDZFGAGFBtIAUQGAGwDZVG0gBQQYRRsAwoNpACiA2AYAYAKSChQQYAYAYFCrEBsINlBgUbCj
diINgG7AGwowA3YIFEBsKMKDABSQQbIowAwAwAwA2AZYA3YqjdgDdiINgGAGAGBRsAwAwAVYA0wB
IBpoIEAGgBDyAMAEMqBJAJZQIANMIEACJAAZFAFhACQAGRQAkEAJAAJFACQQN5ADeRUAJBACQQN5
FAGQQBYQIZVCGAJCBABpgAwDGUCADQQICjCoFkBhFG0UCyA2UC7EB//W+kJ6XyX5VMIowgEMqDRQ
YAYAYAaIDAgSwo0UGAGAGMA0EGEBgBgAlhRooMANBBgBhAaAMAMAMAEMoMAMAMAMAMIDADADQQaA
MANMqjQBgBgBgBhAaANBBgBgBgBgBgBjKBIUYAYAYAYAaCDADRAYAYAYAYAYAYAYAYAYAYAYAYAJ
KowAwAwAwA0EGAGAGAGAGAGAGAGAGAGAGAGiAwAwAwAwAwA00VRoAwAwAwA0EGFBgBgBgBgBgBgB
gBgBgBgBgBgBgBhAaYAkKNBBhQYAYAYAYAYAYAYAYAaYAkoNAGEBhAYAYAYAYAYAYAYAYAYAJaKB
JUGAGAGAGAGAGAGEUYAYAYAYAYEGggwA0woSUGAGAGAGAGAGAGAGggwAwAwAwA2FGAGAGAG0AKIg
2VRgBgBgBsAUiA2FGFBgBsAUiA2AYUGwDZFCggwA2FG0AKIg2FGyg2ggURRgBsoFIgNgGAGAG0ig
WQGAGAGACiqFEQYAYAYAbCjADaQBkggSAYAYAYAYAYAYAYAYAYAYAYAaYAkKMAMANBBgBgBgBgBg
BphQkAwA0EGAGACZACQDADAg0AJaCjQBoIMAMAMAMAFJACgDYULCDaCggAtABIhQtACwAhFBEAEQ
AVBQRABUFBUAEQAVEUEQAVBQWIARABYhQSIAWIASJFBYgBEAHiFBYgBIhQWJAEiFBIgBUFBIgBYh
QVEASIUEQARBQRABUFBEAERFBAAgARABEFC0AEQAtABEALQBsKFRIBRQbIDaChRUGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGACGQGigwAwAGAIYQIYQIYAkiBDKBIQIYAiQAhhAMAQwBVOhKt5qbBJs
PoaPUfPl2L4k212hypxoeYkuf5/FoNcALquWf673Ze3rCbDdy19mduCvbrv5K7mEApTS2tf4n8Oz
IqBFRN7Vlxm7Lsj/AKgAnWvkpN8oq1/11MJsClFw3Rjzlm+78gBEmquTcpvgsl2bfYgg1qunuhDr
zfdm/UgAUmqrzc6j7vi/Uig21KnuhT68372vUQAJONR5udSXd8W/UVAtxlT3Qp9e313l3IihvUlC
b8qU6ku71u79SKgJqzp7IxprjLb/ADXfcgBrVlCTvOcqj5ZLvln6ggIoTSvCnGC+tP4zy7kFAKzj
P97Vc2t0bv1u1uxMIMpRc1elSy+tLyvW7R70CAdZuatVqq31Y+VbqStHuYKAU9STtSpOcvtXf8sb
etsIDVPGpWnUjSj9VWXfGC/xBf3+9CPboUtilUfPyV3K7feis+A8tiIq8YxoR45QfY5eW+xsjXn4
COqQoxd6lSVSW/VVl/FLP+VlZ8AlCU6v/E9BZek1rtdbl5K67IE+6AeJpurniK6y9FPXa6reSu9A
v30NPG0KTtTpupLjN/5Y29rCbgezji3G0mqEHuyp3X3VaUu5hfPw/gIt0sNQ86c6r4QWqv4pXf8A
KGfEB8NXq18sLQUbeko67XXKV0utaoWX3QBxOFdR62KxCvw1nUl6vJXU5IJZ77+oafKcNhvMpuo+
NR2X8MbeuTKm5A+tjq8f7mk/u0YNfy63rZGvN+7+AjvkuFw37yq6j4U45fxSt6osrOpAqlj7S1cL
Qipbm142fr8nuigb90/UGxWCxOIzxdVU0t1Sd2uqCvJdyQWy3kMm8Hhd1StLnanH/NJ98Qniff8A
wDrC47FYrycJTVNb/FQzXXN3l3ysNLLbx/AAqaMUXrYqvCMt6T8bP+Xye+SLtO3339QP5XhML+7p
Oo/rVZZfwQt65MG5A/pVMfpOD8WnClv1UqdPtfkxfa2Rrzf3oNfm7D4b99XTf1aS13/E7R7nIu2e
2T1/AKWkqGG/c0I3+tVeu+7KPemNHdJwHc6GO0rFOo5Kluc2qdNdSdo9yJwurQ3WDwuF/eVXUf1a
Sy/jlb1Jg1J/QFrS0cPlh6MIP60vpJfzeSuyKLo7tcf2Q4q4DGaStUrtqO6VWWquzW/ypkWy3n+I
H8nwmE8+pKq+FNasf4pZ90SpqQbWmfE5YelCnwdtef8AFK9vwpE0d3uB6mjMXjvpK7cU/Tqy1e7W
zfYmNr228/xCVQwmE86cq0uEFqx/ikr90QakBI6ZdHLD04UuaWtL+KV33WGju9wL82YrG/SVrxT9
OrLV/wAWb7LjZ22/0hSoYXC+fOVV8ILVj/FLPuiF1ICLTDo/uIQpc0taX8UrvusTR3e4Ljo/E4/6
Sd7P06jsu+W3suNmrQRYbDYbz6jqPhTVl/FL3JhdSAkdLeJ/cU4U+dtaXfL3JDR3e4XXodXq1/GO
prNPValK/O9mzGTt06H3R6hHB1K1NTUnrXsr5Zva2tvVsFawmthHR6rCFatShDV1Xm7tt2bXV3Cm
HNA9CVKksXWU3JpayTd7K0skKmHNCcLhY0Me5OcdaTlaCu3mm89yBJqhOlsRHD4uNoRcm4+U7vuW
ztzETK6oN0ppzqunGCbvrZK74bhF6geYuhbBRhUepaMbu17WtuRGrPAzo5GnGM/F6zzV27K/Ui1M
BC6Ox1TEV4RvaOt5qyXq95axjd0SWncJKvUTuoxUdsnbO77e4kazmw+go4XCfWjZ8r3ffvI1xBHa
HxTq1VGKjGNnkl7XtLWcb5GaUw88TWeqm0klfd37BDKbolcNTWEwz1ndWd3HnlkRqeIIfDV05xjT
gldrN5v1mmJRIabbqOMIpt5uyJGsxvROClRk5SsrLZfPMUwga4zEw8ZJqOtK9rvZllsXvCWiVwNZ
qk5y5tLYrIlbxvgQMcLOr5TVlxeSNOWhPxSwNDPPq33MuvEEM8W1lBKK5be/aactibqxlSoqKu5P
Lv2mXW+IIj5LqefJLks2Vz0JivJYGlaPUrkdL4ggaleVXznc05W7E9SpvC0bKybW15Zsy68QQbjS
pbW5vlku/aac/EE1hJqjSc2lFbbLhuMuk8QVerN1G5PazThRLaGw2s3UexZLrJXXCBhpDE/Kaje5
ZIsYyuwHB4b5VNR3b+oUk2JfTWJ1EqUet+5Ejed9BWWacgiQQDYANgA2ECGUA2ADYAhhANgA5FAi
QQDYANgAwgQADYANlQDkADkADkEA2AIABgGmECADTAEAGmVANkUJYBtKwQbKDZFCiINlUbAMsAKI
gwKNgGwowqDaQAogMCjADaVwBaVgDADADaQULSCDYBgBsKNpBAqwBsijADLFAtIAwgNgGBRsoFJB
BsgNhRgBhQKSIBQBgBgBuwUKSANhBgBgUbAFWANhBgUbAMIoVYINgGwDCqMIgVYA2QGyqMANpXCB
ViKMAMAMANgGWKDdgDdgo3YiDYBgBgBgBsKMAMAMAFWCDYBsKEtACQDQQIaCjQQaYAgA0wgQVQkI
EMA0ECABEgAEigDIIAyAAyAASKgbyAASKAEggbyAG8ioASCAEgAEioASCALCBDKoSyASVAhgGgAb
ANACGVBoihLKg2kAbIo2UCkgDZAKSKBZAf/X+kJ6XyX5VMIoSwBJUGAGAGAGEBoINAGiqNAGAGAG
BBogMAMAMAEBRhQaCDADADRAYAYAYAYwBBQYAYAYAYAYQGAGACQgwAwA0yqNAGAGAGAGiAwINAGA
GAGAGAGAGmVRoAwAwAwAwA0EGAGEBoAwAwAwAwAwAwAwAwAwAwAwA0VRoAwAwAwAwA0EGAGAGAGA
GAGAGAGAGAGAGAGiAwAwAwAwAwA0yqNAGAGAGAGggwoMAMAMAMAMAMAMAMAMAMAMAMAMAMIBLQUa
ANBBhQYAYAYAYAYAYAYAYAJYUJKgwgMIDADADADADADADADADADTKBJQaCDADADADADADADCKMAM
AMAMANBBgQYAJZVGgDADADADADADADQQYAYAYAYAbCjADADYAoiDCg2FGAGAGACkiAURRhoGAGAC
kiAUAYAYUGyKFIINgGIA2FCkECiA2VRiAFkQYFGyg2gBRAYAYAbKBZAYAYAYAbKoUiINgGAGAGwo
wA2kAKCBDzANAGAGAGAGAGAGAGAGAGAGAGAGACWFGgDADADQBgQYAYAYAYAJCjQBoAwIMANMAQAY
AYAaCDABAUYAaCDADADaQAsA2FCkEGwBaChaAFhQRABEALiALRFBEAEQAVBQRABUFBUAEQAWJFBI
gBYhQSIAVABIhQVABUAERFBUAFQAeIUEiAEiRQWIUEiAFiFBIgBIgBYhQSJAEiFBIgBYhQSIARBQ
RABURQRACwAoAtBQRAC0ALQARAC0AbChUSAUUGwDaIoUVBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgB
gBhADYQYVRgBgANgCWEAwgSwBAQJYAgIESAEMAQEDingZz2+SufwJtrtDqOGp0s35T57P11hrWgq
pXy4LuXuXdfqBsNta+e71d7sr9SQQCctd5ZtcFd97yXYEA5Stm7dbes/h2ZFQDknUzs5Lc5O0exf
mAIlW1PSS+6s/d7WE2Bal81Dtm/9F7QBMqlsnPLhBf6L2g2NKnleMMuMnl7l7QQIlPK0p5cIrL3L
2hAmNO+cYZfWk8vcu+4BqcsrSqWX1YL4WiACpwUvMpuXOTy9Vku24BucmspVFFfVh/yzZesABCMZ
5QhKb539kfiVICOU4bZxprhHb/Ld94UM14tOyUpvnl6ldvvQZDhqrT+rRXc/fML/AADKfik7ylKo
+WS73d+oIDU1UavTpxgvrS/4U8u6wUN6yjJ3q1XJ8I3l63Zd1wlCaTU3ajR1nxleT7lZd6YJ9w3W
VSStVqxhH6qd/wCWGS7bADJyoUtkZVH9p6q7ld+tFTwHiWISvFRoR45Q9b8p97Ivn4COnTowznUl
Uf2V/mln6mVnwF0akqrth6Kvxac3238ldyC/CBOIpTq/8UVkrejra7XUo3S6m0C/fQy8ZhqHmwlU
fGb1V/DHP+YM+IHsXi5xvBKjB71amv4nZvvYa8/D+AjZYahSzqVXN8Kav3ylb1JhnUGU8XG+rh6C
ctzknUl3W1f5Qb90/UFxWGxFf/imqqcV6M5bOqnG7XcgWX1Ee/kmG+vWfZCP+aT/AJSp4gc4bFYn
Ef8AEtJQS3045rrm7yXeiLLbwGlfAK+tia8VLek3Vn6vJ75IrOvff1AflWFw37uk6j+tUll/DG3r
kwbkD6MsfjoeQnTpPglSp9r8lPtbYXzf3oR/yHD4b97W1n9WlHW/mlqx7tYqak/oGvnKjQyoUI33
SqPxj7sofysh3e6fqHVbDY/SMU68nCnu8ZJU4dkXZfwphbLef7AZ/JsHhf3lWVV8KcdVfxzz7osq
akCoaXVN6uGowg9za8ZPvldX+6kNHd7v7IdYjRuLxlp4qeotzrTt3RfldyJtbLef4gHisFhPOlOt
LhFakf4pXk/4UVPE+8Fp6ZnFqOGpwpt7NWOtP+KV33WJpe73AlXRGJrvXxU1TvvrT8r+HOb7hte2
+v8AEIUcFhNrnXly+jj3u8n3RCeJ9/8AAEhpqqnq4aEaV9ni43l/E7y7mho7vcFy0NiKj18TJU77
6srSf4c5vuGy431/iNWweE2udeXL6OPe7yfdEHiff/AKjpurF6uHjGlf6kfK/id5esaO73BctDYi
t9JXapp+lVlZvsd5PsTG17b6/wARtU8HhNsp1pcIrUj3u8n3IHifeCLTc6WVCEKK4xV5fxSvLuaG
ju9wItFYnF/SVfJT9OrLVv8AxZvsuNnbb/SCKhhML585VXwgtWP8Us+6IXUgWtMOh+4pwpc0taX8
Ur+qxNHd7gqGBxOk/pJKTX15uy/ilkDVoKsHh8N+8q67+rTV/wCZ2XcmF1J/QCLScKH7mlGP2peX
L15LsQ0d2uBZOimLrYnEOU3KScWru7S2PqWwzXTp22iw4SgsLj6j143qRuoZ33ZvK3HeT0dJNUIw
c6dDHVKajaUldyb23s8lsXrYJ4oHRxFRaRlTcm42dluV0nsHokv2gmrhPF6QVVyik2rJvN+TbJfG
wNeQnTtSnQxEHKDlJpWbdks3uWbfbYQz8UH6U1p0owUZNJt3s7X2CL1KD16Dq4GMbqL1Y5ydks1t
BrwF9HqUaMJKMlLPNpNLZz2irhBE6HxevXjGEYwjneyu9j2t5isY3yCaaw08VXtCLdor9XEM5uiW
xNONHCqM3ZWje2fPLcRu8BtoOVOU5akbWW1u7fuRamAjNIVZV6sldtKTSXVyLGMruiwYilqYZQbU
cop37zLpeAx0ZTpeMWreTSbvsXdtLWcdbCdK4yaqOCdkrbBDOh/oeGpSct7b9RK1hwId0IU/Pnd8
I5+vYaY0J3F1PkVFKOTyS38zLpfEEBT1sXNKTbuzTlyJ/ScddKN1FbXf3IzHXIMcHTpymkk5Pbd5
LLkWsYyA2k8Q1LVTsksxFzobYCg6s07ZLMVnGbD3SEoTklKWzctvwJG8gHByVSaUIpLa282Ws4hO
l62tJQW7b1sQzojcPR+USUeJWZNiW0vW1Eqa631biRvOiAUXJ2W1lchY8VL5voKC2vL4sy7XxBVz
biLLo2ksHSdWW9X7N3eYrtj4grVaq68nJ7WzTjQ3YANlQIYANgA2EA2UCGADYQDYAhgA5FAiQQDk
ADYAMIEAA2ADZUA5AA5AA5BANgCABDANBANgGACGAJCBAUaKgwKNogFBBuwUbAN2ANkBsA2FGFBu
wQKsQGAGBRsA2kECgowA2AbSChQQbANhRgApIINkUbAMKDaQAogMANgGwo2kUGwg2RRsAwoNpXAF
WsQGwDADABSQUKCDADADYUbsAbCDYBgUbCjCIFAG7AGyqMANpEQKsAbIowoMKBSRAbIDADYBhQZY
AVYKN2CDCA2AYAYAYAbCjADADdgDdgg2AbCjADADABDANACWECGAaAEtFBogEMqBJAJZQICBLABy
AAyKAMggDIABIoASAASCBvIoASCBvIoG8ggBIIASAASKgBIIBMAQygSyIEFAlgCQBMgBABplQIIo
wqDCA2VRtIAUQGygWiA2Af/Q+kJ6HyX5VMIoQyoNFBgBgBgBjIDQQJYUaKDADADADQQYQGAGACWF
GigwA0EGAGAGiAwAwAwA0wBJQYAYAYAYAYQGAGACQgwAwASVRgBgBgBgBogNBBgBgBgBgBgBgBpl
UaAMAMAMAMANBBgBgBhAaAMAMAMAMAMAMAMAMAMAMANMqjQBgBgBgBgBgBoIMAMAMAMAMAMAMAMA
MAMAMAMIDQBgBgBgBgAkqjADADADADQQYAYUGAGAGAGAGAGAGAGAGAGAGAGAGEAlhRoAwA0VBgBg
BgBgBgBgBgBpgCSg0AYQGEBgBgBgBgBgBgBgBgBgAlooElQYAYAYAYAYAYAYAYRRgBgBgBphBgQY
AaANFUaAMAMAMAMAMANBBgBgBgBsKMAMAMAFIgNhBsqjADADADaAFEBsKMKDADYAsgMAMKDYBtEU
KCDADYUbQAoiDYUbKBSIg2FGAGygUiA2AYAYUC0iA2AYAYAbQUKSANhBgBgBsKMANpACgg08gBAB
gBgBgBgBgBgBgBgBgBgBgBgBgBgAloKNAGAGAGggwAwAwAwA0wBIUYAaCDADABDyANAGAGBBoA01
cASFGAGggwAWgDYApBQoINhQtAC4oAIgoWgAgAtBQSJALQAWIUEiAFiAEiFBYgBEAFiiKCRACxCg
iACoAIgoKgAqACIigqACxCgyACoKCIgCoKCIAKgoIgAiCgkQAkSALEKCRACRCgkQAqCgiACRIoIg
AgAQAIFC0AEQAtAC0ALQBsKNogFlBgBsihZUGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGmRAgqjA
DADABDAEMiAZUCWAICBLAEMgMjTdR2SuDQdRwNvPfYtv67xte0Hi40fNSXP8/h3Ea4AqlVvN/rv+
DKlAG75/l63+QQCctZ5ZvkrvvezsCBEss3Zc5O77fzQAP979aSXZFdmfuKgQ56m+MerN9m23eABa
VV3SlN8X79vtCDLuG+MOrN96u+9gArKo8lKb/XC79aCBXlQ3xh1bfVdhQF6s36U5d3xb9QQLtKnu
jT9vvkFAJuEneTlN93rd36ioCKM47IRguMtv83uRAN6rjLz5ub5fF29hQbhFyV6dPL60s/W7R9QI
E1G5ZVKmX1Y5+pWj6wlAIardqdNzfO79Ube1gBZ+MStKcaa4LLvUc+8KGT8TD603/Cve36gz4DmK
rRV4xjSXF2j3Sln3ML5DOpGne9So5v7Kb9crexhKN0peMyo0bvi7zf8AwfUCfdBleM6itWqqK+qn
f+WOS7bAv3hm50KWyMpv7T1V3K79YTwHcflNrxiqMXvyh/M/Kfewvn4CPnRowd6lRzfCCb75St6k
yp4GUqyk9WhRTfFp1Jd3m/ykN+6fqF4ijWqq2IqqC+q5bPwRvbuQLL6hg3hqG6dR87Qj72+9FTwH
NCtiK2eHpqnH60Y2t+OV2u8iy30DOrhI31q9dOW9RvUl35R/mKmvff1AHisPQ/d0td8akr/yxsu9
sJuB5KONxEc/oqT6qUP8t/Wwvm/vQjZYXDYf95Vc3wpxy/ilb1JhnUg1HSEYO2HoR1tzl9JLufk/
yg37p+oNisJi8Wl8pn4uO5VJatuqG3uiFst5DF08HhvOlOs+EVqR75Xl/Kis+IFUNJVJS1cJRjB7
tWLnPvlrPusNL3e4LxOjK9Z62Lqxg/8Ajk9af8K1pd6Q2WX1DW+Cwu6pWlztTj6taT74lTxPv/gD
4fSmJrvUwlNU3wpQ8r+LOfrJYsyt4/gA1dDzTcsVWhTe/Wlrz/hjrP8AisXZcfeB+NwWE82E6z4z
epH+GN5P+JBPE+8OMPpTF4x+LwsdS/o0YWfa1eT7WyaWZW8fwCZaFlTetiasKb3py15/wxu7/esX
advvGvHYPCeZCdaXGb1I/wAMbv8AmRF8QHpaVxeM+jw8dRP0aMdXvcfKfa2NHdbx/AaloOVJ3xNS
FLinLWn/AAxu++w2dvvG1VweE82E60uM3qR/hjd/zIHifeFw0xicR9HQWpf0aMbN9q8p9rY0vdbx
/Ab+YqlPysROFLe9eV5fwq8u9IbTs943rYLCbFOvLn9HHuV5PviDxPvCo6crPyaCjSTytSjZv8Wc
n3jR3X0CvmOvPy67VJPO9WVm+zOT7hte2+v8QtQweE2ynWlwitSPe7yfcgeJ94X8+To5UIQorjFX
l/FK8u5oaO73BUNFYnHfSTTSfp1Hqrvlt7LjZ22gywuFwv7yo6j+rTWX8UvcmRdSBa0sqH7ilCn9
p+XLvlkuxIaO73DIUcVph61p1Ob2LteSHBq5A60dSw376rG/1YeW+/KK72Nr265BFjqOG/dUk39a
o9Z92UfaDcnAktD6Sr4nE09aUpJS2LYk8tiyW0ljWOVtFzxuH8XjqVbWjFOOrZvNvNZLtRl2s87G
sVKnhsdTbi3Oate+S2rZbN9oL4oRjsXPD46nBO0JJXXFu6z4gt1QjSeCm8ZTqqyitW7bS2N5Z7Xy
ETKeQnpJGlCcJ1NZuzslZbHvfbwEMw86R4meGpxlB2bdr2V9m7gIud0NVIzxuBSV5Saj1vykDmBf
R/DPDU5KTV75pNO2W+xKuE0IzQ1Sl45Rpwex+VJ57OCyXrLWMNbA9PVpSrOF3ZJZbtnAsTO+ROaS
oa+HjG6jbVu27bEZjplPARoOjCnrastZ5XdrLfsLUwgiKmOnOTULRu/RVm7ve9pdMdwnNMUpVYxj
FN5+wzHTOAeh8I6Dk21e1rJ3t1lqYTQj8Ri4qcnGCbu85Z9y2Bm0S2JqOGGu9rS9ZG7wIjCYCdSU
W1aN9+RdsTESulasE0pJtrOyyXaSN5UD0XVdWbslGKW5e17S1MaGmObxFVqKbtllyEZy80SWjMK6
F5Syewlbxmgxq4mDk5KN298vgVi0SeBqNwc5PLd1IldMaICpPxjbe9mnKiZ0bBUoOo/0kZrph4EF
VqOrJye9mnKiZ0RR1U6j6l7yV0wghsTW+UTcuOzqKxbsPtEYfxk9Z7I+0lawgb6UxHj6jtsjkveI
mV2G+Dw/yqaju39RWZNiU01iNVKkut+5EjpnRXTTkBsAGwgGwBDABsIBsoEMAGwAbKgQyAHIoESC
AcgAbABhAgAGwAbKgHIAHIAHIIBsAQAJYAkIEyAEgCGAJAEMA0UGyAUkECgowAUkQGwDYUYUGWCB
SRAbAMCjADdgBSVgg2FGAGwBSQBsA2AbCjaQAqwQbIowAyxQKSANkBsAwKNlAqwQbIDYUYAYUCkg
BRAYAYAbsVQqxAbCDADAo2AKsAbCDAo2AYFG7EQKANlBgUYQCkgg2QGyqMANgCkrEBgBgBsoN2AN
2ANkBsAwAwAwA2FGAGAGFBuwBsiDYBsKMAMAMAMAMANNACADQQJaChIQaauAIANMqAYUaCBDAEsI
BSAAyKAMgAMggBIABIoASCAEgBvIqBvIABIqBvIIASAASKgBIIBMAQygSRAhlUaYQIANMAGAYyoE
BRogMANlAtKwBhAKSKBZAbCj/9H6QnofKflU0wBBUGAGAGAGAGiA0EGgo0UGAGAGAGggwgMAMAEB
RhQYAaCDADCA0AYAYAYAJZQaAMAMAMAMIDADADABIQYAYwBJVGAGAGAGEBoA0EGAGAGAGAGAGAGm
VRoAwAwAwAwAwA0EGAGAGiAwAwAwAwAwAwAwAwAwAwAxgCSqMAMAMAMAMAMANBBgBgBgBgBgBgBg
BgBgBgBgBhAaAMAMAMAMAElUYAYAYAYAYAaCDCgwAwAwAwAwAwAwAwAwAwAwAwA0QCQowA0EGFBg
BgBgBgBgBgBgAkKElQYAYQGEBgBgBgBgBgBgBgBgBgAhmgaCDADADADADADADCKMAMAMAMCDQQYA
YAJZVGgDADADADADGAaCDADADYBgUYAYAbRAKCDCg2FGAGAGwBSIDZFGGgYAYAKSIBQBgBhQbIoU
EGwDEAbChSCDZAKKo2gBRAYAbKDaAFEBgBhQKSAFEBgBgBgApIqhREGAGAGwowA2lcAUEGACZACQ
DADADADADADADADADADADADADADADABLCjQBgBgBgBoIMAMAMAEsKNAGggwAwA0wBABgBgBoIMAN
NACQowA2kECgDYULQQbCjaAFgBAAiChaAFoAWRQRABEAEQUFSACIKCoAIgAqIoIgAqQARBQVABEF
BUAEQAVABERQWIAWIUGQAVEUEQAQKCoAIgAiCgiCgsQAiIAiCgkQAsQoJEAJEKCRACRIoKgBaACA
BAoWgAiAFoAWiAWig2FG0QCygwA2RRu4QbKDYBgBgBgBgBgBgBgBgBgBgBgBgBgBgAlkQJKowAwA
wAQwBDCAYQJZAIKgPDDSqclzJtdA8cPCnm8/UiNaCpVrZLJd367Lg2ATlbb8Pb7kVAJO+efXs9bz
CALlntz5ZvvezsAEzXFfxP8AXvCAWspZXcuSVl+uwoNSThujH73wfwIAE5KfnSlLktnr+BWRmo47
IqPOW31+5BQOpJS86blyWz1/AIMjBrOMElxl+dl6gBNSWsrSndcIrL3LuuAIhHW8ynfnLP4LvuAb
lJ2tKaS4R/LL1gAIKLdoQlN8/gs/WEBrzhtlGmuWT9V5d4UNH4uLz1pvu+LfqKyDKNRZxhGmuLsv
XLPuIob1NWTvUqOb5XfrdveVKMp+X+6pX5u8vhHvQBlVTkrVKiivqp39UcvYANdalDZGU3zdl3K7
9YTwHKVeKyUaS45R9b8p+sjXn4BjOFKLvObm/sr3yt7GVnwFUpuo7UaV3xac3/wfUCfcMrQqVFat
VUV9W9/5Y3S7bA+Iaa1ClsUpvm9Vdyu/WgngOacsRJXpxVKP1klFfxyz9Ya8hlUoU4u9WrrPhFOT
73Zd1wzoDWIpwdqVLWe5zbk+5WXemU2HFaniqitUkqUODagv4Fm+4i+RHulhqHnSlUfCK1V3yu/5
Ss+IFUsTKo9XDUYp8oucv5r27EgS+4axOFq1s8TVUbbpS1n/AAxu122BZ7wzcsLh9inVfO0I9yu3
3oJ4gcYfFYnEZYamoLjTjmuubvJd4WW3gNK2j89bEVoqW9J+Ml/Ldd8kE177+oA6+Fw/mU5VHxqO
y/hjn/ME3IHNKvjcdFqhFwhv8XFQj2yVv5mF3bwGEtG06OdevFPfGH0ku9Wj/MXadvvv6hHy3DYb
91Rc39arK/8ALGy73IJuT+kOYVMfpONqalGl9lKnT7WtWPeF8396DP5so4b99Xjf6tNa778o+thO
2TmhLx+Gwv7mhrP61WWt/LHVj36xTcnp+Icxnj9MRtHW8VwilTpru1Y95PEXzkGj0XQw37+vG/1a
S8Y+/KHrY2nbJzfw8hPzjhsL+5oKT+tVlrfyrVj36xdG5PT8Q6p1cfpqOrDXdPhFalNddrRXaThf
OQF800sN+/rwT+rT+kl3q0f5i7Tt1zf1CljsLhf3VHXf1qsr/wAsbLvciLuT+kGhjMdpheLp6zh9
SnHViutRSXeOCW5BK0LHD/8AFFanT+zF+Ml3RyXa0Nnbrn+yFfKsJhP3dKVV/WqOy/hj75MG5AqO
lsXjvoqN4p+hSjqruirvtuNHdb/QFfMM6OeInCjylK8v4Y3l32Gzs94zXwWE2RnXlxk9SPcryfeg
eJ94W9O135FFRpJ5Wpx1W/xZyfeNHffQZHQWIq+XVtTT9KrLVv2Pyn2Jja9t/rBVRweE86c60uEF
qR/ild90UDUn3hfz5KhlQpwpc0taX8UrvusNHdrgZTwOK0t5bUpLfOTy/ill6xvRq5BwtH0MN++r
KT+rSWt/M7R7rkXUn9AWtJ0sN+5oxT+tPy33ZRXcNHdrgJliMTpd6t51Psq7S7FkhwbuQdLQ/iP3
9SFPlfWl/DG/rsNr2+8LVfC4bzISqPjN2X8MfewbkBI6arXST1Ypp6sFqr1be25NL3UX/pDhnUlR
qpxSpzu3JpLc9/UZjvnOArTvi6NSjVnrXjKyta25533dQhn6BOnsTLB1KMo2zlZuybtdZXezfsEM
7rQF0jws61SjKEXJpu9lwaYiZwF6S0IVVCVSWqk3uu3e2zu3iL1IC6arqGHhNRUs421lfattv0hD
O+AidV4nAaz2uO5W2PggcwK6N0JUactZNXeV1bcKYQMNCUqVKstWblKz2K0fXmxWcORrS+OnQrSj
C0dmaWbyW/4CGV1RK6cpSrU4Rim3rbuokbzgXobDvCwlrWvfje2W8UwmhEYSdLxkVCLbbWcn7ll7
SsTQfadqtOMU8rXaEXOhzoWDpU5SeV3v5IlawERGhTi0pS1m3sj8Wac9Ca0riHhoxUcm/cZjrldB
jom9arrSbdlvLWMPNCsfh3VqOUmox3XfsW0Qygf6PhDD05Ti21vezYSt4+BDVMZOpley4LI1pyuQ
mF+y4fm17TLpxBApXNOQsGL/AGakoccviZjrl4ggVHWdlvNOYnMfL5NSUFvy7tpmOmXiCvJXdjTk
LBjX8joqC2vL4mY65eIKyachZl/V1D7T9r+HuM8uvswVY05CyaKpLDU3Vlv9iM11xmvIrleq68nJ
7WzTlvYCyoBkAMqAbAEMAGwgGygQwAbCAbAEMoByAByCBEgAbABhAgAGwAbKgHIAHIAHIIBsAQAJ
YAkINSChAQJkAJAEMA0AKSCBQUYAKSIDYBsqjAg2kAKIDAowA2AbSAFAGAGAG0goWkEGwDAo2AbS
CBQUbIDADaRQKAMIDYBsKN2KDYQbIo2AYUG7XAFJWIDYBgBgUKSKDdiA2EGAGwo3YA2AbCDYUYFG
EApIIN2KDYUYAZYiBaQBsKMAMKDaRAKIDADZQYAKSAFEBgBgBgBgBsKMAMKDdgDdggwgNhRsAwAw
AwAwAVqgGwBDAMAEMA0AJCBDCjQQJZQJIBDKgSQCWUCQgFIADIADIoAyCAEgAEigbyCAEigbyCBv
IABIqBvIIASAASKgBIIBlAhkQJZQIYUJCBDAMABgGgBDKDRAbKBSQQbIo2UC0QGwBdiqP//S+kJ3
fKflUQyg0VBgBgBgBhAaCBLCjRQYAYAYAaCDCAwAwA0woSUGAGggwAwAwgNAGAGAGACCgwAwAwAw
AwgMAMANMA0EGACWVRgBgBgBgBhAaANBBgBgBgBgBgBgBoqjQBgBgBgBgBgBoIMAMANEBgBgBgBg
BgBgBgBgBgBgBgAkqjADADADADADADADQQYAYAYAYAYAYAYAYAYAYAYAYAaIDADADADABJVGAGAG
AGAGAGggwAwoMAMAMAMAMAMAMAMAMAMAMANMgEhRgBoqDADADADADADADADTAEhRoqDADDIMAMAM
AMAMAMAMAMAMAEsoElQYAYAYAYAYAYAYAYRRgBgBgBoIMCDADTChJQYAYAYAYAYwDQQYAYAbCjAD
ADYAoiDCg2FGAGAGACkQCgDAowoMANrMAWQGAGFBsA2iAUAYAbCjaAFEQbCjZQKREGwowA2UCyAw
AwA2igWQGAGAGACkFCggwAwAwKNgGwBQQYAYADAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMANMASF
GAGAGAGAGggwAwA0wBIUYAaCDADABDANAGAGAGggwA00AasFCgg2FCkggUFGAC0gBcQBaCggAtAB
IhQtEAtABEAFSCgiACoKCJABUAERFBUAEiFBYgBEAFiFBIgBYgBIkUEiAFiAGggoKgAqIoIgAiCg
iACIKCoAIgoIgAiIAqCgiACIKCxCgkQAiIAkQoJEAIgBaCggARAC0ALQAREApFBsKNogFgGFBsij
ADADdwgUAYUGAGAGAGAGAGAGAGAGAGAGAGACWRAkqjADADABDAEMiBMYuWSKBxHC/WdibXtBUo0d
i7X+vYReAmdRvb+vf6gmwGUrfq359xUA1xV+zL1vPvABOVuCfLN9+zuCBLV87N85P/T3gAnO3pdk
VZduwIEOOV1Htk8vcgBEpvY52XCK/wBEUAowUvNg3zez1W9oSDbk47ZKPKP5Zd7AAxUZPyYyk/1u
WfrACeVDfGHVt9V5ADaWpfNym+74v2BAbVnHZGMFxf8Ay17gBvUcZefNyfLP1u3sYBuC1v3dO/N5
/BeoAyo5PKdRJfVWfqXk+sABF01lGLk+eXqWfrKgM1Vh9WkuyL/4RF8hrJU1nKUpvll63n6ishVN
yn+6pq3FrW9by9SIoTWi5/vaq6k9but5PrKnxDdTpQ82Lm/tOy7ln6wngOLV0srUo9kP+Wn6w15+
AZSp0o5zm5v7K98rexhnwN0qmu7UaSb5pzfw9QPgFVqdWorVqiivqt3/AJY3t3IF+8M34il9ab7I
r3t+oqeAejUrVVejTUF9ZR/zSu13oiy30Deth1J61asm+Tc5d+z1hNe+/qG7rUKXmwc3xm8u6Nva
ypuQOovFVY+SvFQe9Wpx78r97I15/fgMJYWjSzqVdZ8IJv1uy7rlZ1AP5XSpZUqSb4zbk+5Wj3pg
2HFWli8TH6R+Lp8JNU49kcr9iZF8396Ee8Ph6Hn1HN8KcbL+KVvYys6kCVj4wdqFGKe5y+kl6/J/
lBv3f2QbE4XF4tJ15akd3jJaq7I7e5BbLeQxdHC4fzpyqvhBaq/iln/KE1IEx0nqO2Howi9za8ZL
vlddyQ0nd7v7ILicBi8ZaWJnqLc6s9Xui8+5BbLef4hk6ODw3nTnVfCC1I/xSu/5Sp4gTHS/inbD
0YQe521598r59SQ0nd7gbEaOxmOtPEycVudaer3J59yG1st5/iGvyfB4Xz6k6r4U1qx/iln/AChN
SDXzyqGWHo06b3Sa8ZLvlddyQ0d3uBquj8dpO1Su5KO6VWWrHs1mv5UXel1bz/ENng8Jhf3taVR/
VpRy/jnb1RZDUn9A18808N/xPQhB/Wn9JL+bye6JdJ3a4n6hxLDY/Ta1p68oL0pvVgupytFdhOF1
cgP5tw2F/fV1J/VpLXf8T1Y91y7O2T1/AKWk6GF/cUIt/WqvXfdlH1Mmjuk4n4giq47Ty1V4ycVu
irQXYrRQ4POQxaGhhv8AiitCH2Y/SS/l8ldskNnb77+oV8swmE/dUXUf1qssv4I29bYNyf0jPnbF
4/6Om2k/QpR1V3RWfbcaO63+gE+YKlLOvKFFfbl5X8KvL1IbOz3+BtPBYTYqleXP6OHqvJ98QeJ9
/wDAben6sFaio0V/xuNn/FnL1jR3+7wMpaGxOM+kmnGL2zqPVXfLb2XGzttBlhMJhP3lV1H9WkrL
+KVvUmF1J/QCLTEcP/xPRhD7T8uXfLJdiQ0d2uAhLFabl6dV9rS9yHB5yDpaIhh/39WEPsx8uXdH
JdrJte3XIIsXhsL+7pOb+tUeX8MbLvbBuT+kJq6Wr4paik1H6kFqruja40XK0Gp6ErNa07Uo8ZvV
9W19iG17aDqnhcNtlKq+EVqx73d+pEPE+8KWmJUsqMY0lxSvL+J3fdYaXu9wvWlqE9K4Km4rWl5E
vVn7TMd8puA2mqMcRhYOrLV1dVtpa2drWWdt+3YIZeYN6dxC+TwrKMZZxa1le11tt+kIuV8bAeks
nVw8JRbzaulvTTETPgH03h3jcPB3UWnFtydkshDObgVjVBYOLn5cYqHmu19i2tbCLeBvC174Jypr
UtGVkne1m97BL4AejNWVWM3Jtu6zbuWp06G+hsDLDVrycU7Pyb3fchUxmqNaUq06deXka08s28ti
3L3iJlfIkOkFRwhFJtXbuI1mN6Hg1h5c3L2Eq48Blo7Cwp1Y3mnLPKOa2cS1nGBxpXFulUtFK6Sz
au+wRcr5DunUk8M5SbbafrdiLvwIvA4GbnGTVle+eWzPYW1jHEP9K1KamlJOTS2XsviI1lQ50XU1
4ylZRV93IlXEVqpPxjbe9mnIWKt+zYdLiku/NmXW+IIOjT8bJR4s05QTWlqllGPaSOmYY4Cn42ou
WfcKzjNh1pOprT1eC9oi50B0dS8ZUvuWYpjBrSdXxk7blkIZXyE6Mo+NqX3Rz+ApjPI1pWt42dt0
cviIZUA0fQ8fUS3LNipjNh1pivryUFsjt62IudEVh6LxE1Fb2VmTYnNMVlSiqUe3qWz9ciRvO+gr
TK5BDKBBEAigQwAbAEMqAbAEMAGwAbCAbKBEgAcggRIAGwBAQDABsAGyoByAByAByCAbAEMA0wBA
BgAMA0wgQAIaAFJBBsKN2AFWIDZVGBBtIAVYgMCjADYBtIAUAYAYAbANpACgDYBsKMAFJBAoijAD
ABSRQbIDYBgUbKBSQBsiDYUYAYUCkgBRAYAYAbsVRtIAURBgBgUbCjdggUEGBRsKMANpBAqwBsAw
KMANpEQKsFGwDCgwgFJAGyA2UGAGwoVYINkBgBgBuwUYAYUGwDLBBsgNgGBRsAwAwAwAwAUogGwD
YBgAloASAaYAgA0ECWgoSECWUCSASyoEMgEsoEAApBAKQACRQBkEAJAAJFACQQN5FA3kEAJADeRU
DeQQAkAAkVACQQDZQJZECGVQlgCQgQwDQAiQAkASyoNEUbSKgURRgApIoFkBtIKFhB//0/pAz0Pl
PyqIKgwAwAwAwA0yAwIEhRooMAMAMANBBhAYAYAICjCgwA0EGAGAGEBoAwAwA02FCSoMAMAMAMAM
IDADADQQaAMYAkqjADADADADADRAYEGgDADADADADABJVGAGAGAGAGAGAGggwAwAwgNAGAGAGAGA
GAGAGAGAGAGAGmVRoAwAwAwAwAwAwAwA0EGAGAGAGAGAGAGAGAGAGAGAGAGEBoAwAwAxgCSqMAMA
MAMAMAMANBBhQYAYAYAYAYAYAYAYAYAYAYAIIowA0VBgBgBgBgBgBgBgBgAkKNFQaAMIDCAwAwAw
AwAwAwAwAwAwAQ8jSDQBgBgBgBgBgBgBgBhFGAGAGmEGBBgBgAllUaAMAMAMAMYBoIMANhRgBgBs
A2RBsA2VRgBgBgBsAUQGyKMNAwAwAWkQGwDADCg2RQsIMAMQBsKFIINkAoqjaCBRFGAGygUgDZAY
AYUC0rEBsAwAwA2FCkEGwDADADYUYALQQYAYAYAJcQDVgo0EGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GACWgo0AYAYAYAYAaCDADABAUYAaCDADADTQAgAwAwAwA0EGAGAGACkFCgg2FG0gBYAtABEgoWkA
LACEULQARABIhQSIAWIASIUFiAEQAWJFBIgBYoKCIAIgAqCgiQAVABERQVABEFB4oALEAJEigkQA
iCgiACIKCIAIgoKgAiIoIgAiACoKCIKCIAIgAsSKCRAFxACIKFgBABaAFoAWiKFoqDYUbRALAMKD
ZFGAGAGAG7gGwg2AYUGAGAGAGAGAGAGAGAGAGiASwg0VRgBgBgBuNFzIaBlQjHbmRdBTnq5LILsB
lP8AX6z9gZA5O36t+bKBKfC/Yrevb3hAOXk8F62ECH5e5y/X63gCU9XelyXx/MADlLYnJ/rh8Qg1
JyjvjHq2+q7AANxk89aT7viVArVlHdGHXt9d33EUBqOL86Tl1fF/AqDcYt5xhlxln7bIATUbeUp5
cI5+yy9YAKGq3aMHJ8/gviEBJa8NsowXLJ+rPvChs/Fx2uUn3fF+wICpT2xgori/jL3AgFUtP95U
vyV37bLuBQiLi8oQcnzu/Ure8JASXjUrSkqa4ZL1Rz70FoayVKG1yk+Xkrvd36kVPAJTc5q9Omku
Nr+uV0vUQA6sNf8Ae1U+Sbk/h6wfEA16UPNi5P7T9y+JU8BwvH2ySpR7IevJv1kXz+/AZypUoO85
uT+yve7exlZGoVo3tSpJv7V5PuyXqBsFqwrzVqs1CPBu38qz9QW7DJwoUtrlN8lqrvd36kGfAJSr
TqO1Ckk+KjrPvd7dlgsvuCa+HqVc69VLk5az7le3bYJZ7w1vh6O6dR87RXvfrRU8AtDEV62VCmo8
4RzX4ndrvIst9ACrg23evVin168vVdd7RSz3/wBkN3Uw9DZGVR8ZPVXdHP8AmCeAajiMTicqENRf
8bjbvlt72Rd28BpUwCi7160U96T15erLvaKmvf8A2QF18NQ82nKo+M3Zfwxz/mBuQGo4rF4xNUIu
Md/i46q7ZLPvYJbeA0noyNPOvWhF70n4yX8uXe0Np2+/+yBOvhcN5lOVR8aktVfwxz/mBuQFoY7F
428cPFxW9Uo6ve1n3sG7eP4BrPRPi88RWhB71fXl3Rv62htO33gTrYPC+bCdZ8ZvUj/DG7/mKbkC
qOlcViXqYaOpf0aMLPvV5PtZNHdbx/ADqaEqRetiakKT360taf8ADHWl32Ls7feB3wWE2KpXlztT
j3LWk++ITxPv/gNx05Wvq4aEaV9ipx8r+J3n6xpe73DVTQeJqvXxElTv6Vadm+x3m+4uztvr/EId
HA4Tzp1K74QWpH+KV5fyoieJ94StPPD5YelTpfatrz/inf1WGl7tcAstG43S30lXXcfr1Zase+bS
7i70mrkNLR+Fwn76vrv6tKN/5pWXcmTa6k9fwC/najhv3FCCf1qn0ku52iv4S6Tu1xP1GeMx2n/J
XjKiW5X1V2K0V6icL5yBFoWGG/4orU4fZj9JLujku1obO3XN/UZ8rweE/d0pVX9arKy/gjb1yYXc
n9I29N4rFfR03qRfoUo6q7o5vtuNJ3WhUej9aPlVnGinvqS1X/DnJ9w2dl9QRU8Fg9sqleX2V4uP
e7yfcgviff8AwGfP86GWHhCiuMY3l/FK77rDR3+4IpYDF6Xevac/tyeX8UsvWOE1cg6WjKGF/fV4
t/VpLXfflFd7G17ZOaFrSOHw37mim/rVXrv+FWj6mNL3ScT8QOppHE6T8hylJboRVl2Rjl6hrSbt
DqGgqlPOs40V9t2f8KvL1E2vZ7wVfI8L9es/4I++T9QPE+8K+e6kMqKjSX2FZ/xO8vWNL3AeHwNf
SLcoxlLjJ7O2TyCSWh6tHUsP++qxv9WHlvvyiu8m2u3XIWsdRw/7qkm/rVHrPuyj7QbkF38ZLSOj
XJ5ycXsX1ZcF1GfV25xBKOGliNH6k/Jeq/OytZ3TfYh6rreILaFTA5/SRjHddX1XzV9wPQZWxLng
VUpeS1FWtnazs83y3gt8BFaMtIYBWvKTUebbTswXzAaOH/YtSp5No577Wd9xF14G9FuHyaSheUVr
Lylty4LcKY8BHR7FyxKmnZJWskkkr34FqYXYj9C0JRxDlZ6q1le2QrOE8gukqNPx7lOWbt5KV3sW
17EIuU8iR03iHh1FpJvPNq9uokazuhvD1pVcLKUndtS+AJfAYaGwk41FNppWe0tZwgXpF0lVbleT
yyWS2b38BDLWxI4mq6GHTh5N0rcrkat1BG6JvVq3bu0m8+4tZw5AdJy160uVl6ixnLkS1D6DDN8U
/XkZdJ4ggaFPxskuLRpygm9Mz82PWyR0zDXRVPXqX4IVMBrSFTxlR8shEyvkPtE07KUuwlbwgjK0
/Gyb4s053yJbR8fEU3N78+xGa6Y+IIKctdtveachOYCPyWk5vfn8DNdcfEFenLWu3tZpyE9oyCw9
N1Hvz7EZrrj4FfqTdRuT2t3NOVE1oahqp1H1L3krphBDYuv8pm5cdnUWOeV2GrCBDKAYQDAEMAGy
gQwgGwAbAEMAGwgGygQwAbAESCAbABsIEAA2ADZUA5AA5AA5BAhgCADQAMAwIBsKNMIEAGioNkUb
SAFEBsoMAFJEBsKMANgGWKBViA2AYAYAbsAKSANgGwDYUbSCBVgDZFGAGWKBaQBhAbANhRtIoNhB
sgNhRgBtK5QKSsQGwDADADdiqFWIDYQYFGwDYBuwBsA2AYFGACkgg2AbCjADCAUkAKAMKDADdiAV
YgNgGFBgAqwUbsRBsAwA2VRgBgBuwBuxEGwDLBRsAwAwAwAwA3YA3YAUAYAYAYAYFGBAhqwBoASw
BIAkIEMKNBAhlBpkQIZVCQgQwAUggDIABIoAyCAEgAEigBIIG8gAEioG8gBvIqAEggbyAASKgDII
BsoEMiBDKoSyASVAlgCQBLAEAGmVAlBQsAwgNooFkBsAWgDYB//U+jzPQ+U/KpoqDADADADADREG
mFCSgwAwAwAwA0EGEBgAlhRooMAMYBoIMAMAMIDQBgBjChBUGAGAGAGAGAGEBgBgBoINAGmVRoAw
AwAwAwAwA0QGBBoAwAwAwAwAwASVRgBgBgBgBgBgBoIMAMAMAMIDQBgBgBgBgBgBgBgBgBgBjAEl
UYAYAYAYAYAYAYAYAaCDADADADADADADADADADADADADADCA0AYAY0AJKowAwAwAwAwAwAwA0EGF
BgBgBgBgBgBgBgBgBgAlhRogNBBhQYAYAYAYAYAYAYAaYAkKNFQYAYQGEBgBgBgBgBgBgBgBgBpl
QJKDQBgBgBgBgBgBgBhFGAGAGBBoIMAMANMKElBgBgBgBgBoIMANhRgBgApEBsIMKDYUYAYAbANo
gFEBhVGFBgBtK5ALAMAMKDYApEBsAwA2AbQUKIg2FGygURBsKMKBSAFEBgBhQKSAFEBgBgBtBQpF
BsiDADADYUYALSCDADADYUaCDADLACbWCjQBgBlgDQBgQYAYAYAYAYAYAYAYAYAYAYAJsFGgDADA
DADADQQYAJYUaANBBgBgBgAloIEhRgBgBgQaAMANhQpBAoKMAFrIAUgBYUEQARAC4gC0RQRAC0AE
QUFQARBQVABEAFRFBEAFQARBQVABEAEQUFQARABURQRABUrhQdABEQBEFBEFBEAFiAEiFBIgBIhQ
REARBQRABEFBUAEQUEQARABERQSIAuIARBQtABABaACIAUgoWiINlUYiAIAYUGyKMAMAMAMAMAN3
CDYBgBsoMAMAMAMAMAMAMAEkQJKowA2lcANGg3tyJtdAqioEUalMAE5fr8ln3lQDeX6sECE+HqX6
ZAIatwXXm+4qDTetxf6/XAAS048I+33hAKpJPa2+S+L+ABqz3RSXP88gAM3fzpX5L9JBAhLW82Df
N5+ywINtyW2SjyX5e8Ab+QnknJ93qz9pUBWpx3Rh15P15hQ3nqvOUnJ8vi/gEG4py8yHa8/y9QIM
nrPKc0lwWfqWQKAXpx2JyfPL1L4hAVeMjsSprjkvW8woBOMNs5uT5L3u3vDNGoSUnanTu+d5P3L1
BQSaqNWnNRXC/wDlj8ABq1Sp/Wl/Kve/YE8AtN1Jq9OCS42v65Xt6goFUhr51aib4JuT+HrCfEAc
6VPZFyf2nZdy+JU8BxF12rxSpx42UPW7N95F8hpKjCLvOpd8Ipv1uy9pU0EeOpwyhTu+Mm36lZe0
JsOJRxE15T8XHg7QXdlfuYW7/fgMXRo0vOm5PhBe+VvYwmoNLExi7UqSvxl5b7tnqBsGq0sRWVqs
tSPCTUV/D8ECyhk6VCj505TfCKsu+WfqKmoNLGKLtSpRT4ta8vXl3Ihv3AlfD4nEfvpakd2vLV7o
7e5BbLeQzdLD0POnKo+EVqrvln/KVnUgSseoO1GlFPc2teX8113JA37gSvhcVilevLVju8ZLVXZF
59yItlvIZOhhqHnTlUfCCsv4pZ/ylTUCPnGNLKjShF8ZeXL+bLuQ0d3uBa2FxmPV6zcYbnUlqR7E
7epEWy0M3hMNh/3lVzfCnHL+KVvUmVnUgH85UqH7mjFfan5b7naP8o0d2uAWVPHaWjeWv4vm9SC7
7RC+aGfzdQw376um/q0k5vverHubDOpPUI+cMPhv3VBSf1qsnL+Vase+4Nyen4hUMTjtMLUp67h9
WEdWC61FKPeODdyAXoWOH/f1qcPsxfjJd0cu9ouzt1z/AGQn5Tg8J5lKdV8aktWP8MM/5gbkG46a
xWJ+joeQn6NGOrf+Hyn2tjR3W8fwCJdH60fKxEoUb5/SS8r+FXl6i7Oz3jWrgcJtdSvLlanHvetJ
90SJ4n3/AMBpdIJ0MsPTp0ecY3l/HK8u6w0vf7gr5qxulPpailb+8qy1V/FNr1F3pO23+kKWj8Lh
P31fXf1aUb/zSsu5Mi6k9fwCvnajhf3GHgn9ao/GS7naK7ho7pOJ+oT8pxunnqJ1Ki+rFPVXYskO
DdyBvmH5P/xRVp0vs315/wAMb+tobOzXI2q+CwnmU51pcZvUj/DHPvkDcn3jJ9IK7WrStSi/RpRU
fWvKfa2NHff6hlPQOJxC15x1Iv06jUF/Nm+y42dloN8jweE/eVZVH9WlGy/ilb1JhdSf0Dfz1DDf
8T0YQ+1L6SXfLJdiQ0d3un6gDqYrTcrN1Kr4Zu3ZsQ4TzkHq0E8P/wAUVKdL7N9aX8Mb+uw2vb7w
tVsHhPMhOtLjN6sf4Y597C7kGT07XktWDVKP1aaUfWs32tjSd9GYbRGIxi11B6u+UvJXe7ImyY2h
2sDh8L+9raz+rSV/5nZd1w1qT+gEWlKeH/cUYp/Wn5cvX5K7ho7tcBvWxtfSLtKUpvct3Yll3BLb
Q9hoSpFXquNJfbdn/Dt9Q212gqWEwu+dZ/wR98vYQ8T7xetCYn5VhJ6kVC2sko3yyvfPO+e0zXfG
7gF0cnLG4WpGTbbcld57UhUw8wOdCYSUcNKjUtfylZNOya3238hWsZ40FaJlTq4WUad5RjrLylte
3Yt2ZKY8BOj67x2DnsTSmslZLK6tYqS7gRoWDr4OUOOsl2r8xTDzA40Dh/FUpQcoyzd9V3tdcSVc
J4Aej9WnJzjTi42Szbu3t7O4tTAN8FiJ1MW4yk2k5JLdlfcEl8hWkcDOriNdK0fJzbshDKeQ/wBN
+LSi6ms9tkt+zayRrMEpVdTC60Fq5Oyve2fME4DDQk5VarlJtvV39aLWcORH6Rd6s+ssZy5E5pjy
KUY816kZjpnwA6CjnJ8ki1MBFYiWvOT5v2lc6J3H/Q0Ix6kZjrl4gj9FU9eouV2WsY8helJ69S3B
Je8Rc+Q+0THUhKT/AFYlawENOWu2+JpyE8v2ehza9pl14gg0rmnITWPfyekoLfZdxmOuXiCDhB1G
kt+RpygmdKTVKEYL9JGY65iChTdVqK2t2NOQm9K1FQpqmt/sRmOuXgV6MXNpLazTiLFj5LBUVTW1
5fH9czMdsvEFYNOISwBDKAbCAYAMAQygGwgQwAcgAbAEMIBsoBsAQwAcggQwAbCBAANgAmVAiQAO
QAOQAgIEBRoIEMA0ECGFCWECADADaQAsAwA2lcKFbCAwA2AYUCkiA2AYAYAbAN2ChSVgg2AYFGwB
SQQbCjZAYAbSKBRAYAbANlUKsAbIg2FGAGFApIAUQGAGAG7FUbSAFEQYAbCjAo3YqBREGBRsKMAN
2CBSQBsKMAMANpXIBSVgDYBhQYQCkgDZAbKDADYUbSAFEQYAbsVRgBuwBuwQYQGwDAo2AYAYAYAY
AbSKBViA2AYAYAYAYFGyAwA0VBpq4AgA0AIANBAlhQkIEsoEkAhlQJIBEigDIADIqAMgAMggBIoG
8gAEggbyKAEggbyAG8ioASCAEgBvIqAMggGwBLAEMoEkQIKo0wgQAaAEAGmUGkgg2RRgAtIoFEBt
BQsINhR//9X6OnpfJflUwAwAwAwAwgNBAkKNFBgBgBgBoIMIDADABAUYUGAGgDAgwAwA0QGAGACW
VRoIMAMAMAMAMAMIDADQBoIMAElUYAYAYAYAYAYAaIDAg0AYAYAYAYAYwBJVGAGAGAGAGAGAGAGg
gwAwAwAwgNAGAGAGAGAGAGAGAGAGACSqMAMAMAMAMAMAMAMAMAMANBBgBgBgBgBgBgBgBgBgBgBg
BgBgBogMAMaAElUYAYAYAYAYAYAYAaCDCgwAwAwAwAwAwAwAwASwDRFGAGioMAMAMAMAMAMAMAMA
EhRoINFBhAYQGAGAGAGAGAGAGAGAGACWVAkoMAMAMAMAMAMAMAMIowAwA0GRgBgBoASVRgBgBgBo
IMANhRgBgBtACiIMANlUYAYAYAbRAKANhRhQYAYALWRAbAMAMKBSIBQBgBiAFBQoIMIBRVG0ECiK
MANlApEBsAwA2sygWQGAGAGACkiqFEQYAYAbCjABSQBsIMANgGBRoIMAMAMANNBQkAwAwAwAwAwA
1YAwIMAMAMAMAMAMAMAMAEhRoAwAwAwAwA0EGACAowA0EGAGAGACGgDQBgBgBoINhRtACwDABSQA
oAUgAiQULACAC0FC4kARABEAEQUFQARIAIkFBUAESIoKkAEiAFiFBEAEQUEiAFiAERFBYgBIgBYI
KDoAIiKCIAKgoIgAiACIKCIKCRIAkQAkQoLEAJEKCIAIgoIgAiIoIgAiAFxAFxACIKFgBABaAFIK
FoiDZVGAC0QGyg2RRgBgBgBgBgBgBgAq4QYQGFBsoMAMAMAMANMiBLAFRpuewLoHjQS2sba0CX1d
hAI1rgCG/wBfkveVAl/rcgBF7b+4IENcrdfwAEylxfcEo1qtZpW5v9JACJPc5ZcF+kgBCs8oxb/X
IIEtyjvUer8swAHk85Pu+IQKtJbIqPN/n7goFUtLzpN9WftsECI2l5sG+vP2WKg3JzW2SiuC+Efe
RQB+Ljxl6vj7ioFxU9sYKK4te+RFA6i1vPnfkrv4L1lQCUoLKMXJ837lb2hAd+NW21NdkfzYXyGj
jTj50nJ8l738AgXCWvlTp3fO8n8PUAZUjOWVSaiuF/dG4AD6Kn9aX8q979gTwCU5Tn+7gkuKV/W7
29QWAdSm551ai79Z+rL1hL94A5UqexSk+bsu5Z+sHgHhOtNXpx1VxSt/M8/WDyG06CvepUV+V5P4
esqWAbq0afmwcnxk8u5W9oPAPCeIqryFqR4pKK/iy9bIvkNJYaEc6lRX4R8p9+S9ZWdAbrUaXmwc
nxm/cre1g3AeM8TXj5CcI8YpQj35ethfN/eg0eEhDOpVV+EfKffkvWGdAbr0aPm03J8Zv3Rt7WDc
BoVcViV9GnGH2UoR7WrethfNDSWBhTd6tWKfCPlv1ZesJoDdfD0fNpub4zdl/DG3tKm5ASlisVi/
JoxcVv8AFx1V2tZ97IstvAaz0bqO9arCL3q+vLujf1tF2nb7wJ1MLh9kZ1Xxk9Vd0bv1oHiDdPSW
IrPVw8VDlSjn35y9Y0d19P4AVTRNVvWxE403v15Xl/Cry70Nnb7wG2Ew211Kr5WhH/M36gniBC0x
Km7UKcKfBxjrS/ild91ho7vcN1dGYvG+XXbivrVZavdrO77ExsuNvP8AEN3hcJhv3lWVR8KcbL+K
VvVFhNSf0Ab0vTw/7ihCL+tP6SX83k/yjR3a4n6jbjj9Or+0nBdkF7IocHnIC+aaWG/f14J/Vp/S
S71aP8xdp265v6hLxuEwv7qi6j+tVll/DGy72wu5P6Ri0xjMd9HSuk/QpR1V3QV323Gjut/oCX0d
q0s8ROFHf5cvK/hV5eobOz3+Bq2Awe+pXlytTh69aT9RU8T7/wCAz/aGdDLD06dHnGN5fxyvLusT
R3+7wNR0ZjdL/SSU5L69R2X8UmkXelmNyBPmvDYT99iE39Wktd/xO0e5smztk5v4BXznh8J+4oJv
61V67/hVo96Y0bk4n4hE9J4vS30alOS3QgrL+GKS9Q1pLlaDLo7Uo515Qor7cvK/hV5eoba7Pf4C
ksDg/wC8ry/5Nw98n6gniff/AACn0hqUcqEYUV9iPlfxO8vWho7/AHeACho/FaYeuoznxnK9u2Ty
9Y3okuQd/NNHC/v68U/q014x9+UV3sbXtk5o2tIYbC/uaGs/rVXrfyq0e+40bk4n4gVfTWJxq1HN
qO6EfJj3RshpO60Ho9H68lrTSpR+tUagu55vsTG1mFDhYfB4Tz6kqsuEFqx/iln3ILqQLWm/k/8A
xPShS+1bXl/FK/qSJo7tcBs519Kyzc6ku2ReE85CQWg5UM684UuTd5fwxu++xNtdvvBFUwmF82M6
z4yepHuV360DxPvG5abq21aerSjwgtX17fWNHcA4fBVse7wjKXF/F7AklokFoyGH/fVYxf1Y+XL1
ZLvJtrt1yLv0WnSlTnCkpaqees1d3XBZLZzM136Y10Zx08U6kZteS1ZJJJbdiQp07sa6M0ZYeVaL
TUdbJ2ydrp+4VOn6h1oKgsK6tNSUnrXsr5bsyVrCaCtBTgvGUoR1VCWd3e+6/qFMAjQGIniFUjUb
k4ytn3e4Uwuwjo5h54fxikmldWutu0tTCaGaHoww9acVPWlZ3SWSs+IpjNUao4nVxbgoxV3K7tm8
m9vwBL5DPTV/lC6kIznyH/SLZDrfuEa6gLDLB9j9pF9A30AvKl1ItZwEdXXjK0uc37Ss3kTOnZZQ
XX7iR0zC9CrVpylz9iJTAQVKPjJJcWjTlBOaallFdbJHTMJ0NDOT5JCmAjcTPxk5PmysUTf7jD9a
9pl04ghaUPGSS4s05wTOlJ2UYrrJHTMMcDT8ZUXLMVjGeQTStTWnbghFzo1oulrzvwQphA30jV8b
UfBZCJld0H0TR15uX1faxVwgZ6RreOqPgsl2CJldg+iaHjZ6z2R9u4VcIA6Vr+OqNbo5fERMrsRh
WAlgA2UCGEA2ADYANlAhhANgCJAA5ACGEA2UA2AIYAOQQIYANhAgAEADZUA2AIYAOQAlhAhgCQBL
AEgCJAGggGAbSuALAMCjaQAogNgGFBuwAqxAYAYAbANhRuwQbANgGwoywApIIFEUYAYAKSKDZAYA
bCjZQKQQbIo2AYAbKBSRAbAMAMAN2KoVYgNhBgUbANlBuxAbANgGBRgQKSAFAGBRgBhAKUQBQBhQ
YQGwDaQAoAwA2AYFCkgg2QGAGyqMAFWCDZAZYKNgGAGAGAGFBuwBuxAbsAbAMAMAMAMCjYBuwBuw
QYwBBFGFQIaANACWAJANBANgGgBBQJYQIYUJkEAZAAZFQAkABkAAkVACQA3kEAJFA3kEDeQA3kVA
CQQAkEDeRQBkECGAIZQJZAIKgSwo0ECGAaABsA0AYAYAKSuUCyAwAWgo2EG7BR//1vo6el8l+VTA
DADADADRAaYAkoMAMAMAMANBBhAYAaYUJKDADADQQYAYAYQGgDADTChLKDAgwAwAwAwAwgMAMANM
A0EGMASVRgBgBgBgBgBhAaANBBgBgBgBgBgBplUaAMAMAMAMAMAMAMAMANBBgBgBgBogMAMAMAMA
MAMAMAMAMANFUaAMAMAMAMAMAMAMAMAMAMANBBgBgBgBgBgBgBgBgBgBgBgBgBgBhAaAMaAElUYA
YAYAYAYAYAYAYAaCDCgwAwAwAwAwAwA0wBJFGAGioMAMAMAMAMAMAMAMANMASFGioMAMIDCAwAwA
wAwAwAwAwAwA0VAllBoAwAwAwAwAwAwAwijADADQQYEGAGACWVRoAwAwA0EGwowAwA2AKIgwAwoN
hRgBgBsAUQGyKMKDCgwAUkRAoKMAMKg2FCkQGwDADYBtACiA2FGygURBsKNlBtBAoijADCgWlYgN
gGAGAG0goWEGAGAGwowAUkAbCDADADYUYAaCDADADADADLXAE2CjLAGWANAGAGAGAGAGAGgDAgwA
wAwAwA0wBIUYAYAYAYAaCDADTChIBoIMAMAMANBAloKNAGAGAGwBSCDYUbSuALAMACIKFoAIgBaz
AFkUEQAtABIhQSIAWIASIUFiAEQAWJFBIgBIhQWIASIASIUEiAFiAFiRQSIARABoIKDRIAsQoIkA
EQUEQARBQRABEFBUQBEFBEAEQARBQSIASIUERAEQUEAFgBEALiFC4gBEALAFoAUFC0RBsqjABaID
ZQbIowAwAwAwAwAwAwAwA3cINkBgBsoMKDADAAkaLe3IyaBVCMebDWhtzuAC1rlBpvj+uxBBrbx9
iANJ2326gBLV93awDTdt9uoIBWT2JsA27rhH2/EAE3HmwgxJ7opc3+YAibv50uxZ/BBAJWfmxb6/
yCDflR3qPq9mYUN5ai2tv1ev8ggVG782C63n7cgBE7y8+fYs/ZkCgLcI7E5dbt6l8SoDLxi2JQXY
vW8yKG84xveU23yV/W7e8qBMZR2Qhd87v1KwASSqrJtQXC6j6ln6iKG2rThtbl1K3rfwKyFRnrO1
Omm+rWfw9QBupGpPKpNRXBv3K4UN2qVP60v5V737Az4C6dSU/wB1TS5paz73f3BRqrSnP97NLk3d
9yv7gfEA+hp/Wm+yK979gTwFwq1Kn7qCXVG773dhZfcEVaEp51aiT5vWfcr+uwSz3gDdGlulN8/J
XvfrRU8AlOvUqZUYJfdjd97uwsvuA6uGnN3rVEnzlrPuV/XYJZ7wB+IpfWm+yK979gTwFU8VUm7U
YJP7Mbvvd2CX3BNXCVKjvWmov7UrvuV2Cz3hvq4ejtc6j5Wiu93fqQTwMjjmnajTjF7rLWl3yv6r
A37huvg8RiM60tX/AHkrep59yC2W8hq6OHo+dOU3wgrLvln6gmoEPSEaX7qlCPOXlv15eoaO4Eq0
MXj1eetqcZPVj2Xsu4GrQ0eDoUP3lW74U1ret2XdcqakA3jaND93RTf1qjcvUrLvuDcgXGvjNJrV
p62pwgtWPbay7yLu0NXoqNH99VhDknry7o5d7Rdp2+8IdbCYbzYTqvjN6q/hjn/MDcgTHTOIqPUo
JU77qUbPvV5PvGk7r6fwCKmhK83rV5Rp331ZWfdnL1DZ231/iBOjgsL5051nwgtSP8Urv+UJ4gG9
NrD/ALijTp/aa15d87ruSGju9w08NjtOeVJVJx+tJ2iu2VoocGrkEfNVDDfv8RC/1aadR9+UfWy7
O2Tm/qNPH4TCfuqDm/rVZX/ljZd7YNyen4hD01i8d9HTbSfoUo6q7oJX7bjSd1v9Az/ZytDOu4UU
/wC8kk/4VeXqG17L6+BrxeAwe2VSvLhFeLj3u8vUi+U8T7/4DP8AaF4f/ielTo81HWn/ABTu+6w0
d+uAOGFxunnrWqVftO7S7XkicLq5Bx8y0sL/AMUYiEX9WH0kurLyV/ENnbrm/qN/LsHhP3VF1H9a
rLL+CNl3thdyf0hFTT+JxC1Iy1Iv0KaUF3RtftuNJ32hVLo7iaq15xVOL9Ko1BevN9iY2dlB1g8H
g/3lWVV/VpRsv4pe6INSf0Dfz3DDf8T0KcPtS+kl3yyXYkNL3a4n6htPE4rTUrN1Kr4K77kskOE3
cg8XR6dDPETp0VwlK8v4Y3ffYbXs9/gLTwOD2KpXlz+jj3K8vWgeJ9/8Bt9IatPKioUV9iNn/E7y
9Y0d/u8BtQwWI0tK8YzqPfLN97fvHCSWiRWhoYb9/WhD7MfLl/Lku1jbXbrmgixeEwv7uk6j+tVe
X8MbetshuT+kIrabr11qqWpD6sEor1W9Y0d1GYXRFfGLWjB6v1nku92Q2TG0PVo+hhv31ZN/VprW
f8TtH2hdSAi0jRw/7mir/WqPXfdlFdzJpe6TgN8RpKtjcpzbXDYu5ZF0zcrQ5oaHrVlraurH60nq
r1+4m1mNF26LUYYZ1IxqKcnq31U7K19727TNd+nNBehcTD5TVpRgo21ru7bbUrb+vYKYXyM0fXn8
uqwlJtWdk3szTyFMb5DrA4WeHxdWTVoSWT4vJ/ELJqgmChDD4qrFSblLymrZLt3vMizxRmArKOJq
0lGMd91tfX3gl8hvo2cli6sZNvba/C+XtLUx5AsCvFY2ouOt67MJOQma8Xjutr1xB6hOnlatF/ZX
tYiZ8h90hV4w62I1mFx/4j7PeD0AtALOfZ7xTAR0FrV+ufvKx6/MSWnH5UVyZI3mHGB+jw0nykyL
OBE6Pjr1Y9d+7M1XPHkPdLyvUS4IkazDzRv0VKUut9yJWseBAwjru3E05if0o9SEYrj7DMdMwy0b
T16i5ZlrOMCtIz16j5ZCJlyHWioW1pdgrWEERWqeNk5cWViiZwK+T0nN77vuM10x8QV1vWzNOQsO
H/Y6Dlvav37DLrPEFaNOQsmF/YqDnveffsMus8QVdu5pyGggQwBEigHIIBsAQwAbABsqBDAByAES
ABsIEMoBsAQwAcggGwBDCAYAMAGyoBsAGwBEgBIQIYAlgCWAJAEyAEhAhIAWAYFCkiAUAYUGwDdi
A2AYAbsAbCjdgg2AbAMANhRtIIFWANkUYAZYoFpAGEBsA2FG0igUEGyKMAMKBSQBsgNgGAG7FUbs
AKIgwA2FGBRuxUCrEBsAwKMANpFQKSIDYUYAYAbSuAKSsQGygwAwgN2ChVgg2AYAbCjdgDZEGwDZ
VGAG7AG7EQbCjYBgBgBhQYAKsAbsQGwDADADADADAo2AbsAbsEGwDAowASwBIQaaAEAGmAIANBAl
gCABLKBJECGVQiQQBkABkVAGQACQACRUAJADeQQAkAN5FQN5ADeRUAJBACQQAkUAJBAlgCGUCGRA
llAlhQkIEsASAJkAIAMANgC0rAGwDaQULCDYUKCD/9f6OnpfJflUwAwAwAwA0RAkKNFBgBgBgBgB
oIMIDTChIBhQYAaAMCDADADRAYAYAJKo0EGAGAGAGAGAGEBgBgBphBoA0yqNAGAGAGAGAGAGEBoA
0EGAGAGAGAGAGmVRoAwAwAwAwAwAwAwAwA0EGAGAGAGEBoAwAwAwAwAwAwAwAwAxgCSqMAMAMAMA
MAMAMAMAMAMAMAMANBBgBgBgBgBgBgBgBgBgBgBgBgBgBogMAElUYAYAYAYAYAYAYAYAaCDCgwAw
AwAwAwA0wBIUYQGggwoMAMAMAMAMAMAMAMAEhRoA0VBgBhAYQGAGAGAGAGAGAGAGFQJANFBoAwAw
AwAwAwAwAwijADQQYEGAGAGmFCSgwAwA0EGwowA2AbIDYQYUGwowAwA2AbIDYBsKMKDADYQLIowA
wAwoFIgFAGAGIAUFCiIMAFFUbQQKIowA2igWQGAGACkigUQGAGAG0FCkEGwDADAo2AbSAFBBgBgB
sKMANBBgBgBgBgBgBgBgBgBgBpoKNAGgDADADADADADADQBgQYAYAJaCjQBgBgBgBgBoIMAEBRgB
oIMAMAMANBAloKNAGAC0gg2FGABFkAYAKSChaACIAWlYAXFBQRIgFoAIgAiCgiQARABUFBEAEQUF
RAEQAVIKCIAIgAiCgqACIAKiKCIAIgoPEAMiAIgoJEKCIAJEAJEKCIAIgoKiAIgoIAEACIKCIAJE
KFxACIigiAFgBAAiAFxChaAFoAIgDYULREGyqMAFogNlBsijADADADADADADADADADaYBsiDABUY
uWwAOqNto2ugu6jsCjTlcAFe/wCr/kVBpvj6/gAavfiwDWzgvWAa87iwDea4IAG2nxYQZZ7l2v8A
MARN8Zfr2AA8nsTb/XAIFeUuEf13gAXq722EGZvzY9rz/IKEyu/OkrcFn7MggBeEdzfqCBfl7oqK
47PWwoFNJ+dO/Vn7bFSgalFebFt837lYgCPxi4QXZH8weQ2cYLzpNvkve7FQYprZCF3zu37l6gAk
lVatKSguF0vUvgFDVwpw2ty6lb1v4BkbhUu7U4K/8T+HqAF1IVJq05KK4N/5V8AobatKG1yl1Ky7
3f2BPAVGrrZU4K/VrP15eoGxupTq1P3klFcG/wDKs/UF8gGrSp7XKXUrLvd36gz4GRr52p01fq1n
68vUF2FVqVaqvpJaq4Sdv5dvqBqht4ujT2ylL7qsu9/AJ4GvlSi7U6cU+flP15eoqbBalLEV19I3
GP2nqruy9SIvmhp4mjS86bk+EV73b2MqagS8VTp+ZTXXJ6z7sl6gmwZrFYqO9Q7IR9yC+aGnySnS
8+ouqC1n35L1hNBDxFGj5lPWfGb9yt7WDcBIYjE4tWpJqPCEdVdtresEtoby0fqZ1akI8r60u6N/
W0Np2+8Cc8NR2RnUf2nqruV360DwMjpKq/JoxjB/Yjn35y9Y0d3uCaujK9Xyq0lDnUlZ92cvUNnb
fX+IbujhaHnTnUfCC1V3yz9QNSBD0pGj+6pQjzkteX82Xci6TuGTo4zSyu9eUeMnaC77RQXzQ3ej
aVD97Wj92Cc335R9Y2nb94Q8XhsN+7pOb41JZfwxt62wbkCfnXFYv6OleKfoUo6v+FXfbcaTut/o
A5aBqxzryhS+/Lyv4VeXqGzs94G6eCwu2VSs+EUoR73eXqQPE+8DenXh/wBxSp0uerry/inf1WGk
7/cB/Jcbpzy2qlRfWk3qrtlki8GrkM+aKOG/f4iCf1af0ku9Wiu8mzt1zf1GnjcJhP3VF1H9arLL
+GNl3tlNyf0gU9P4rEfR05akX6FKKgv5bN9txpO+/wBQyPRzEzWvVSpRfpVZKHqflPsTG17L/WN/
JcDg/wB5VnWfCnHVX8U8+6JTUg18+ww3/E9CnT+1JeMl3yy7kho7tcT9QJ18Zp6Vr1Kr4K7S7Fki
cJbcg6/2elh/+KKtOjyctaf8MbvvsNr2a5G1PAYPZGpXlxk/Fx7leXrQPE+8bfSOtTVqChRX/G4p
P+J3l6xo7/d4Deho3FaXevGM58Zu9u2Ty9Y3pNXIPfmalhf+KK8E/q0/pJeq0V3jbXbrm/qN/LsJ
hP3VF1H9arL/ACxsu9sG5PT8QOvp/EV1qKepD6sEoLuja/bcaS52jWG0DicUtfUcYfXn5Me+VvUN
kwtDv5uwuE/fV9d/VpLW/mdl3XC6k5v4BS0tRwv7ihFP61R68u7KK7ho7pOJ+obYnSuI0j5M5ykt
0VkuyKy9Q0lytDyjoDETWtKKpw+tUagvXn3IbWYUOFhcJhPPqSqvhTVl/FL3Ii6kC1plYf8A4npQ
p/aa15d8su5IaXu1wGdbF1tIS8uUpvcm2+5FZttEjS0FWtrVNWlHjUer6tvqJtrsoMqWEwvnSnVf
CK1Y97u+5EXxAtaZdHKhCFLmleX8Urv2DR3e4MpVKmNl5TlOXa2VnkXjorgKuEqSdSOqpRyT27eG
0xXfpzQdYJUaGOmk5OpLWvklFXz62FmpQWWMdHHqmlFRltaWb8ne+sLvyB4l+J0jB7pR9qaHol9o
Fr/QY+D3Tj8V7kPRb7QJL6HHr7cPd+Q9DjIJt4nH/fj7vyB/OCJrxWPT+sv8tvcPRP5wTpBeLxkH
x1fbYQy5GukUbTi+XvEOoHuns6cXz9xIuY3D/iPsftKegHoD0/w+8UwEfhleuvvFYnId6bflpfZ9
7JGsw8j9Hhez2sjXoGOiI3q9SZazhyNaSetVl2ewRMuRJfusN1r2sjfoIvAw16kev2ZlYnIe6Vne
aXBCNZg2iYWUpdhKuAi6k/GSb4s05iZX7PQvva9pl0niCAS1sjTkJzSL8RSUFvsu4zHXLxBBUafj
ZKPFmnKTYmNMVNSMYLr+BI650QuHpePmo8WVzk2JjTNXVUaa6/gSN50VwrmMCBDAByKBEggGwBDA
BsAGyoEMAGwBEgAbCBDKAYANgCGEA2AIYQDYAMAGVANgA2AIkECQoSwgSFCWECADTAEBBgBgULSs
QGygwA3YAUQGAG7AGwowoFWIg2AYAbCjABSQQbIo2AYAbSAFAGAGwo2UCkgg2QGwowA3YoFJWIDY
BgBgUKSKDdiA2EGBRsA2UG7EBsA2FGAGFQKSIBQUYAYAYAKSAFAGAGEBsKNpBAoAwA2AYFG7BAog
N2KDAowA3YIFEUbAMKDADADdgBViA2AYAYAYAYAYAZYKNgG7AG7BBsAwKNkBgBgAkqBAUYECGgDQ
AloASAJYQIYAllAkgEMqBEgAMgAEioAyAAyAG8ioASAASCBvIoG8ggbyCBvIoASCAEggBIoAsIEA
CGUCWRAhlUJZECSg0wBABpgAwDABaQAoAwAWgDYApBQoA//Q+jp6XyX5VMAMAMANMgEsA0UGAGAG
AGAGggwgMAEsKNFBgBgBoIMAMAMIDQBgBphRooNBBgBgBgBgBgBhAYAYAaCDQAkqjADADADADADA
DCA0AaCDADADADADABJVGAGAGAGAGAGAGAGAGAGMINAGAGAGAGEBoAwAwAwAwAwAwAwAwA0yqNAG
AGAGAGAGAGAGAGAGAGAGAGAGAGggwAwAwAwAwAwAwAwAwAwAwAwAwgNACSqMAMAMAMAMAMAMAMAN
BBhQYAYAYAYAaAEhRhAYAaKgwAwAwAwAwAwAwAwA0wBIUYVBoAwgMIDADADADADADADADADRUGmA
JKDADADADADADADCKMANBBgQYAYAaYUJKDADADADADYBsgNhBgBsqjADADABSRAbANkUYUGFBgAt
IiDYUYAYVBtBQogNgGAGwoUgg2QGwo2igURBsKNlApBBsijADaVygWQGAGAGACkiqFEQYAYAbCja
AFBBgBgBsKMAMANBBgBgBgBgBgBgBgBgBgBgBgAmwUaAMAMAMAMAMAMAMAMANAGBAlhRoAwAwAwA
0EGAGmgBIUaCDADADADADQQasAYkAKCjABaVgDYBsKFpAC0gBaVwBYAQihaQAtABEgAiVwoIgAqA
CIKCIAIiKCoAIgAqCgiACIKCoAIgAiCgqIAiACIKHCQAVEUEQARBQRABUAEQUEQASJFBIgC4hQRA
BAoKAEQAtBQRABIkUEQAtABABYUEQAuIAtAC0AbChaIg2VRgAtEBsoMAMAMAMAMAMAMANkBgUYEG
igNCk5ciLoHVNR5kXQW5A2B61wBLlf8AV/yCBMv1coNXvxfUAatbgvaAabvvbAN2fD9doBp57X3A
GlZ7FcAxtrgv13gAnbe2wgyzeyPb+sgBMrvbLs/0yAEeSuL9QZGeVuSX64sKBzSfnSv6wgHeK2K/
W/gECvLXCPcvzCgEoxv5Urvkve7BBpTjsjG755+yxQKaqb2oLsj6tpFDdwhHbJvqXvfwKyNRqLZC
GfPN/D1ABJqq1aT1VwbS9S+BF8htqU4bZOXUve/gVBiqrZCCvz8p/D1BNhc41pLynqrg2o+r8g1d
gHi6cNsnL7q97+AZCfHRjlCCvz8p+5eoGwaUa815T1Y82oruyC+Q1dGnT86d+UV73b3hNDXj4Q82
F+cnf1KyBsF/aKyyvGPZCPuQPNDZ4aEPPqLqitZ+5esJoI8dSp+bByfGT9yt7WDcBYVa9dWpppfZ
Vl2te9gltDeWD1XepUin16z9V/WypoDcqFLYpTfN6q7ld+sHgbjjKknalFRf2Y59+b9YN+4aqYKr
Ud60lH78s+7N+oFx94bunh6O2Upv7K1V3u79QTwEvHqn+7pwjza1n/Nl6ho7gSdHFY5XlravGT1Y
+uy7gatDZ4OlR/eVU+UE5et2XrYTUA3iqFHzKWs+M5X9UbL2g3INwxuJxnkUrpfVpxsv5V7QbtAZ
aJlDOtOFPjrSvLujd942dvvAmsLh/r1X2Qj737AeIEPTEqX7mEKfNRvL+KV33WLo7vcEzwOL0l5c
1Jr603Zd8mkQ1aAvR9DD/vayb+rTTk+92j62VNSeoQ8dh8N+6o6z+tUk5fyxsu+4NyActK4rG/R0
3JJ+hTjqruilcaTutCHoCrDOtKFFfbkk/wCFXl6hs7PeEOngsL50qlZ8IpQj3u79SB4n3gb078n/
AOJ6VOl9q2vL+Kd/UkNJ3e4B8XjdPO/0lXm7uK7Xki8HnIK+ZIYf/iivTh9mL8ZLujl3tE2dvvv6
jTxOCwnmUp1nxqS1Y/wxz75FNyAc+kmIS1aWrRi91KKj615T7WNFzoHS0Hi8f9I4SSe2dR6q/ik1
cbSY2hfzZhcJ++xCk/q0YuX8z1Y91xte2Tm/gN/OmGwn7jDpv61V67/hVo+pjR3ScT8QGvpvFaQ+
j15ar2QgtWP8MbIukuVoNS6NYhrWqJUY/WqyUPU832Im17KDLCYLB/vKs6r4U42X8U/dEGpBv58h
hv8AiehTp/al9JLvlkuxDS92uJ+oZ1cbidMStKU6j3Rzfcll3IvDNtyD+PRutTV6zhRX/HJJP+FX
l6iba7Pf4ClTwOD2yqV5cl4uPe7y9SB4n3/wCv8AaGVDLD06dHnGOtL+KV33WGjv1x4EfrYjS089
erPtk/eOE80Si6PTo54idOiuEpXl/DG79g2vZ7/AUngcHsVSvLn9HH3y9gPE+/8AgF/7Q1aatRjC
ivsRs+2TvL1jS9/u8BjTp1tJSyU6ku2TDPmiWWgZUM684UuTd5fwxu++xNtdmuQtTweE2RnWfGT1
I9yu/WgvifeFPT1VK1LVpR4QVn37fWNHeGVKlVx0vJUpyfW2GeRLR0JKjnXnClybvL+GN37Cbb7P
eFqeEw2yM6r4yerHuV36weIFPTVW1qerSjwgrevb6xo7hLdE6jliW27txeb60St9PkPv3Wk+32wH
o1/OBtK/RY+k+Op7WiQy5B9O/RYmjPq9UvzEXPmA2nX4mvQnz9jXxEXPxYC6Y+hr0J87PvXxYhlz
BmlF4rE0Z8cvX+YhlzAnSq8XiaMuNl6/zEMuYEacWpWpy/WT/MQz5C+kcfMfX7hDqA2l/LoQfOPs
YhnwFUc8H2P2sizgI0Bsn2e8tTAMcEr1195+8VnHkG01nVX3V7WIuYf4jycKuqJGrwG2hY+VJ8i1
MAyxktapLrZWKJjSH0dGMepeozHTLgNdFQvO/BFrOADjpa9SXd3CJlyJPD/Q0G+Kb9xG54ghox1m
lxNOYl9KS1Ixiv1YzHTIR2Ap+MqLln3FrGPILpaprTtwQjWQzRFLXm5cF7RUwga6Rq+NqPgsu4RM
r5DvQ1G7c+GSFawgjsbW8fUlLdfLqRYxldhiEGBAhgA2UA5BAhgA2AIYANlQDYAhgA5ACJBAhlAM
AGADYQIYAhgA2EA2ADZUA2ADYAmQAgA0wgQFGggQAJYAgIMChaRAbKDYBuxAbAN2ANhRhQbsRAoA
wA2FGAG7BApIA2RRgBlrgC0rAGAGwDAoUkUCgg2RRgBhQKSAFEBgBgBuxVCrEBsIMANhRhVG7BAq
xAbAMCjCoNpXAFWsRRsAwAwA2kALsAYAYQGwDAoVYINgGAGwo2AbsRBsoNhRgBsA2kRAoKMAMKDd
gDdiA2AbAMAMAMAMAMsFGwDZQbsQGwgwAwA2RRgBgBuwBoA0UCWAJCDTAEAGgBABoIEMoEkAgoNM
IBSAAyAASKAMggDIAbyKgBIABIAbyKgbyCBvIIG8igBIIASCAEigEwgGAJYAlhANlUaIgQyqMCAb
AMABvIA2lcAWAYAbSChYQYFC0EGwo//R+jp6XyX5VMAMAMANMgElBoAwAwAwA0EGAGEAlsKNFBgB
gBoIMAMAMANEBgBgAkqjADQQYAYAYAYAYAYQGAGgDQQaZVGgDADADADADADADCA0AaCDADADADAD
ABJVGAGAGAGAGAGAGAGAGAGAGggwAwAwAwAwgNAGAGAGAGAGAGAGAGACSqMAMAMAMAMAMAMAMAMA
MAMAMAMAMANBBgBgBgBgBgBgBgBgBgBgBgBgBgBogNNFUaAMAMAMAMAMAMAMAMANFQYAYAYAYAJC
jQBhAaCDCgwAwAwAwAwAwAwAwASwo0AaKgwAwyDADADADADADADADADRUGBAllUaAMAMAMAMAMAM
CjCA0EGBBgBgBphQkoMAMAMANgG0iA2EGAGFBsKMAMANogFBBgUbCjCgwAUkRAoKMAMANlApEBsA
wA2gDYUKIgwAUVQoiDYUYUCkECiKMAMKBaViA2AYAYAKSKoURBgBgBsKMAFhBgBgBsKMAMANBBgB
gBgBgBgBgBgBgBgBgBgBgBgBgBlgDVgo1awBoAwAwAwAwAwAwA00AJANAGAGAGAGggwA0woSAaCD
ADADADADQQbCjABSQAoAwAWkFCkAEQAtIAXFBQtEARAC0gAkQoJEAJEAJEKCxACRACRRFBIgBYhQ
SIARABYhQSIASIAVEUEiAEiAFigocRIAiCgiACoKFoAKgoIgAiCgiIBcQAkQoIgAiCgiACBQQAIg
AiIoJEAWgBYAQKFoAWgBaIBaKDYULREGyqMAFogNlBgBgBgBgBgBgBgBgBtRcthAOI4fiNroFSVP
YRRjkAITuEGm/wBbfyANP9XANa1t/cECbW3W6yqMb4vuANLkgDea3pfrkAJdkAKSe5frtANN32sA
E7LiwgV5W5JfrmADmr7ZX9YQIutyv1/kAL8tcI+r8wAMorfK/V+YQJ1lujfrz9gBt6+/yV2IAbuM
Ftk31L3sINa62Rjd88wBclU3vVXZH1BQ2cIR2yb6l738Ag0qkVlGGfPP4IqbBGqrWb1V2RXdkRfI
bunCO2V+pe92KgR42EfNhf7zv7LIGwf6aa+rHsivcDyGrowj507/AHVf22QNDXjacPNjf7z9ysE2
CxlWqryE4rktVd+QXyAPDpZzmuzyn6svWE0EuVKGyLl1uy7l8QeAqniKtTKlG33Y59+b9YNgdTCy
lnUmk+bu+5XYNAdqNPfKb7Ir3v2FTwE/K9V2pwin1az9d/UQ2F1aFfEZ1G0vtuy7n7gatDfxFKl5
09blFe9295U1Al4mnS8ymnzk9b1ZIGwuNTE4xWjrav2Vqx9VkDzQ3eAVP95UjHknrP1ZesbTtCHP
D0dkZTfN6q7ld+sHgaWkamylGMPuRz73d+saO73DU9H163lVXq86kre3MbLjf6wF4fD0fPqOb4QW
XfK3sYTUCHj6dH93Sj1z8t+5eoG9DSrYvSfkx15R4RVo9ysgbtAfmrxX72pCHK+tLujf1tDZ2gbl
hMPsjOq+bUI9yu/WgeIBvTVSn+5jCl92Of8AE7y9Y0dwRLR2K0h5c1K31qjsu+TRdnbaBvR9DD/v
ayb+rTTk+92j7QmpPUIeOw+G/dUdZ/Wqycv5Y2XfcG5PQCnpjFYv6OEmk/QprVXdFK40ndaEf7P1
/Oq6tJPfUkovu871DZ2UIeHwWF8+pOq+FOOqv4pZ/wAoNSBD01DD/uKFOH2pfSS75ZdyGk7tcT9Q
2nicZpx6t6lX7Ku0uxZIvCbuQL/s7Oh/xRUp0eUpXl/DG777Da9nvGv2DCf3leXZTj/ml7CHiff/
AACX0jnQyw8KdHnGN5fxSvLusXR3+7wGkMNi9OyulUqvi7u3a8kOE1cg4+YI4b/imvTp/ZT8ZPuh
dd7Q2vZ76NrEYDB+ZTqVnxqS1I/wxz75A3J94yfSXEJatLVox4UoqP8AN53rGjvvwDbDaLxWl3rR
hOd9sns7ZPL1l3pJjaH/AMyUsL/xRiKcX9WH0kurLyV3k2vbrm/qN/LcFhP3VGVV/Wqyy/hjb1th
dyf0hFXpHiai1YSVKH1aaUF6s32tjSd9AcLofE6S8qFOUlvk8l/E7L1l2kxtD9aHo4X9/iIJ/Vp/
SPqurRXeTbXbJzf1G/l+Ewn7mg5v61WV/wCWNl3tjRuT0/ECr9IMTXWqp6kPqwSgu6NvWNJc6BYP
Q+I0hnTpya+tsX8Tsi2kxtEitD0cL+/rwT+rT8t9V1aK7yba7dc39QtY/C4T9zRc39aq7/yxsu9s
mjcnp+IHX07iMQtXX1YfVglFdyt6y6S52geD0XXx37uEpLjbLveQ2TG0Sa0RTw37+tCL+rDy5erJ
d5NtduuaFrGYXC/uqTm/rVH/AJY2Xe2Dcn9IRW01XrrV1tWP1YLVXcresaLlRHorIWiALEAsvRZ2
xMeal7CV16fIlMf9HpGL4yh67Ino1faBukr8XXpT5L1MkXqchx0rVlTlwb93wEXqA3SZa9KE19b2
r8hDqcBfSB+MowqLdJPvQi58BennenTqrdJPvV/cIZjXSBWVOot0vbn7hDMZ0ijrRhLg36/9BDqB
enV4ylCXNetEi58BWN8vCxfKILwN4XysI+qXvKTgI0Dsn2e8VMAzwP8AxQuuXsYScgml/wB72IRM
+Q/0h5NCK+77CRvLgD0JHzn1e8tTARcvpJ9cveVgTOmHlFdZmOmYzREfOfUWpgIipLXk3xbKxROY
z6Kio9SMx0y4EfgYa9Rcsy1nEL0pPWnbghDIH0TT86XYStYCIxFTxsnLizTnyJrAr5NRc+N38DNd
MfEFdk7mnIWGH7Hh772vWzLrxBWjTiBhRgQDYAhlAOQQDYAhgA2AIZUA2AIYAOQAiRUA2ADAEAA2
ECGADYQIYANgA2VANgA2AJYAgAxhAMKNBAgASwBAAtIA2AbCjdiINgCiqMAN2CDZAbANhRgBuwBt
IINkUbAMANpACgDADYUbAFJFQbIDYUYAbSuUCkrEBsAwAywUKSKDdiA2EGBRsKNlQbsQGwDYUYEG
ygUkRRsAwAwA3YAUkAbAMANkBgUbsECgDADYUYAbSAFBBsKMAMANpACrEBsAwoMAFJEAoAwAwAwA
wAwA3YqjADdiA3YINgGAGBRsgMAMKDdgDaQAogEtACQBLKgQFGBAhoA0AIZQJIBLKgQQCWUCSAFI
qAMgAMigDIIASAG8ioASAASAG8ioG8ggbyCBvIoASCAEggBIoBBAhgCWAIYAhlAkIEsKNBAhgGgB
LVwBQBgBgAtAGwBSChQBuwB//9L6OnpfJflUwAwA0yASAaKDADADADADQQYQCWwo0UGAGAGAGggw
AwAwgNAGAGmFGig0EGAGAGAGAGAGEBgBgBoA0wgSVRgBgBgBgBgBgBgBhAaANBBgBgBgBgBjAElU
YAYAYAYAYAYAYAYAYAYAYAaCDADADADADADRAYAYAYAYAYAYAYAaYUaKDADADADADADADADADADA
DADADADADADADQQYAYAYAYAYAYAYAYAYAYAYAYAJaIDRVGAGAGAGAGAGAGAGggwoMAMAMANMASFG
EBgBoqDADADADADADADADADTAEhRoqDADCAwgMAMAMAMAMAMAMAMKg0EGmFCSgwAwAwAwAwAwAwi
jTCDAgwAwA0woSUGAGAGACkQGwgwAwA2VRgBgBsAUQGAGwowoMANoIFIgNhRgBhUCkRQoAwAwA2F
CkEGyA2FCkUGyINhRsoFEQbCjABSRQKIDADADaChYQYAYAbCjABSQQbAMANhRgBgBgBoIMAMAMAM
AMAMAMANhRoIMAMAMAMAMAMAMAMAEtBRoAwAwAwAwAwAwAxq4AhqwBoAwAwA0EGAGACWgo0AaCDA
DADADADADaVwBYBgApIKFBAtIKFoAWAESIoWkALQAsAIkFBUgAiACIKCIAIgoKkQBEAFSCgiACIA
IgoIgAqACIigiACoKCwQAdEAVBQSIAuIUEiAEQUEQARBQREARABEFBIgBIhQSIARBQRABCAIgoWg
AkQBaAFhQQAWgBaIBSKDYULREGyqMAFogNlBgBgBgBgBgBgASFJzIaDiNFR25k21oLctXZkFCdYI
EXv+veAJk/1tKg1t4vrANp8+4iDSz2K/WAY2+KX65FUIy5sAUk9yt+uYBjz2sASrbkAKzXIAS7b3
cAxNblcIMesuXq/MKBNLe79QQautyv6wg29be7eoKBWitrv1fmGRrWXox94BuSnvequ71BQ31YR2
tvqXxDISpr0Y9+YULkqj2vVXZH1A8hu4QjtlfqXxsECfGRj5sb9bv7LABPpZL6q7Ir3A8hu6UY+d
PuV/gimhrxlOGyLfW/cre0IFQnVqeYrL7Kt6/wAyL5A5UN85pPr1n6viVLANulDdKXXkvVf2g8BU
K85O1OKXUrvvd2DY1UoVJ51JJfeln3ZsGgHUpU9rlLqVl3v4BPAz5So+ZCK6/Kfry9QNhcoYiuvK
uo83qr12QXzQB4enDzprqir+vJBnQR46lT82Dlzk/cre0G4FxxFevlTTS4QVvZ7wu7QKWBks6kox
63d9yuwnaBNUKW+U32RXvfsB4Gvl2p+7hGPO2s++V/UVO4bnQxGMV561uMnZeuyBq0AeEpUvPqLq
gtb15L1g0EvEUaXmU9Z8Zv3K3tYTcGRx9ev5NO65Qjb2ZjR3Wgb0XU21XGH35Z92b9Q2doG6WGo7
ZSqPhFaq73n6gngDekY0v3VKEeb8t/zZeoaO4JcsVpXLy5rlfVXuQ4POQG9FKj+9qwhyT1pd0b+t
obO33gbnhMPsjOq/tNQXcrv1oHiAb01Up/uowpfcjn/E7v1jR3AXzditI+XJTa+tN2XfKyKatCXo
2jQ/e14/dppzfflH1jadsnqEPGYXDfu6Lm+NSX+WNvW2DcgDU07iKi1IS1Iv0aaUf8Ob7bjSd9A4
6CxNda846kX6VRqC/mtfsuNnZRp4DC4X97X139WlG/8ANKy7kwak9fwCHpXD4X9zh43+tVbm+7KP
qY0d0nE/ENa2msVj/I15WeyEPJX8MbIumblaFw6N4hrWqJUo/WqSUPU8+5DazChXyTBYT95WlVfC
lGy/in7kQ1J/QEvTdLDf8T4enH7U/pJfzeSu4ul7tcT9QyxGlMVpZ6kpznfZFbOyKy9RdaZuVocR
6MYhLWq6tGL31ZKPq871E2vZfgCLDYDB+fVnWfCnHVj/ABSz7og1IN/P0MN/xPQp0/tSXjJd8su5
IaO7XE/UMq+kcTpd6s5zqPdHNrsisu5DWkttD+n0ZxCWtV1aMXvqyUfV53qG17KFrDYHB+fUnWlw
px1Y/wAUs+5BdSfeF/P0cN/xPQp0/tNeMl3yy7kho79cQR2I0hiNKStUnOo9yu33LZ3F4ZttEhS6
N4iS1qiVKP1qklD1PPuRNtdlBVhMFhP3lWVV/Vpxsv4pe5A1IF/PkMN/xPQp0/tS+kl3yyXYho79
cT9RHYrSVfSL+lnKfJvLsWwukuVofYfo/iay1nDUh9abUF67eom1mFDpYHCYT97WdR/VpLL+KVl3
JhdSf0Ai0vSw37ihCP2p+XL15LuJo7tcQNMVpSvjv3k5SXC+Xcsi6S5WhmgyCoKCIAIgoIiAKAWH
o07YqH4v8LJXTp8iV009THQfOD9ZI3lyHPS5WdN8pe4mK9QPOk30lCEvtL1piNdTgb0n9LgoS4KD
9VhDLgKxX02AT4Rj6mkC+YFYj9owKfCMfU7AvmBWO/aMHGXBRfuEMvMCtI/TYWMuCi/d7xDLzBvG
/S4SL4KL9wLwFP6TB9nsYX0G9HeVhpL73sJTHgD0D6fZ7y1OmGuCVsT2y9jCTkK0v+97EIZ8h/pX
KjFc17GSNZcDeh1qwk+fuFMBEYRa1SPWjTnORJaXflJciRvMOMB9HRlLrfqJVx4EPQhryS4tGnMS
2lZeauszHTMJ0VC7b5WFMBHYqfjJt8zTFEtR/Z6De9pvvyRlueIK/bWyNOUE7pJ+IpKC5LuMx1y8
QQlCl46SjxZpzk2JTTVW2rBdfwJG86IErkEBRphANgA2UA2ECGAIYANgCGVANgA2AIYAiRUA2ADY
AgAGwgQwAbCAbABsAQyoBsAGwDQAMAwIEMASwBDAEsAxIA2AbsAKIDdgDZVG7BBuxAbANhRgBgAp
IINkUbAMAMsAKSsAbANgGBQpIoFBBsijADCgUkAKIDADADdiqFWIDYQYFGwDCg3YgFWANhRgBhUG
0goWQGAGAG7AG0gBVgDADCA2FGwDdioNgGyAwKMAFJBBsA2FGAGwBSRAbAMKDADaVwBSViA2AYAY
AYUGwowA3YgN2CDYBgBgBgUbIDADCg3YAUkAbIDAowA0wgQAaKBLAEhBpgCADTAEACWECGAJZQJA
AyCAMgAMigDIIASAG8ioASAASAG8ioG8ggbyCBvIoASCAEggBIoBBAlgCGAIZQJZAJZUCWRQkqBL
AEgGAGAGACkgoUEGBQtBBsKFhB//0/o6el8l+VTADABDZAaKDADADADADQQYQGmwoSUGAGAGAGgg
wAwAwAwgNAGMKElBgBoIMAMAMAMAMAMIDADADQQIKowAwAwAwAwAwAwAwAwgNAGggwAwAwAwA0yq
NAGAGAGAGAGAGAGAGAGAGAGAGAGggwAwAwAwAwA0QGAGAGAGAGAGAGAGmVRoAwAwAwAwAwAwAwAw
AwAwAwAwAwAwAwAwAwA0EGAGAGAGAGAGAGAGAGAGAGAGrACQowAwAwAwAwAwA0EGFBgBgBgBoASF
GEBgBoqDADADADADADADADADABLCjRUGgDCAwgMAMAMAMAMAMAMAMANFZGACWVRoAwAwAwAwAwAw
ijTCDAgwAwA0woSUGAGAG0gBREGAGAGyqMAMANgGyA2EGyKMKowoMAFpEQbCjADCg2AKIDYBgBtA
G0FCiIMAFFUKIg2FGyg2ggURRgBhQEIDADADABaQUbCDADYUYAKSANhBgBsKMAMANpAGMINWCjLA
GWAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMsAYAasAZYA00AJAMAMAMAMAMAENAGgDADADQQYAYAJaC
hIBgQYAYAYAbSuALAMANhQsINhQRKwAuIAtIihaACIAWgBaQASIUEQARIAKgoIgAiIoIkAFQARBQ
RABEgoKgAiACIAKkRQRBQRAB4IAMiKCIAWgAiCgkQAiCgiACIKCIgCBQRABEAEiFBIgBEFC0AERF
BAAiAFxAFxAFoKCACwBaIBSKDYULREGyqMAFogNlBgBgBgBtK4AeOHb25E2ugZQjTIo3KYAi/wCv
1mAIvfZ6viUGm7cPaEGvO4sAzZvS6gBOT4sAVmtyQBptPa7hBpZ7FcKFZrkAIy43ANp32K/rANu+
92/XIARZLmECk77F7wo2773b9cgATUVxYQaTvsXvANyUntdv1wQAG0Vvb6ggxSXox94QKkpva7Lu
9QUN5RjHa79S+IQJ14rZHvz+AAp+Mf2V2RXuB5AJU4rzpdyv8AmgnXhHZG/W/cgBUZVZ+arLkres
LNgUqO+c133fqKmgNunDdKXXkveAbhWlLKEUupXfe7sJsZVo1J/vJJfefu2hdAWpShtk5dSt638A
gS8RGHmwXb5X5eoJsEar11ndR/hXuQa80B+Twh5011Rz+C9YZ0EeMpU9kXL7z9y+IAuGJq1Mqat9
1e/aDYHUwc271JKP3pZ92bBoI1KNPbKUupWXe8/UE8BDxcafmQiub8p+vL1A2FSWIxi9Jx7o+5Bf
NAfkcafn1IrlHyn6svWE0EupQpbIym/tOy7l8QeBpaQqbKaUfuxz7836y6TuCZYGtW8qplzm7e3M
GqBvD0aXn1HJ8IL3u3sYNQIeLpUvMpJ85ty9WSCbkGljMRi/Jg5W+rBWXdEG7QN6KnD95KNP70s+
5XY2doQ4YajtlOo/srVXe7v1BPAG9Jqj+6pwjza1n3yuvUNHcBt4rSuXlzXbb4IcHnIJeifFfvak
Icr60u6N/XYbO33gblhMPsU6r52hH1XfrQPEA3pqdL9zCFLnGN3/ABSuxo7vcG6wuK0t5Vp1PtO9
u95F4TVyG3oiFD99WhDlHy5fy5esbO330DdfB4bzac6r4zlqrujn6wbkA59IK0Falq0l/wAbiovv
zl6xo76G1PRuK0r5ajOf2pbP4pZesbTttC3oelh/39eEfswvUl6vJ9Y2duub+oG8XgsL+7oyqvjU
lZfww97BuQDqdJMRbVpuNGPCnFQ9a8r1jSXOhtQ0RitKPXjCcr7ZvJfxSsvWXaTG0OfmWjhv3+Ip
x+zTvUl6rRXeTa9uub+oS8ZgsJ+7oyqv61WVl/DC3rbKbk/pAqvSbEtatNqjH6tKKh61n3saLnQ0
w2iMVpV60Kc532yeztk8vWN6SY2h/wDMVPDf8UYinD7MPpJfy5LtY2vbrm/qN/K8Dg/3dKdZ8ast
Vfww97C7kGqnSXENatNxox+rSioetZ97Gk76GWG0fiNKyvThOo3tdm+9/EvCSWiUXR9Yb/imtTpc
Yp68/wCGN/W0TbXZrmjfj8Bg/Np1K0uM3qR/hjd97Hk3J94yXSWvFatLVoxe6nFR9fnesaO+/ARl
OjW0lLyVOpN8LyZWPNExHo5OhniJ06K4SleX8Mbv2E26dmufAVfAYP8AvK8v+TcffL2Dyniff/Ab
/wBoqlLKhCFFfYj5XbJ3fsGl79ceBE1sTPFPWqScnxbb9pWLdhKCAiCgiIAiCgqACIAIiKCIAKgo
nujv/FVPt9jJW8ORK9I3q4uL5R9rJG8+RIdLldU+uXuJGuoD6Y+kwcH9x+oRcuBt/S6P/D7JfkPU
5xCsF9NgWuEZeq7BOArR30+DlHgpL3imPmBWB/aMG48FJe9AnmBVD6fBNcIv1O4J5g3R+mwfUn6m
RZwFYL6TCNcFL4gnA3oXyqUlzfsQphwA6CecupFqYAOFVsV+KXvCTkZpf972IQz5Ehpf93Hr9xI1
kN6N8mjJ837BTHgRujVerHt9haxjyD6Ud6nUkIufIex+jw3Z7WRr0DDR8daou8tYx5BdJSvO3BIR
rIPMB9FScut9xK1j4ggmrmnETekn4qnGPV6jMdcuBF4Gn4ypHln3FrGINpeprTUeC9oi50K0RS1p
uXBe0UwgY4+r46pJ8Mu4sTK7DIMBAUJZUCGADYANgCGEA2AIYANlQIYAMAQwAcigRIIBsAQADYQI
YANgA5BANgA2VANgCGQGigQwDQAhhBoAQwBIQYFCkiAVYA2VRgApIiDYBsKMAMKBSREGwo2QGAGA
G0gBQBgBsA2FCrFQbIDYUYAbSuUCkrEBsAwA3YKNpFAoiDADYUYFGyoN2IBQBgUYEGygUkRRsAwA
wA2AKSANgGEBsAwKFWKg2AYQGwowA2kAKsEGwowAwA2kAKsQGygwAwAUkQCgDADCg2AYFG7AG7EB
gQbAMAMCjYBhAYUGAG7ACrAGyAwKMAMAMAMAEtFQJIBLKgQFGBAhgGgAbKDRECGUCSAQUApBAGQA
CRQBkEAJADeRQAkEDeQACRUDeQQN5BACQA3kVACQQAkVAMAQwBLAEMoEsiBBVGiIEFUaCBABgBgB
tIKFhBgApBQoIFIKFgH/1Po6el8l+VTABLYAkAwAwAwAwA0EGAGmyKElBgBgBgBjANBBgBgBgBog
MAElUYAaCDADADADADADADCAwA0AJZUGgowAwAwAwAwAwAwAwA0QGggwAwAwAwAwASVRgBgBgBgB
gBgBgBgBgBgBgBgBgBgBoIMAMAMAMAMAMIDQBgBgBgBgBgBgAkqjADADADADADADADADADADADAD
ADADADADADADADQQYAYAYAYAYAYAYAYAYAYAaaAEhRgBgBgBgBgBoIMKDADADADABLCjQBhAaCDC
gwAwAwAwAwAwAwAwA0wBLANFBgBhAYQGAGAGAGAGAGAGAGisjADTChJQYAYAYAYAYAYRRphBgQYA
YAaYUJKDADaAFEQYAYAYUGwowAwAUiA2EGBRsKMKDABSIgUAYFGAGFQKRFCgDADADYULIgwA2VQp
BBsgNhRtFAoiDYUYALSKDZAYAYAKSKoURBgBgBsKFJAGwgwA2FGAGAG0gBWwIEBRgBgBgBgBgBgB
gBgBgBgBgBgBgBgBgBgBgBgBgBgBgBgBpq5FCbAGWANAGFQYAYAJaAEgGAGggwAwAwA00FCbAGgg
wAwAWlYA2AbChSQAoA2kAEChYQLRFBEALQAsAIlYKCIAIkAEQUEQAVABERQRABIgBUFBEAEiFBIg
BYoAIiKCRACRACJBQ5iiAIgoIgAiCgiACIAXEKCIAIkRQRABEFBEALQARBQVBQuIASIAREUEQAsA
IgBcQBaChYAQAWiA2ig2FC0RBsqjABaIDZQYALjTc9hDQcRw6W1k21oFuobMgoQ5BAlv9bPzYAm/
D1FQaeXBesATfW4sA3muCAEtre2wDaz2IAzPe7cl+QAnJcWAKV3sQBju9r7ABOS4v1AG1d7EAY7v
awBPkri/UECk29iCjbTe1gCPJXFhBq99i94BklJ7Xbt9wANqK3t9QQJU1uj7wBTU3tyXcAD1Ira+
5BAJzjHZG/W/hYAUnUlsVlyy9YPIDKkvSkvaDQQ3CO5vryCDcKspeZFLqV/XmwuwmpSnPz5Jdb92
bCaAtWnDa3LqVvb8CgS66j5sF25/l6gbBGq1VZ3S/hXuRDyAOhGPnTXZn8F6ypoJ16cNkXLrdvUv
iDwFRxFSeVNW+6s+/aDYRPCzlnUaX3nn3ZsGgjUpQ2ycupWXe/gE8BLxMYeZCK5vyn68vUF2Fp18
Usta3LJe5A80CeEUPPnFcl5T9WXrCaCNajT2KU+t6q7ld+sHga+XSjlTjGPUrvvd2DYyWFr4nOd7
cZuy9YTVoD8mp0/PqJ8oq/rdkDQ069Gl5tPWfGb9ysDcGlj61TyYeTygrezMqboQ9G1XnUtC++bt
6tvqGztCHQoUvOm5PhBe+XwBqBHy2nS/d0o9cnrPuyXqCb0EPF4jG+TFya+rFWXcgbtCXomcP3jj
T+9LPuV36hs7Qh08NR2ynUf2Vqrvd36geIBvScaX7qlCPNrXf82XqGk7gGdfE6T8m858le3cshwb
uQx6GlS/ezhT5Sld/wAMbsbO0DccJh9rnVfK0I+u79SB4gG9MeJ/c0qdPnbWl3yv6kho7vcGsqmK
0w7XqVOWbXdsReE80LegpUv306dLlKV5fwxuxtez3gbjgsNtdSs+VoR98vYE8T7wh6cdD9xSp0uD
1daX8Ur+qw0d2uAwnVxWmZWbqVXwzl6tw4Z85Bw+jtSlnXnTorhOS1v4Y3Y2vZ7/AABuGAwm2VSu
/spU497vL1IHifeE/wC0Hyf/AIno06XCWrry/inf1JDR364EfWxWJ0xK0pVKsuGcu5F4Z3cg8XRm
vBXrOFFcaklF/wAOcvUNr2X18Dbw+Awfn1KlZ8IR1I/xSu+5A1J94T8/xw3/ABNQpU+EmvGS75XX
ckNL364n6iNxWk8TpV2qTnO+yN212LZ3DTFytD2j0YxM1rTiqUPrVWoL159yG2phQdYDBYP97XlV
f1aUcv4p29SY2upPX8Ar56o